Skip to main content
Have a personal or library account? Click to login
Development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of Globodera ellingtonae
             Cover

Development of a loop-mediated isothermal amplification assay for rapid and sensitive detection of Globodera ellingtonae

Open Access
|Jul 2026

Figures & Tables

Figure 1

Optimization of LAMP assay for Globodera ellingtonae. (a) amplification of the cm gene using species-specific LAMP outer primers (F3 and B3), resolved on 1.5% agarose gel. Lane:100 bp DNA ladder; Lanes 2 and 3: Globodera ellingtonae (Ge); lanes 4 and 5: Globodera rostochiensis (Gr); and lanes 6 and 7: Globodera pallida (Gp). (b) qPCR amplification curves for the cm gene of Globodera ellingtonae (Ge); Globodera rostochiensis (Gr); and Globodera pallida (Gp). (c) Optimization of LAMP amplification temperature from 56 to 66℃, analyzed on 1.5% agarose gel. The LAMP assay conduced at 62℃ produced the brightest bend on the gel. (d) Colorimetric closed tube LAMP assay at the amplification temperature from 56 to 66℃ visualized under visible light (top) and UV illumination (bottom). Here, positive reactions appear green, whereas negative reactions and non-template control (NTC) remain orange in color due to staining with SYBR Green I dye.

Figure 2

Optimization of LAMP assay for Globodera ellingtonae. (a) Optimization of LAMP amplification time from 30 to 90 min, analyzed on 1.5% agarose gel. The LAMP assay conducted at 30 min produced the brightest bend on the gel. (b) Colorimetric closed tube LAMP assay at the amplification temperature from 30 to 90 min visualized under visible light (top) and UV illumination (bottom). (c) Optimized LAMP reaction compared with NTC under visible light (top) and UV illumination (bottom). Here, positive reactions appear green, whereas negative reactions and NTC remain orange in color due to staining with SYBR Green I dye.

Figure 3

Specificity and sensitivity of the close-tube LAMP assay for G. ellingtonae. (a) Sensitivity of the LAMP assay using serially tenfold diluted gDNA of G. ellingtonae starting from 1 ng to 10 fg, visualized by 1.5% agarose gel electrophoresis. Each reaction contained 1 µL of template DNA per assay. The LAMP assay consistently detected till 100 fg. (b) Colorimetric closed tube LAMP assay visualized under visible light (top) and UV illumination (bottom). Here, positive reactions appear green, whereas negative reactions remain orange in color due to staining with SYBR Green I dye (c) qPCR amplification of serially diluted G. ellingtonae gDNA. (d) Specificity of the LAMP assay using G. ellingtonae specific primers evaluated against gDNA from G. pallida (Gp), G. rostochiensis (Gr), G. ellingtonae (Ge), and NTC. Amplification was resolved in 1.5% agarose gel. (e) Colorimetric closed tube LAMP assay visualized under visible light (top) and UV illumination (bottom). (f) qPCR specificity assay performed using G. ellingtonae specific primers with gDNA from G. ellingtonae, G. pallida, and G. rostochiensis.

Optimized LAMP reaction parameters for Globodera pallida, Globodera rostochiensis, and Globodera ellingtonae

OptimizationOptimized LAMP reaction for G. pallida Optimized LAMP reaction for G. rostochiensis Optimized LAMP reaction for G. ellingtonae
dNTPs (mM L−1)0.2–1.82.12.12.1
MgSO4 (mM L−1)2–101.21.41.4
Bst DNA Polymerase (U µL−1)0.04–0.120.080.080.08
Temperature (℃)54–66606262

Oligonucleotide sequences of LAMP primers targeting the cm gene for Globodera ellingtonae, Globodera rostochiensis, and Globodera pallida_

SpeciesPrimerTypeSequence (5′–3′)Length (bp)TmTarget region length (bp)
Globodera ellingtonae Ge-F3Forward outerCCAGCAGATTCTTTTTTACATCA2357.08∼315
Ge-B3Backward outerAGTCGGCTTACAACACAT1855.37
Ge-FIPForward innerATTGCGCAAAATGATTTCCTCCGAAT ACTTCCCAAAAGATTACCTAAC48
Ge-BIPBackward innerTGTGCCTTCATGAAGAACATTGATCCGTTGTCGATTTCGTT41
Ge-LPLoopTCAAATTTGTCGTTGGGATGGAAGG25
Globodera rostochiensis Gr-F3Forward outerTCTTCATTGTCGGCATGG1856.54∼297
Gr-B3Backward outerACCTTTTTTACCTGAATGACTT2255.59
Gr-FIPForward innerCAACCTTTTCCCGCTCGAAATCGTTG GCCAAAGATGTGGT40
Gr-BIPBackward innerGCGAAGAGTGCCGGGATAAGAGCGTCCATTTGGTCTTG38
Gr-LPLoopCAACTACGGGGAGCCGTTTT20
Globodera pallida Gp-F3Forward outerTTTCCAAAAGATTGCCTAGC2055.74∼285
Gp-B3Backward outerCGTTTAGTGACCGTACCT1855.06
Gp-FIPForward innerCAATGTTCTTCATGAAGGCACAGTCACAACAAATGCAAGTCATCG45
Gp-BIPBackward innerCCAAACGGAAACGGAATCCCTGATTTGGCTTACAACACAT40
Gp-LPLoopGGACTTGCGCAAAATGATTTCCTC24
DOI: https://doi.org/10.2478/jofnem-2026-0017 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Page range: 208 - 219
Submitted on: Mar 30, 2026
Accepted on: May 23, 2026
Published on: Jul 7, 2026
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2026 Chandni Shah, Louise-Marie Dandurand, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.