Table 1.
Primer sequence of genes
| Gene | Primer | Primer efficiency (%) | Accession number |
|---|---|---|---|
| Ghrelin | F: 5′ CGCTCTTTCCTTATGTCTCG 3′ R: 5′ TCATCCTCTTTAATCACTGGG 3′ | 96.3 | XM_051896386.1 |
| IGF | F: 5′ GTGGAGACAGGGGCTTTTA 3′ R: 5′ AAAGCAGCATTCGTCCACA 3′ | 95.4 | XM_051891268.1 |
| GAPDH | F: 5′ CCATCACAGCCACACAGAAG 3′ R: 5′ TGGAGGCTGGGATAATGTTC 3′ | 102.7 | XM_051865633.1 |
Table 2.
Growth performance of grass carp fed with probiotic Lactobacillus casei and resveratrol (RES) for 56 days
| Initial weight (g) | Final weight (g) | Weight gain (g) | FCR | SGR | Survival rate (%) | |
|---|---|---|---|---|---|---|
| T0 | 4.89±0.08 a | 10.39±0.10 a | 5.51±0.07 a | 3.27±0.04 c | 1.35±0.02 a | 100 |
| T1 | 4.93±0.09 a | 11.06±0.22 ab | 6.12±0.16 ab | 2.95±0.08 b | 1.44±0.02 ab | 100 |
| T2 | 4.84±0.14 a | 11.34±0.12 bc | 6.50±0.10 bc | 2.77±0.04 ab | 1.52±0.04 ab | 100 |
| T3 | 4.87±0.11 a | 11.84±0.19 c | 6.95±0.26 c | 2.60±0.10 a | 1.58±0.06 b | 100 |
Figure 1.
Mucosal immune components of the grass carp after 56 days of feeding with experimental diets, Lactobacillus casei and resveratrol. T0: basic food as control; T1: 1 × 108 CFU/mL Lactobacillus casei; T2: 0.3 g resveratrol/kg; T3: Lactobacillus casei + resveratrol.
Figure 2.
Liver antioxidant enzyme activity and oxidative stress indices (MDA) in the grass carp after 56 days of feeding with experimental diets, Lactobacillus casei and resveratrol. T0: basic food as control; T1: 1 × 108 CFU/mL Lactobacillus casei; T2: 0.3 g resveratrol/kg; T3: Lactobacillus casei + resveratrol.
Figure 3.
Growth gene expression in the grass carp after 56 days of feeding with experimental diets, T0: basic food as control; T1: 1 × 108 CFU/mL Lactobacillus casei; T2: 0.3 g resveratrol/kg; T3: Lactobacillus casei + resveratrol.
Figure 4.
Cumulative mortality rate of grass carp after 56 days of feeding with Lactobacillus casei and resveratrol. T0: basic food as control; T1: 1 × 108 CFU/mL Lactobacillus casei; T2: 0.3 g resveratrol/kg; T3: Lactobacillus casei + resveratrol.
Table 3.
Effect of probiotic Lactobacillus casei and resveratrol on mortality rate and the relative percentage of survival (RPS) of grass carp after 14 days post-challenge by Aeromonas hydrophila
| Treatment | Mortality rate (%) | Survival rate (%) | RPS |
|---|---|---|---|
| T0 | 73.33 b | 26.67 a | – |
| T1 | 63.33 ab | 36.77 ab | 10.00 |
| T2 | 50.00 a | 50.00 b | 28.57 |
| T3 | 50.00 a | 50.00 b | 28.67 |