Figure 1.
(A) Sampling location of adult stable flies (Stomoxys calcitrans). (B—F) Larval form of the mermithid nematode from Gifu. (B) Whole body. (C, D) Anterior part and its extremity. (E, F) Posterior part and its extremity with a tail appendage (arrowhead).
Table 1.
Detection of parasitic nematodes from Stomoxys calcitrans on three farms in the Gifu Prefecture, Japan.
| Farm | Location | Sampling date | Total stable flies (Number) | Parasitized stable flies (Number) | Total nematodes (Number) |
|---|---|---|---|---|---|
| Dairy cattle farm | |||||
| F1 | Gifu | 11 Oct 2021 | 80 | 1 | 1a |
| 15 Sep 2022 | 140 | 0 | 0 | ||
| 20 Sep 2023 | 112 | 0 | 0 | ||
| Subtotal | 332 | 1 | 1 | ||
| F2 | Yourou | 8 Oct 2021 | 17 | 1 | 1b |
| 18 Oct 2022 | 38 | 0 | 0 | ||
| 11 Oct 2023 | 27 | 0 | 0 | ||
| Subtotal | 82 | 1 | 1 | ||
| Sheep farm | |||||
| F3 | Nakatsugawa | 29 Jul 2022 | 72 | 1 | 1c |
| Total | 486 | 3 | 3 | ||
Figure 2.
Phylogenetic trees of Mermithidae with known genus-level identifications based on 18S (A) and 28S (B) rDNA using the maximum-likelihood method. Arrowheads indicate the mermithids sequenced in this study. Bootstrap values above 50% are indicated at the phylogenetic tree node.
Figure 3.
Phylogenetic tree of Mermithidae with known hosts based on 18S rDNA sequences using the maximum-likelihood method. Arrowheads indicate the mermithids sequenced in this study. The red frame includes mermithids recorded from Japan. Bootstrap values above 65% are indicated at the phylogenetic tree node.
Figure 4.
Phylogenetic tree of unidentified species of mermithid nematodes parasitizing insects in Japan based on 18S rDNA sequences (A) using the maximum-likelihood method and (B) distribution map of mermithids included in Ovomermis sinensis, Hexamermis sp., and Amphimermis sp. clusters. Ovomermis sinensis (KU177046), Hexamermis agrotis (DQ530350), Hexamermis popilliae (MF040823), Romanomerimis sichuanensis (EF612769), and Amphimermis enzoni (MT021436) have been identified in other countries and used as reference species in the phylogenetic tree. Arrowheads indicate the mermithids isolated in Gifu and sequenced in this study. Bootstrap values above 65% are indicated at the phylogenetic tree node.
Supplementary Table S1.
Mermithid nematodes reported in Japan.
| Species | Location | Host | Reference |
|---|---|---|---|
| Agamermis unka | Hiroshima | Sogatella furcifera Nilaparvata lugens (Homoptera: Delphacidae) | Hidaka and Andow, 2017 |
| Amphimermis zuimushi | Shizuoka | Chilo simplex Butler (Lepidoptera: Pyralidae) | Kaburaki and Imamura, 1932 |
| Gastromermis mesostoma lsomermis bipapillatus | Fukuoka, Kagoshima, Oita | Simulium japonicum (Diptera: Simuliidae) | Poinar et al., 1986 |
| Hexamermis sp. Mermithidae sp. | Mie, Saga, Shizuoka | Glaucias subpunctatus Plautia stali (Hemiptera: Parastrachiidae, Pentatomidae) | Watanabe et al., 2021 |
| Mermithidae sp. | Hokkaido | Bombus pseudobaicalensis Vogt (Hymenoptera: Bombinae) | Kubo et al., 2016 |
| Mermithidae sp. | Kanagawa | Ligidium sp. (Isopoda: Ligiidae) | Yoshino and Waki, 2021 |
| Mermithidae sp. | Hokkaido | Eriosoma auratum (Hemiptera: Aphididae) | Tong et al., 2021 |
| Mermithidae sp. | Saga, Nagasaki, Kagoshima | Parastrachia japonensis Plautia stali (Hemiptera: Parastrachiidae, Pentatomidae) | Iryu et al., 2020 |
| Mermithidae sp. | Kyoto | Pardosa pseudoannulata (Araneae: Lycosidae) | Iida et al., 2003 |
Supplementary Table S2.
Primers and PCR conditions used in this study.
| Denaturation | Annealing | Extension | Cycles | ||||
|---|---|---|---|---|---|---|---|
| 18S rDNA | MF | CAAGGACGAAAGTTAGAGGTTC | 95°C, 30sec | 50°C, 30sec | 72°C, 45sec | 40 | Kobylinski et al. 2012 |
| MR | GGAAACCTTGTTACGACTTTTA | ||||||
| KuboF | ATGCATGTCTAAGCACATGCC | 95°C, 30sec | 50°C, 1min | 72°C, 2min | 40 | Kubo et al. 2016 | |
| KuboR | AACCTTGTTACGACTTTTACTTC | ||||||
| newF | AGTTATCTACTTGGATAACTGTG | This study | |||||
| 28S rDNA | F (3745-3764) | AGCGGAGGAAAAGAAACTAA | 95°C, 30sec | 62°C, 30sec | 72°C, 1min | 35 | Nadler et al. 1998 |
| R (4359-4377) | ATCCGTGTTTCAAGACGGG | ||||||
| LSU-F | ACAAGTACCGTGAGGGAAAGTTG | 94°C, 30sec | 45°C, 1min | 72°C, 2min | 40 | Tong et al. 2021 | |
| LSU-R | TCGGAAGGAACCAGCTACTA |
Supplementary Table S3.
Mermithid nematodes used in phylogenetic analysis of 18S and 28S rDNA retrieved from GenBanka.
| Organism | Location | Host | Accession number | Reference | |
|---|---|---|---|---|---|
| 18S rDNA | 28S rDNA | ||||
| Agamermis changshaensis | - | - | DQ628908 | - | Unpublished |
| Agamermis changshaensis | - | - | - | EF617371 | Unpublished |
| Agamermis xianyangensis | - | - | EF617352 | EF617370 | Unpublished |
| Agamermis sp. | Argentina United States | Armadillidium vulgare (Isopoda: Armadillidiidae) | OP380610 | - | Unpublished |
| Megacopta cribraria (Hemiptera: Plataspidae) | KX173336 | - | Stubbins et al. 2016 | ||
| - | Environment | DQ665653 | - | Unpublished | |
| Allomermis solenopsii | - | - | DQ533953 | - | Unpublished |
| Amphimermis enzoni | Argentina | Ischnura fluviatilis Rhionaeschna bonaerensis (Odnata) | MT021436 | - | Rusconi et al. 2020 |
| Amphimermis sp. | China | - | EF617354 | EF617372 | Unpublished |
| - | EF617355 | EF617373 | |||
| Gastromermis sp. | - | - | DQ533954 | - | Unpublished |
| - | - | AY146543 | - | Unpublished | |
| Gastromermis viridis | Canada | Simulium squamosum (Diptera: Simuliidae) | EU792502 | - | St-Onge et al. 2008 |
| Heleidomermis sp. | - | - | DQ533955 | - | Unpublished |
| Hexamermis agrotis | - | - | DQ530350 | - | Unpublished |
| - | - | - | EF617369 | Unpublished | |
| Turkey | - | - | KC784667 | Unpublished | |
| Hexamermis popilliae | Italy | Popillia japonica (Coleoptera: Scarabaeidae) | MF040823 | MF040824 | Mazza et al. 2017 |
| - | MF040826 | ||||
| Hexamermis sp. | Japan | Glaucias subpunctatus (Hemiptera: Pentatomidae) | LC661690 | - | Watanabe et al. 2021 |
| LC661691 | - | ||||
| Isomermis lairdi | Ghana | Simulium squamosum (Diptera: Simuliidae) | FN400899 | - | Crainey et al. 2009 |
| FN400892 | - | ||||
| Limnomermis sp. | - | - | KJ636371 | - | Unpublished |
| Mermis nigrescens | Viet Nam | Orthomorpha coarctata (Polydesmida: Paradoxosomatidae) | OQ341432 | - | Unpublished |
| New | Forficula auricularia (Dermaptera: Forficulidae) | KF583882 | KF886019 | Unpublished | |
| Zealand | Plant | KF583883 | KF886018 | ||
| - | - | AF036641 | - | Blaxter et al. 1998 | |
| Mermithidae sp. | Japan | Parastrachia japonensis (Hemiptera: Parastrachiidae) | LC512368 | - | Iryu et al. 2020 |
| LC512369 | - | ||||
| LC512370 | - | ||||
| LC512371 | - | ||||
| Japan | Plautia stali (Hemiptera: Parastrachiidae) | LC512372 | - | Iryu et al. 2020 | |
| Japan | Ligidium sp. (Isopoda: Ligiidae) | LC596451 | LC500234 | Yoshino and Waki, 2021 | |
| LC596452 | LC500235 | ||||
| Japan | Eriosoma auratum (Hemiptera: Aphididae) | MW649131 | MW653323 | Tong et al. 2021 | |
| Japan | Bombus pseudobaicalensis (Hymenoptera: Apidae) | LC114020 | - | Kubo et al. 2016 | |
| Japan | Glaucias subpunctatus (Hemiptera: Pentatomidae) | LC661692 | - | Watanabe et al. 2021 | |
| Japan | Plautia stali (Hemiptera: Parastrachiidae) | LC661693 | - | Watanabe et al. 2021 | |
| Japan | Stomoxys calcitrans (Diptera: Muscidae) | LC788412 | LC788415 | This study | |
| LC788413 | LC788416 | ||||
| LC788414 | LC788417 | ||||
| Australia | Kosciscola tristis (Orthoptera: Acrididae) | JQ894731 | - | Umbers et al. 2015 | |
| JQ894732 | - | ||||
| Mesomermis camdenensis | Canada | Simulium squamosum (Diptera: Simuliidae) | EU792504 | - | St-Onge et al. 2008 |
| Mesomermis flumenalis | Canada | Simulium squamosum (Diptera: Simuliidae) | EU792506 | - | St-Onge et al. 2008 |
| Octomyomermis huazhongensis | - | - | EF617353 | EF617368 | Unpublished |
| Ovomermis sinensis | China | Spodoptera frugiperda (Lepidoptera: Noctuidae) | MN367957 | MN367955 | Sun et al. 2020 |
| MN367956 | MN367954 | ||||
| Poland | Cerapteryx graminis (Lepidoptera: Noctuidae) | KU177046 | - | Unpublished | |
| - | - | DQ520879 | - | Unpublished | |
| Pheromermis sp. | France | Vespa velutina (Hymenoptera: Vespidae) | KR029620 | KR029622 | Villemant et al. 2015 |
| KR029621 | KR029623 | ||||
| Romanomermis culicivorax | - | Culex sp. (Diptera: Culicidae) | DQ418791 | - | Unpublished |
| - | - | - | EF417153 | Sonnenberg et al. 2007 | |
| Romanomermis iyengari | - | - | JX021620 | - | Unpublished |
| Romanomermis sichuanensis | - | Culex sp. (Diptera: Culicidae) | EF612769 | EF617366 | Unpublished |
| Romanomermis wuchangensis | - | Culex quinquefasciatus (Diptera: Culicidae) | DQ520878 | EF617365 | Unpublished |
| Strelkovimermis spiculatus | Argentina | Aedes albifasciatus (Diptera: Culicidae) | KP270703 | - | Belaich et al. 2015 |
| - | Aedes sp. (Diptera: Culicidae) | DQ665654 | - | Unpublished | |
| Thaumamermis cosgrovei | - | - | DQ665655 | - | Unpublished |
| Thaumamermis zealandica | New Zealand | Bellorchestia quoyana (Amphipoda: Talitridae) | KY264164 | KY264165 | Unpublished |
Supplementary Table S4.
Information on locations of nematode species and hosts corresponding to nematodes used in Figure 4, a.
| (Country) | Family | Genus | Species | |||
|---|---|---|---|---|---|---|
| Ovomermis / Hexamermis cluster | ||||||
| Ovomermis sinensis | KU177046 | (Poland) | Noctuidae | Cerapteryx | C. graminis | Unpublished |
| Hexamermis sp. | LC661690 | Mie | Pentatomidae | Glaucias | G. subpunctatus | Watanabe et al., 2021 |
| LC661691 | Mie | Pentatomidae | Glaucias | G. subpunctatus | Watanabe et al., 2021 | |
| Mermithidae sp. | LC788413 | Gifu | Muscidae | Stomoxys | S. calcitrans | This study |
| LC788412 | Gifu | Muscidae | Stomoxys | S. calcitrans | This study | |
| LC512368 | Saga | Parastrachiidae | Parastrachia | P. japonensis | Iryu et al., 2020 | |
| LC512372 | Saga | Parastrachiidae | Parastrachia | P. japonensis | Iryu et al., 2020 | |
| LC661692 | Shizuoka | Pentatomidae | Glaucias | G. subpunctatus | Watanabe et al., 2021 | |
| LC114020 | Hokkaido | Apidae | Bombus | B. pesudobaicalensis | Kubo et al., 2016 | |
| LC661693 | Mie | Pentatomidae | Plautia | P. stali | Watanabe et al., 2021 | |
| LC596451 | Kanagawa | Ligiidae | Ligidium | sp. | Yoshino and Waki, 2021 | |
| LC596452 | Kanagawa | Ligiidae | Ligidium | sp. | Yoshino and Waki, 2021 | |
| Hexamermis agrotis | DQ530350 | (China) | - | - | - | Unpublished |
| Hexamermis popilliae | MF040823 | (Italy) | Scarabaeidae | Popillia | P. japonica | Mazza et al., 2017 |
| Amphimermis cluster | ||||||
| Amphimermis enzoni | MT021436 | (Argentina) | Coenagrionidae | Ischnura | I. fluviatilis | Rusconi et al., 2020 |
| Aeshnidae | Rhionaeschna | R. bonariensis | ||||
| Mermithidae sp. | LC788414 | Gifu | Muscidae | Stomoxys | S. calcitrans | This study |
| LC512369 | Saga | Parastrachiidae | Parastrachia | P. japonensis | Iryu et al., 2020 | |
| LC512371 | Kagoshima | Parastrachiidae | Parastrachia | P. japonensis | Iryu et al., 2020 | |
| LC512370 | Kagoshima | Parastrachiidae | Parastrachia | P. japonensis | Iryu et al., 2020 | |
| Others | ||||||
| Mermithidae sp. | MW649131 | Hokkaido | Aphididae | Eriosoma | E. auratum | Tong et al., 2021 |
| Romanomermis sichuanensis | EF612769 | (China) | - | - | - | Unpublished |