Skip to main content
Have a personal or library account? Click to login
First Report of Mermithidae (Enoplea: Mermithida) Parasitizing Adult Stable Flies in Japan Cover

First Report of Mermithidae (Enoplea: Mermithida) Parasitizing Adult Stable Flies in Japan

Open Access
|May 2024

Full Article

Mermithid nematodes (Enoplea: Mermithidae) parasitize a wide range of invertebrates (Nickle, 1972; Platzer, 2007; Poinar, 2015), and previous studies have reported several cases of mermithid parasitism in Japan (Supplementary Table S1). Mermithids have gained attention as biological alternatives to chemical insecticides for the control of agricultural pests (Nickle, 1981; Hidaka and Andow, 2017) and disease vectors (Molloy, 1981; Platzer, 1981; Sanad et al., 2017) because of their ability to cause host mortality. However, biological knowledge of most mermithids, including their host preferences, distribution, and parasitism rates, remains limited. Additionally, the species-level classification of mermithids is challenging because of the scarcity of published morphological information and DNA sequence data for Mermithidae.

Stable flies (Diptera: Muscidae: Stomoxys calcitrans) are economically significant blood-feeding pests that pose a threat to livestock globally. Their painful bites not only disrupt the grazing behavior of livestock but also cause direct harm through blood loss, tissue damage, and allergic reactions (Taylor et al., 2012; Machtinger et al., 2021). Moreover, stable flies may play a crucial role in the spread of infectious diseases, particularly in livestock, because of their potential as mechanical vectors of various pathogens, including viruses, bacteria, protozoans, and helminths (Baldacchino et al., 2013; Cook, 2020; Rochon et al., 2021).

In this study, we observed nematodes resembling mermithids inside adult stable flies at three farms in different regions of the Gifu Prefecture, Japan. To the best of our knowledge, there has been no report on nematodes in adult stable flies in Japan. To characterize them morphologically and molecularly, microscopic observations and sequence analyses of the 18S and 28S rDNA genes were carried out. Subsequently, the phylogenetic relationships of the species to the available Mermithidae sequences were analyzed based on the rDNA sequences.

Materials and Methods

Adult stable fly sampling and nematode collection

During our study period on surveillance and control measures for flies in farms (Shimizu et al., 2023), adult stable flies were collected from three farms (F1, F2, and F3) across different geographic locations in the Gifu Prefecture, Japan (Table 1 and Figure 1A). Flies were captured once annually from 2021 to 2023 at farms F1 and F2, and once at farm F3 in 2022. Flies inside and outside the livestock barns were captured using butterfly nets. After collection, the flies were transferred to our laboratory and killed by placing them at −80°C. At the time of the use of flies, three nematodes were unexpectedly isolated individually from three flies. The isolated nematodes were fixed in 70% ethanol. Nematodes 1 (Gifu), 2 (Yourou), and 3 (Nakatsugawa) were isolated from stable flies captured from farms F1, F2, and F3, respectively (Table 1).

Figure 1.

(A) Sampling location of adult stable flies (Stomoxys calcitrans). (B—F) Larval form of the mermithid nematode from Gifu. (B) Whole body. (C, D) Anterior part and its extremity. (E, F) Posterior part and its extremity with a tail appendage (arrowhead).

Table 1.

Detection of parasitic nematodes from Stomoxys calcitrans on three farms in the Gifu Prefecture, Japan.

FarmLocationSampling dateTotal stable flies (Number)Parasitized stable flies (Number)Total nematodes (Number)
Dairy cattle farm
F1Gifu11 Oct 20218011a
15 Sep 202214000
20 Sep 202311200
Subtotal33211
F2Yourou8 Oct 20211711b
18 Oct 20223800
11 Oct 20232700
Subtotal8211
Sheep farm
F3Nakatsugawa29 Jul 20227211c
Total48633

a Nematode 1 (Gifu).

b Nematode 2 (Yourou).

c Nematode 3 (Nakatsugawa).

Morphological and genetic analyses

For morphological observation, the specimens were cleared in a glycerol-ethanol solution (5% glycerol in 70% ethanol) by the evaporation of ethanol and were mounted on glass slides with 50% glycerol solution. The specimens were viewed under Nikon Optiphot (Nikon, Tokyo, Japan) and Olympus BX50 (Olympus, Tokyo, Japan) microscopes equipped with a commercial camera Lucida.

A molecular approach was used to identify the nematode species. Total DNA was extracted from the middle part of the nematode body using a DNeasy Blood and Tissue Kit (QIAGEN, Venlo, Netherlands). Several primer sets were used to amplify 18S and 28S rDNA (Supplementary Table S2). PCR was performed with GoTaq Hot Start Green Master Mix (Promega, Madison, WI, USA) using a Veriti thermal cycler (Applied Biosystems, Foster City, CA, USA). The PCR conditions are listed in Supplementary Table S2. The PCR products were purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Duren, Germany), and the nucleotide sequences were determined via direct sequencing using a BigDye Terminator Cycle Sequencing Kit v3.1 (Applied Biosystems). DNA sequences were confirmed and edited using Genetyx-Win version 13 software (Genetyx, Tokyo, Japan), and the species were identified based on the results of the Basic Local Alignment Search Tool (BLAST) analysis. The obtained sequences were deposited in the DDBJ/EMBL/GenBank database under the following accession numbers: LC788412 to LC788414 for 18S rDNA and LC788415 to LC788417 for 28S rDNA.

The DNA sequences of the mermithids available in the NCBI database are highly variable in length. Therefore, to include reference sequences from known species in the phylogenetic analysis, we aligned 327 to 986 bp for the 18S and 296 to 822 bp for the 28S rDNA sequences. Furthermore, to include reference sequences with known hosts in the phylogenetic analysis, we aligned 327 to 1011 bp of the 18S rDNA sequences. Phylogenetic trees were constructed using the maximum-likelihood method with the Kimura two-parameter model, and the reliability of the branches was evaluated using 1,000 replicates. In total, 76 sequences of previously reported mermithid nematodes from Japan and other countries were used for the phylogenetic analysis (Supplementary Table S3).

Results

Three nematodes were found individually in three of the 486 stable flies from three farms in Gifu, Japan (Table 1). At each of the farms (F1, F2, and F3), only a single adult stable fly of the 332, 82, and 72 flies, respectively, sampled was parasitized by nematodes, indicating a low prevalence of the nematode. Previous studies have reported negative effects on hosts infected with mermithids, including deformation (Muñoz-Muñoz et al., 2016; Mazza et al., 2017). However, differences in the general appearance were not observed between the three infected flies and the other flies.

Morphological characterization

The morphological characteristics of the mermithids are shown in Figures 1B1F. The nematodes were wire-like in shape and had a milky-white cuticle sheath. The specimen from farm F1 was ca. 12.5 cm in length and ca. 0.25 mm in width. Among the nematodes, the sample from farm F1 (Figure 1A) could be studied morphologically, as it had relatively complete head and tail extremities (Figures 1C1F). The head had a slender esophagus, and the tail had an appendage on the posterior end. Thus, this nematode was a juvenile belonging to the family Mermithidae. Based on the general appearance and host range, the other two degenerated individuals from farms F2 and F3 could belong to the same family and stage (Poinar, 1975). This is further supported by the sequence analysis described in the following sections.

Molecular characterization

The lengths of the three 18S rDNA sequences were as follows: Gifu, 1,662 bp; Yourou, 1,733 bp; and Nakatsugawa, 1,719 bp. BLAST analysis showed that nematodes from Gifu and Youro shared 99.94% (1603/1604) and 99.82% (1633/1636) identity, respectively, with Hexamermis sp. (LC661691) isolated from Glaucias subpunctatus (Hemiptera) in Mie, Japan (Watanabe et al., 2020). In addition, the Nakatsugawa specimen shared 99.21% (630/635) identity with Amphimermis enzoni (MT021436) isolated from Ischnura fluviatilis and Rhionaeschna bonariensis (Odonata) in Argentina (Rusconi et al, 2020) and 99.10% (774/781) with Amphimermis sp. (EF617354) isolated in China. The lengths of the three 28S rDNA sequences were as follows: Gifu, 1,103 bp; Yourou, 1,103 bp; and Nakatsugawa, 1,082 bp. BLAST analysis showed that Gifu and Yourou exhibited 90.39% (715/791) and 90.52% (716/791) identity, respectively, with Hexamermis agrotis (KC784667) isolated in Turkey. In addition, Nakatsugawa shared 96.18% sequence identity with Amphimermis sp. (EF617372) isolated in China.

Phylogenetic trees based on the alignment of 18S and 28S rDNA sequences classified the mermithids from Gifu and Yourou into clusters containing Ovomermis sinensis reported in China (MN3679544 to MN367957, and DQ520879) and Poland (KU177046), and Hexamermis sp. (LC661690 and LC661691) reported in Japan, whereas the specimen from Nakatsugawa fell into a cluster containing Amphimermis sp. reported in Argentina (MT021436) and China (EF617354, EF617355, and EF617372) (Figure 2).

Figure 2.

Phylogenetic trees of Mermithidae with known genus-level identifications based on 18S (A) and 28S (B) rDNA using the maximum-likelihood method. Arrowheads indicate the mermithids sequenced in this study. Bootstrap values above 50% are indicated at the phylogenetic tree node.

A phylogenetic tree, constructed using 18S rDNA sequences and referencing known host information, revealed that specimens from Gifu and Yourou formed a distinct cluster encompassing hosts such as Isopoda, Hemiptera, Hymenoptera, and Lepidoptera (Figure 3). In contrast, the Nakatsugawa specimen was positioned within a cluster that included Hemiptera and Odonata hosts. Additionally, these mermithids could be categorized into the same clusters as other mermithids recorded from Japan, rather than in clusters within which the host species were categorized (Figure 3). Phylogenetic analysis of 13 unidentified species of mermithids that parasitize insects in Japan (registered in GenBank) categorized the three mermithids we sampled into clusters with O. sinensis, Hexamermis sp., or Amphimermis sp., with one exception (MW649131 isolated from Erisoma auratum in Hokkaido; Figure 4, Supplementary Table S4).

Figure 3.

Phylogenetic tree of Mermithidae with known hosts based on 18S rDNA sequences using the maximum-likelihood method. Arrowheads indicate the mermithids sequenced in this study. The red frame includes mermithids recorded from Japan. Bootstrap values above 65% are indicated at the phylogenetic tree node.

Figure 4.

Phylogenetic tree of unidentified species of mermithid nematodes parasitizing insects in Japan based on 18S rDNA sequences (A) using the maximum-likelihood method and (B) distribution map of mermithids included in Ovomermis sinensis, Hexamermis sp., and Amphimermis sp. clusters. Ovomermis sinensis (KU177046), Hexamermis agrotis (DQ530350), Hexamermis popilliae (MF040823), Romanomerimis sichuanensis (EF612769), and Amphimermis enzoni (MT021436) have been identified in other countries and used as reference species in the phylogenetic tree. Arrowheads indicate the mermithids isolated in Gifu and sequenced in this study. Bootstrap values above 65% are indicated at the phylogenetic tree node.

Discussion

This is the first report of mermithids isolated from adult stable flies in Japan. This study identified mermithid parasitization in merely three out of 486 flies. Notably, the occurrence of mermithid parasitism in adult stable flies has been previously reported only once, originating from cattle farms and suburbs in the USA (Smith et al., 1987). These results suggest that mermithid parasitism is extremely rare in adult stable flies.

Morphological identification of mermithids must be performed using adults, which constitute the free stage of these parasites, as the genitalic structures and other organs necessary for identification are fully formed specifically in this stage (Poinar, 1979). However, the Mermithidae nematodes obtained in this study were in the larval form; therefore, accurate identification could not be performed. Species identification based on morphological observation remains unclear, whereas sequence analysis is a well-developed powerful tool for genetic identification (St-Onge et al., 2008; Yoshino et al., 2021). Molecular phylogenetic analysis revealed that the mermithids parasitizing adult stable flies formed two different clusters with O. sinensis and Hexamermis sp. or Amphimermis sp. and that these clusters included hosts of various orders. The high sequence identities of the stable fly mermithids with these aforementioned species suggest that they may belong to these or closely related genera.

In terrestrial mermithids, including Hexamermis sp. and Amphimermis sp., infective juveniles seek out a host and bore through the host’s body wall into the body cavity (Nguyen, 2011). Additionally, Hexamermis sp. (Achinelly and Camino, 2008) and Amphimermis sp. (Baker and Poinar, 1994) parasitism has been reported in Coleoptera, Dermaptera, Diptera, Hemiptera, Homoptera, Hymenoptera, Lepidoptera, Odonata, and Orthoptera. Therefore, stable flies may also be viable hosts for these terrestrial mermithids.

Mermithids that parasitize adult stable flies tended to be classified into the same clusters as mermithids previously recorded in Japan, and most unidentified species of mermithids that parasitize insects in Japan were classified into clusters with O. sinensis and Hexamermis sp. or Amphimermis sp. (Figure 4). Our results, along with those of previous reports (Supplementary Table S1), confirm that O. sinensis, Hexamermis sp., and Amphimermis sp. are distributed in Japan.

Acknowledgments

This study was supported in part by JSPS KAKENHI grants (21H02357, 22F22097, 22KF0161, and 23K21269), the Morinaga Foundation for Health and Nutrition, the Hirose Foundation, the Kobayashi Foundation, and the Yanmar Environmental Sustainability Support Association, Japan.

Supplementary materials

Supplementary Table S1.

Mermithid nematodes reported in Japan.

SpeciesLocationHostReference
Agamermis unkaHiroshimaSogatella furcifera Nilaparvata lugens (Homoptera: Delphacidae)Hidaka and Andow, 2017
Amphimermis zuimushiShizuokaChilo simplex Butler (Lepidoptera: Pyralidae)Kaburaki and Imamura, 1932
Gastromermis mesostoma lsomermis bipapillatusFukuoka, Kagoshima, OitaSimulium japonicum (Diptera: Simuliidae)Poinar et al., 1986
Hexamermis sp. Mermithidae sp.Mie, Saga, ShizuokaGlaucias subpunctatus Plautia stali (Hemiptera: Parastrachiidae, Pentatomidae)Watanabe et al., 2021
Mermithidae sp.HokkaidoBombus pseudobaicalensis Vogt (Hymenoptera: Bombinae)Kubo et al., 2016
Mermithidae sp.KanagawaLigidium sp. (Isopoda: Ligiidae)Yoshino and Waki, 2021
Mermithidae sp.HokkaidoEriosoma auratum (Hemiptera: Aphididae)Tong et al., 2021
Mermithidae sp.Saga, Nagasaki, KagoshimaParastrachia japonensis Plautia stali (Hemiptera: Parastrachiidae, Pentatomidae)Iryu et al., 2020
Mermithidae sp.KyotoPardosa pseudoannulata (Araneae: Lycosidae)Iida et al., 2003
Supplementary Table S2.

Primers and PCR conditions used in this study.

DenaturationAnnealingExtensionCycles
18S rDNAMFCAAGGACGAAAGTTAGAGGTTC95°C, 30sec50°C, 30sec72°C, 45sec40Kobylinski et al. 2012
MRGGAAACCTTGTTACGACTTTTA
KuboFATGCATGTCTAAGCACATGCC95°C, 30sec50°C, 1min72°C, 2min40Kubo et al. 2016
KuboRAACCTTGTTACGACTTTTACTTC
newFAGTTATCTACTTGGATAACTGTGThis study
28S rDNAF (3745-3764)AGCGGAGGAAAAGAAACTAA95°C, 30sec62°C, 30sec72°C, 1min35Nadler et al. 1998
R (4359-4377)ATCCGTGTTTCAAGACGGG
LSU-FACAAGTACCGTGAGGGAAAGTTG94°C, 30sec45°C, 1min72°C, 2min40Tong et al. 2021
LSU-RTCGGAAGGAACCAGCTACTA
Supplementary Table S3.

Mermithid nematodes used in phylogenetic analysis of 18S and 28S rDNA retrieved from GenBanka.

OrganismLocationHostAccession numberReference
18S rDNA28S rDNA
Agamermis changshaensis--DQ628908-Unpublished
Agamermis changshaensis---EF617371Unpublished
Agamermis xianyangensis--EF617352EF617370Unpublished
Agamermis sp.Argentina United StatesArmadillidium vulgare (Isopoda: Armadillidiidae)OP380610-Unpublished
Megacopta cribraria (Hemiptera: Plataspidae)KX173336-Stubbins et al. 2016
-EnvironmentDQ665653-Unpublished
Allomermis solenopsii--DQ533953-Unpublished
Amphimermis enzoniArgentinaIschnura fluviatilis Rhionaeschna bonaerensis (Odnata)MT021436-Rusconi et al. 2020
Amphimermis sp.China-EF617354EF617372Unpublished
-EF617355EF617373
Gastromermis sp.--DQ533954-Unpublished
--AY146543-Unpublished
Gastromermis viridisCanadaSimulium squamosum (Diptera: Simuliidae)EU792502-St-Onge et al. 2008
Heleidomermis sp.--DQ533955-Unpublished
Hexamermis agrotis--DQ530350-Unpublished
---EF617369Unpublished
Turkey--KC784667Unpublished
Hexamermis popilliaeItalyPopillia japonica (Coleoptera: Scarabaeidae)MF040823MF040824Mazza et al. 2017
-MF040826
Hexamermis sp.JapanGlaucias subpunctatus (Hemiptera: Pentatomidae)LC661690-Watanabe et al. 2021
LC661691-
Isomermis lairdiGhanaSimulium squamosum (Diptera: Simuliidae)FN400899-Crainey et al. 2009
FN400892-
Limnomermis sp.--KJ636371-Unpublished
Mermis nigrescensViet NamOrthomorpha coarctata (Polydesmida: Paradoxosomatidae)OQ341432-Unpublished
NewForficula auricularia (Dermaptera: Forficulidae)KF583882KF886019Unpublished
ZealandPlantKF583883KF886018
--AF036641-Blaxter et al. 1998
Mermithidae sp.JapanParastrachia japonensis (Hemiptera: Parastrachiidae)LC512368-Iryu et al. 2020
LC512369-
LC512370-
LC512371-
JapanPlautia stali (Hemiptera: Parastrachiidae)LC512372-Iryu et al. 2020
JapanLigidium sp. (Isopoda: Ligiidae)LC596451LC500234Yoshino and Waki, 2021
LC596452LC500235
JapanEriosoma auratum (Hemiptera: Aphididae)MW649131MW653323Tong et al. 2021
JapanBombus pseudobaicalensis (Hymenoptera: Apidae)LC114020-Kubo et al. 2016
JapanGlaucias subpunctatus (Hemiptera: Pentatomidae)LC661692-Watanabe et al. 2021
JapanPlautia stali (Hemiptera: Parastrachiidae)LC661693-Watanabe et al. 2021
JapanStomoxys calcitrans (Diptera: Muscidae)LC788412LC788415This study
LC788413LC788416
LC788414LC788417
AustraliaKosciscola tristis (Orthoptera: Acrididae)JQ894731-Umbers et al. 2015
JQ894732-
Mesomermis camdenensisCanadaSimulium squamosum (Diptera: Simuliidae)EU792504-St-Onge et al. 2008
Mesomermis flumenalisCanadaSimulium squamosum (Diptera: Simuliidae)EU792506-St-Onge et al. 2008
Octomyomermis huazhongensis--EF617353EF617368Unpublished
Ovomermis sinensisChinaSpodoptera frugiperda (Lepidoptera: Noctuidae)MN367957MN367955Sun et al. 2020
MN367956MN367954
PolandCerapteryx graminis (Lepidoptera: Noctuidae)KU177046-Unpublished
--DQ520879-Unpublished
Pheromermis sp.FranceVespa velutina (Hymenoptera: Vespidae)KR029620KR029622Villemant et al. 2015
KR029621KR029623
Romanomermis culicivorax-Culex sp. (Diptera: Culicidae)DQ418791-Unpublished
---EF417153Sonnenberg et al. 2007
Romanomermis iyengari--JX021620-Unpublished
Romanomermis sichuanensis-Culex sp. (Diptera: Culicidae)EF612769EF617366Unpublished
Romanomermis wuchangensis-Culex quinquefasciatus (Diptera: Culicidae)DQ520878EF617365Unpublished
Strelkovimermis spiculatusArgentinaAedes albifasciatus (Diptera: Culicidae)KP270703-Belaich et al. 2015
-Aedes sp. (Diptera: Culicidae)DQ665654-Unpublished
Thaumamermis cosgrovei--DQ665655-Unpublished
Thaumamermis zealandicaNew ZealandBellorchestia quoyana (Amphipoda: Talitridae)KY264164KY264165Unpublished

a Hyphen represents that the data was not found on the database.

Supplementary Table S4.

Information on locations of nematode species and hosts corresponding to nematodes used in Figure 4, a.

(Country)FamilyGenusSpecies
Ovomermis / Hexamermis cluster
Ovomermis sinensisKU177046(Poland)NoctuidaeCerapteryxC. graminisUnpublished
Hexamermis sp.LC661690MiePentatomidaeGlauciasG. subpunctatusWatanabe et al., 2021
LC661691MiePentatomidaeGlauciasG. subpunctatusWatanabe et al., 2021
Mermithidae sp.LC788413GifuMuscidaeStomoxysS. calcitransThis study
LC788412GifuMuscidaeStomoxysS. calcitransThis study
LC512368SagaParastrachiidaeParastrachiaP. japonensisIryu et al., 2020
LC512372SagaParastrachiidaeParastrachiaP. japonensisIryu et al., 2020
LC661692ShizuokaPentatomidaeGlauciasG. subpunctatusWatanabe et al., 2021
LC114020HokkaidoApidaeBombusB. pesudobaicalensisKubo et al., 2016
LC661693MiePentatomidaePlautiaP. staliWatanabe et al., 2021
LC596451KanagawaLigiidaeLigidiumsp.Yoshino and Waki, 2021
LC596452KanagawaLigiidaeLigidiumsp.Yoshino and Waki, 2021
Hexamermis agrotisDQ530350(China)---Unpublished
Hexamermis popilliaeMF040823(Italy)ScarabaeidaePopilliaP. japonicaMazza et al., 2017
Amphimermis cluster
Amphimermis enzoniMT021436(Argentina)CoenagrionidaeIschnuraI. fluviatilisRusconi et al., 2020
AeshnidaeRhionaeschnaR. bonariensis
Mermithidae sp.LC788414GifuMuscidaeStomoxysS. calcitransThis study
LC512369SagaParastrachiidaeParastrachiaP. japonensisIryu et al., 2020
LC512371KagoshimaParastrachiidaeParastrachiaP. japonensisIryu et al., 2020
LC512370KagoshimaParastrachiidaeParastrachiaP. japonensisIryu et al., 2020
Others
Mermithidae sp.MW649131HokkaidoAphididaeEriosomaE. auratumTong et al., 2021
Romanomermis sichuanensisEF612769(China)---Unpublished

a Hyphen represents that the data was not found in the database.

DOI: https://doi.org/10.2478/jofnem-2024-0022 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Submitted on: Feb 15, 2024
Published on: May 25, 2024
Published by: Society of Nematologists, Inc.
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2024 Kaori Shimizu, Taizo Saito, Yasuhiro Takashima, Haruhiko Okada, Mitsuhiko Asakawa, Yasuo Inoshima, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.