Skip to main content
Have a personal or library account? Click to login
Complete Mitochondrial Genome of Contracaecum sp. (Nematoda: Ascarididae) from night herons in China Cover

Complete Mitochondrial Genome of Contracaecum sp. (Nematoda: Ascarididae) from night herons in China

Open Access
|Oct 2022

Full Article

Contracaecum species are nematodes that parasitize throughout the world, causing severe pathogenic influences on vertebrate and invertebrate animals, including humans (Shamsi, 2019). They have an indirect life cycle: first intermediate hosts involve a wide range of invertebrates, including cephalopods, copepods, and crustaceans; and second intermediate hosts are various fishes; and piscivorous birds are definitive hosts, causing severe diseases in birds like hemorrhages, necrosis, and severe ulcerative eosinophilic granulomas in intestinal tracts (Zhang et al., 2021). In Australia, the first anisakid nematode was detected in the human body coupled with gastrointestinal pain, diarrhea, and increasingly severe vomiting, although it was not identified at the species level (Shamsi and Butcher, 2011; Shamsi et al., 2019). Over the years, anisakidosis caused by Contracaecum was diagnosed mainly based on its morphological characteristics.

In the past decades, morphological features and molecular sequences of >100 Contracaecum species have been described (Shamsi et al., 2019; Zhang et al., 2021). However, it was challenging for nonexperts to distinguish and identify specific helminths based only on morphological features, especially for detecting cryptic species. Studies show that there are considerable differences between cryptic subspecies/species which are isolated from different hosts or geography (Shamsi et al., 2009; Mattiucci et al., 2014; Timi et al., 2014; Liu et al., 2016). The complete mitochondrial (mt) genome (mitogenome) has been evidenced as a useful molecular marker to identify and distinguish different/ similar species between related taxa, even cryptic species, especially for Contracaecum (Mohandas et al., 2014). However, only three Contracaecum species published complete mitogenome sequences, C. ogmorhini, C. osculatum, and C. rudolphii, which made it difficult to detect new/cryptic species within the genus Contracaecum. Although the complete mitogenome of Contracaecum sp., which was collected from black night herons from Beijing, China, has been published (GenBank no. MN892395), the published sequence was not characterized and detailed features were not recorded, which caused inconvenience to use it.

Therefore, in the present study, we aim to (i) reassemble and annotate the complete mitogenome of Contracaecum sp., which was isolated from black herons in Beijing, China, and describe detailed information of this sequence; (ii) based on uploaded annotated sequences of Ascaridoidea and Heterakoidea species, conduct phylogenetic analyses to verify Zhang et al. (2021) hypothesis; and (iii) provide more detailed molecular features and new useful markers for detect cryptic species within genus Contracaecum for successive studies.

Materials and Methods

Parasites and molecular identification

Helminth specimens were obtained from the digestive tracts of gray and night herons in Beijing Zoo, China. The species were washed with ultrapure water and physiological saline solution, fixed in 75% ethanol, and stored at -40°C. The specimens were preliminarily identified as Contracaecum based on hosts and primary characteristic morphology (Zhang et al., 2021). For additional examination of molecules, the total genomic DNA was extracted using a QIAampÒ DNA Micro Kit as per the manufacturer’s instructions. Based on polymerase chain reaction (PCR) amplification of partial cox1 (with primers JB3 – JB4.5) (Bowles et al., 1992; Bowles and McManus, 1994) and ITS (including ITS-1, 5.8S, and ITS-2) (with primers NC5 – NC2) (Newton et al., 1998; Chilton et al., 2001), the worms were recognized at the species level. The obtained ITS sequence was totally matched with published Contracaecum sp. (GenBank no. MW538933~36), and the partial cox1 sequence showed 99.7% identity with Porrocaecum reticulatum (GenBank no. MF113244).

Sequencing, assembling, and annotation

The genomic DNA sample was fragmented to a size of 350 bp. The DNA libraries were sequenced using high-throughput sequencing (HTS) on an Illumina Hiseq 6000 platform (Novogene Co. Ltd., Tianjin, China), and 250-bp paired-end reads were generated. The raw data were obtained and recorded in FASTQ format. Then, the reads with low-quality bases (Phred quality <5) or uncertain reads with repetitive “N” bases were filtered to acquire clean data. The partial cox1 sequence was used as the initial reference to assemble complete mt sequence of Contracaecum sp. using Geneious Prime 2022.0.1 (Kearse et al., 2012). The assembly was operated with the following parameters: (i) minimum overlap within the range of 150 bp to 200 bp; (ii) minimum overlap identity among 98% to 100%; and (iii) maximum gap of 5 bp. The assembled mitogenome was verified by long PCR with designed primers (Table S1 and Fig. S1 in Supplementary Materials).

ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/) was used to identify the start/stop codons and boundaries of protein-coding genes (PCGs). Later, two ribosomal RNAs (rRNAs, rrnL and rrnS) were framed using Tandem repeats finder (Benson, 1999). The 12 protein genes were then further confirmed with previously published Ascarididae sequence (Contracaecum osculatum, GenBank no. JN786330). The tRNAscan-SE 2.0 (Chan et al., 2021) with a cutoff score of 1.0 and MITOs (Bernt et al., 2013) were applied to search 22 potential transfer RNAs (tRNAs).

Nucleotide variation in mtDNA genomes among Contracaecum spp

Based on available mitogenome sequences of the genus Contracaecum in the NCBI, mt sequences were aligned using Clustal X1.83 to a single alignment dataset, including C. osculatum, C. rudolphii, C. ogmorhini, and Contracaecum sp. The nucleotide diversity of Contracaecum species was computed by DnaSP v5 using sliding windows (Librado and Rozas, 2009). The parameters of the sliding window were followed with 300-bp window length and a default 25-bp step site to calculate the nucleotide diversity (Pi or p). Each boundary of protein genes was identified due to mid-point position, and we then graphed nucleotide diversity for 12 protein genes from Contracaecum.

Phylogenetic analyses

A total of 41 mitogenomes of species from families Ascaridoidea and Heterakoidea were applied to analyze phylogeny with outgroups Enterobius vermicularis (GenBank accession no. EU281143) and Wellcomia siamensis (GenBank accession no. NC_016129) (Table S2 in Supplementary Material). Each amino acid sequence was aligned using a MAFFT computational algorithm (Katoh et al., 2019). The aligned sequences were then concatenated to a single alignment dataset. The ambiguous gaps in the alignment were excluded by Gblocks 0.91b with default parameters “less stringent” (Dereeper et al., 2008). Computational algorithm maximum likelihood (ML) (Guindon et al., 2010) was conducted to perform a phylogenetic tree with the best model “JTT+I+G+F” screened by ProtTest 3.4.2 (Darriba et al., 2011) and applied 1,000 replicates. Bayesian analysis was operated with MrBayes 3.2 (Ronquist et al., 2012), and “GTR + F + G” was selected as the most suitable model by ModelFinder in IQTree v.2.1.3 (Kalyaanamoorthy et al., 2017). Four Markov chains were progressed with 1,000,000 MCMC generations, with sampling analysis tree each 100 generations. The residual trees were calculated with Bayesian posterior probabilities (BPP), burning first 250 trees.

Results and Discussion

Mitogenome organization and composition

The clean data of Contracaecum sp. are nearly 2 GB with a total of 8,677,194 × 2 clean reads for further assembling. The circular mt genome of Contracaecum sp. (GenBank accession: ON149889) assembled was 14,082 bp in size, shorter than that Zhang et al. (2021) published, with 12 PCGs, 22 tRNAs, 2 rRNAs, and 2 noncoding regions (NCRs) (Table 1 and Fig. 1). A total of 36 genes were transcribed in the forward direction and gene arrangement was recognized as the typical GA3 pattern, which is mostly observed in the worms (Liu et al., 2013). Consistent with previous reports, there was an obvious bias of A + T bases (71.2%). A total of 10 intergenic regions were found among the complete mt genome of Contracaecum sp. ranging from 1 bp to 16 bp (Table 1). One short NCR (122 bp) was located between nad4 and cox1, and one long NCR (691 bp) was placed in tRNA-Ser2 and tRNA-Asn. The values of AT skew were negative from -0.475 (nad6) to -0.111 (NCRs), and inversely, the values of GC-skew were positive with scope 0.226 (nad4) to 0.674 (nad3), suggesting Ts and Gs were more frequently used in the genome.

Figure 1

Organization of the complete mitochondrial genome sequence of Contracaecum sp. NCR, noncoding region.

Protein-coding genes

TTG was the most common initial codon in this study, followed by ATT. TTG was used as the start codon for nine genes (cox1-3, cytb, nad1-4, and nad6) (Table 1). The rest three PCGs (atp6, nad4L, and nad5) used ATT as the initial codon. Generally, TAG and TAA were common stop codons in metazoans (Hu et al., 2004). In this study, TAA was the most frequent termination among nad6, nad4L, nad4, cytb, and nad2. The genes nad1 and nad3 used TAG as their stop codon. The rest genes used incomplete stop codons T (cox1 and cox3) or TA (atp6, cox2 and nad5), respectively.

A total of 3,422 amino acids were translated by 12 PCGs. TTT (480) was the most common codon used in encoding Phe, followed by GTT (219, Val), TTG (216, Leu), and ATT (214, Ile). Leu (519) and Phe (499) were the most frequent amino acids, while Arg (34) was the least. There was a tendency of Gs and Ts in the same amino acid by comparing the relative synonymous codon usage (RSCU) (Table 2). The AT content of 12 protein genes ranged from 66.7% (cox1) to 78.9% (nad6) (Table 3). The values of AT skew ranged from –0.475 (nad6) to –0.373 (cox2), while the values of GC skew were 0.226 (nad4) to 0.674 (nad3), suggesting the bias of T and G bases.

Transfer RNA genes, rRNA genes, and non-coding region

The length of 22 tRNAs ranged from 51 bp (tRNA-Ser1) to 65 bp (tRNA-His). The typical structure of tRNA consisted of one acceptor stem, a dihydrouridine loop (D-loop), an anticodon loop, TYC loop, and related arms fixing with them (Su et al., 2020). However, the TψC loop was always replaced by a TV replacement loop in nematodes. In our study, 16 of 20 tRNAs (excluding tRNA-Ser1 and tRNA-Ser2) lacked a TYC loop, replaced by several nucleotide residues, which compromised the TV replacement loop (Hu et al., 2004). The tRNA-His, tRNA-Ile, and tRNA-Met were observed in a relatively standard cloverleaf structure with a TYC loop, although the latter two (tRNA-Ile and tRNA-Met) lacked DHU stem. The tRNA-Ser1 and tRNA-Ser2 were similar to previous reports with one TYC-loop but lacked D-loop (Su et al., 2020).

Table 1

Organization of the complete mt genome of Contracaecum sp. from Beijing, China.

Gene/regionStrandPositionsSize (bp)Number of aaaIni/Ter codonsAnticodonsIn
tRNA-Asn (N)H1–6060GTT0
tRNA-Tyr (Y)H61–11656GTA0
nad1H117–989873290TTG/TAG0
atp6H993–1,591599199ATT/TA+3
tRNA-Lys (K)H1,592–1,65362TTT0
tRNA-Leu2 (L2)H1,654–1,70855TAA0
tRNA-Ser1 (S1)H1,709–1,75951TCT0
nad2H1,760–2,605846281TTG/TAA0
tRNA-Ile (I)H2,619–2,67860GAT+13
tRNA-Arg (R)H2,679–2,73254GCG0
tRNA-Gln (Q)H2,733–2,78755TTG0
tRNA-Phe (F)H2,788–2,84659GAA0
CytbH2,847–3,9531,107368TTG/TAA0
tRNA-Leu1 (L1)H3,961–4,01757TAG+7
cox3H4,018–4,782766255TTG/T0
tRNA-Thr (T)H4,783–4,84360TGT0
nad4H4,844–6,0731,230409TTG/TAA0
Intergenic regionH6,074–6,1951220
cox1H6,196–7,7711,576525TTG/T0
tRNA-Cys (C)H7,772–7,82958GCA0
tRNA-Met (M)H7,831–7,89060CAT+1
tRNA-Asp (D)H7,907–7,96357GTC+16
tRNA-Gly (G)H7,965–8,02157TCC+1
cox2H8,022–8,713692230TTG/TA0
tRNA-His (H)H8,714–8,77865GTG0
rrnLH8,779–9,7379590
nad3H9,738–10,073336111TTG/TAG0
nad5H10,077–11,6591,583527ATT/TA+3
tRNA-Ala (A)H11,660–11,71657TGC0
tRNA-Pro (P)H11,724–11,78057TGG+7
tRNA-Val (V)H11,781–11,83757TAC0
nad6H11,838–12,272435144TTG/TAA0
nad4LH12,275–12,50523176ATT/TAA+2
tRNA-Trp (W)H12,506–12,56358TCA0
tRNA-Glu (E)H12,565–12,62460TTC+1
rrnSH12,625–13,3357110
tRNA-Ser2 (S2)H13,336–13,39156TGA0
Noncoding regionH13,392–14,0826910

[i] aInferred length of aa sequence of 13 PCGs.

aa, amino acid; In, intergenic nucleotides; Ini/Ter codons, initiation and termination codons; PCGs, protein-coding genes; tRNA, transfer RNA

Ribosomal RNAs of Contracaecum sp. were fixed as a GA3 pattern. The rrnL was located between tRNA-His and nad3 with a size of 959 bp, and the rrnS gene was located between tRNA-Glu and tRNA-Ser2 with a size of 711 bp (Table 1). The content of A + T for rrnL and rrnS was 75.6% and 70.6%, respectively. There were two NCRs among the mt genome of Contracaecum sp. One short region was placed in nad4 and cox1 with a length of 122 bp, and the long region was situated between tRNA-Ser2 and tRNA-Asn with a length of 691 bp.

Table 2

Amino acid frequency of Contracaecum sp. mitochondrial PCGs.

Amino acidCodonNumberRSCU (%)Amino acidCodonNumberRSCU (%)
PheTTT4801.92TyrTAT1541.84
PheTTC190.08TyrTAC130.16
LeuTTA1992.3StopTAA51.43
LeuTTG2162.5StopTAG20.57
LeuCTT760.88HisCAT541.86
LeuCTC20.02HisCAC40.14
LeuCTA100.12GlnCAA200.98
LeuCTG160.18GlnCAG211.02
IleATT2141.92AsnAAT1001.79
IleATC90.08AsnAAC120.21
MetATA760.86LysAAA350.71
MetATG1011.14LysAAG631.29
ValGTT2192.61AspGAT621.65
ValGTC130.16AspGAC130.35
ValGTA490.59GluGAA320.84
ValGTG540.64GluGAG441.16
SerTCT1393.08CysTGT531.96
SerTCC60.13CysTGC10.04
SerTCA140.31TrpTGA210.57
SerTCG50.11TrpTGG531.43
ProCCT663.11ArgCGT333.88
ProCCC70.33ArgCGC10.12
ProCCA90.42ArgCGA00
ProCCG30.14ArgCGG00
ThrACT893.24SerAGT1212.68
ThrACC60.22SerAGC20.04
ThrACA90.33SerAGA360.8
ThrACG60.22SerAGG380.84
AlaGCT722.5GlyGGT1122.22
AlaGCC240.83GlyGGC210.42
AlaGCA110.38GlyGGA230.46
AlaGCG80.28GlyGGG460.91

[i] Excluding abbreviated stop codons (TA and T).

Stop = stop codon.

PCGs, protein-coding genes; RSCU, relative synonymous codon usage.

Table 3

Nucleotide composition and skews of Contracaecum sp. mitochondrial genome.

GeneAGTCA + T (%)AT-skewGC-skew
atp622.022.049.16.971.1-0.3800.526
cox119.521.847.211.566.7-0.4160.307
cox221.222.146.510.167.7-0.3730.372
cox318.920.949.810.468.7-0.4490.333
cytb19.722.047.610.767.3-0.4150.343
nad119.520.550.59.570.0-0.4440.364
nad220.718.254.66.575.3-0.4510.474
nad320.021.454.44.274.4-0.4640.674
nad421.417.050.910.772.3-0.4080.226
nad4L22.917.355.04.877.9-0.4110.569
nad521.218.851.98.173.1-0.4200.398
nad620.713.358.27.878.9-0.4750.261
rrnS30.219.740.49.770.6-0.1430.340
rrnL27.317.548.36.975.6-0.2770.436
22 tRNA31.518.740.89.072.3-0.1290.352
NCR37.410.346.75.684.1-0.1110.290
Total23.519.048.78.972.2-0.3500.364

[i] NCR, noncoding region.

Nucleotide variation of genus Contracaecum

Based on aligned nucleotide sequences among species C. osculatum, C. rudolphii, C. ogmorhini, and Contracaecum sp., nucleotide diversities (Pi) were calculated based on the sliding window. The values of Pi ranged from 0.124 to 0.181 by analyzing a window of 300 bp and a default step of 25 bp (Fig. 2). The most variable genes were cytb (0.178), nad2 (0.181), nad4 (0.179), and nad6 (0.172), and the most conserved genes were cox1 (0.124) and cox2 (0.130) in Contracaecum (Fig. 2). Protein genes cox1 and cox2 seemed to be the most stable genes in Contracaecum nematodes with the least variation, which could be used as molecular markers to identify species from Contracaecum. Results also supported that nad2 and nad4 could act as alternative markers among nematodes isolated from different distributions.

Figure 2

Sliding window analysis of the alignment of complete mtDNAs of available Contracaecum spp. The black line shows the value of nucleotide diversity Pi (π) in a sliding window analysis of window size 300 bp with step size 25 bp, and the value is inserted at its mid-point. Gene boundaries are indicated with a variation ratio per gene.

Phylogenetic analyses

The present phylogenetic trees were constructed based on the 12 PCGs of 41 available mt genome sequences from the superfamilies Ascaridoidea and Heterakoidea (Table S2 in Supplementary Material). Two phylogenetic trees, both Bayesian inference (BI) and ML, had similar topologies, excluding species within the superfamily Heterakoidea. The topologies of ML and BI phylogenetic trees were highly similar to those of previous studies (Liu et al., 2016; Zhang et al., 2021; Zhao et al., 2021). Contracaecum sp. formed a branch with Contracaecum nematodes, indicating a closer relationship within the genus with strong support (Fig. 3); however, the long distance between Contracaecum sp. and the other three Contracaecum species (C. osculatum, C. rudolphii, and C. ogmorhini) was longer than the branch distance within other anisakid nematodes, which further indicated Contracaecum sp. was a novel species and verified the hypothesis of Zhang et al. (2021) proposed. According to the structure of phylogenetic trees, results supported that the superfamilies Ascaridoidea and Heterakoidea were monophyletic and evidenced families, including Ascarididae, Anisakidae, Heterocheiidae, Toxocaridae, and Cucullanidae, were monophyletic, consistent with previous studies (Li et al., 2018; Zhao et al., 2021).

Figure 3

Phylogenetic relationships of Contracaecum spp. with species from Ascaridoidea and Heterakoidea. Analysis trees based on amino acid sequences of 12 protein genes by complete mitochondrial genome using BI and ML with Enterobius vermicularis and Wellcomia siamensis as outgroups. BI, Bayesian inference; ML, maximum likelihood.

Within the superfamily Ascaridoidea, both BI and ML showed identical topologies. Among the family Ascarididae, the genera Ascaris, Baylisascaris, Toxascaris, and Parascaris had a closer relationship than Ophidascaris, which was similar to Zhou et al. (2021) reported. Based on morphological descriptions, the genus Ophidascaris was classified as a member of the superfamily Ascaridoidea (Pinto et al., 2010), and phylogenetic analyses suggested the genus Ophidascaris was more related to the family Ascaridae. However, the distance between the genus Ophidascaris and other Ascaridae genera was longer, suggesting there was systematic controversy in the Ascaridae. In the present study, the family Ascarididae was closely related to the family Anisakidae (Fig. 3), different from the previous study where the family Ascarididae was closely related to Toxocaridae (Zhou et al., 2021). In addition, results also supported the monophyly of all 5 families and all 11 genera within the superfamily Ascaridoidea with strong support (BPP = 1, Bf >70, Fig. 3), consistent with records (Liu et al., 2016; Zhao et al., 2018).

Liu et al. (2013) confirmed that Ascaridia columbae was more related to Ascaridia sp. than A. galli. The phylogenetic analyses in the present study also confirmed this. In ML analysis, the topology showed that A. galli was more related to Heterakis species with high statistical support (Bf = 87), in line with Liu et al. (2016) studied. However, BI analysis presented a totally different topology from that of ML tree. A. galli formed a distinct branch from genera Heterakis and Ascaridia with strong support (BPP = 1), hypothesizing A. galli might be another genus. Results also showed the family Heterakidae was a sister taxon to Ascaridiidae, and phylogenetic analyses (BI and ML) suggested the family Ascaridiidae might be paraphyly.

Conclusion

In the present study, we annotated the complete mitogenome sequence of Contracaecum sp. isolated from night herons and described its characteristics. Based on available mitogenome sequences of Contracaecum species, we also calculated the nucleotide diversity, indicating cox1 and cox2 could be used as effective markers to distinguish and identify other Contracaecum species. Results also supported the hypothesis of Zhang et al. (2021) proposed that Contracaecum sp. was a novel species, and evidenced that families Heterakidae + Ascaridiidae were closely related and all genera and families (excluding genus Ascaridia and family Ascaridiidae) were monophyletic.

Notes

[4] Contributed by Author’s Contributions

G-HL and Y-PD conceived and designed the study, and critically revised the manuscript. Y-T provided the sample worms and provided initial identification. Y-PD performed the experiments and analyzed the data. G-HL and Y-PD drafted the manuscript. R-L and H-MW helped in study design, study implementation, and manuscript preparation. All authors read and approved the final manuscript.

[5] Conflicts of interest Conflict of Interest

None.

[6] Financial Support

This study was supported by the Training Programme for Excellent Young Innovators of Changsha (Grant No. KQ2106044).

[7] Ethical Standards

Not applicable.

Supplementary Figure and Tables

Figure S1

Polymerase chain reaction amplicons from the mitochondrial genome of Contracaecum sp. M: DL5,000 DNA marker; 1: Validation_01; 2: Validation_02; 3: Validation_03; 4:Validation_04.

Table S1

Primers used for assembly validation.

NameSequence (5'-3')Size (bp)
yeluF1AGTTGTTGAAGAAGGAGCAGTT
yeluR1CTAAACATTGACCTAACCACCT3,564 bp
yeluF2AGGTGGTTAGGTCAATGTTTAG
yeluR2ACAGAGTAAACATCAGGGAAAT3,900 bp
yeluF3TTGGATTTCCCTGATGTTTACT
yeluR3CAAACTAAACATACTGCCAACA2,816 bp
yeluF4TTGGTCAACAAGATGGTCGTAA
yeluR4AACTGCTCCTTCTTCAACAACT3,757 bp
Table S2

Mitochondrial genome sequences of nematodes of superfamily Ascaridoidea and Heterakoidea were sequenced completely before the present study and used for phylogenetic analysis.

SuperfamilyFamilySpeciesSize (bp)GenBank accession No.
AscaridoideaAnisakidaeAnisakis pegreffii14,002NC_034329
Anisakis simplex13,899MK820679
Contracaecum ogmorhini Canada14,010KU558727
Contracaecum ogmorhini Australia14,019KU558725
Contracaecum ogmorhini South Africa14,012KU558726
Contracaecum osculatum13,823NC_024037
Contracaecum rudolphii14,022NC_014870
Pseudoterranova decipiens13,962NC_031645
Pseudoterranova decipiens s.l.13,965KU558722
Pseudoterranova krabbei13,948NC_031646
Pseudoterranova bulbosa13,957KU558720
Pseudoterranova cattani13,950KU558721
AscarididaeAscaris lumbricoides14,281NC_016198
Ascaris lumbricoides China14,303HQ704900
Ascaris ovis14,288NC_036666
Ascaris suum14,284NC_001327
Ascaris suum China14,311HQ704901
Ascaris sp. Chimpanzee14,268KC839986
Ascaris sp. gibbon14,274KC839987
Baylisascaris ailuri14,657HQ671080
Baylisascaris procyonis14,781NC_016200
Baylisascaris schroederi14,778NC_015927
Baylisascaris transfuga14,898NC_015924
Ophidascaris baylisi14,784MW880927
Ophidascaris sp.14,660MK106624
Parascaris equorum13,899NC_036427
Parascaris univalens13,920NC_024884
Toxascaris leonina14,310NC_023504
HeterocheilidaeOrtleppascaris sinensis13,828NC_036669
ToxocaridaeToxocara canis14,322NC_010690
Toxocara canis Australia14,163EU730761
Toxocara cati14,029NC_010773
Toxocara malaysiensis14,266NC_010527
CucullanidaeCucullanus robustus13,972NC_016128
HeterakoideaAscaridiidaeAscaridia columbae13,931NC_021643
Ascaridia galli13,977NC_021642
Ascaridia sp.13,862JX624730
HeterakidaeHeterakis beramporia14,012NC_029838
Heterakis dispar13,995NC_042411
Heterakis gallinarum13,973NC_029839
OxyuroideaOxyuridaeEnterobius vermicularis14,010EU281143
Wellcomia siamensis14,128NC_016129
DOI: https://doi.org/10.2478/jofnem-2022-0048 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Submitted on: May 3, 2022
Published on: Oct 26, 2022
Published by: Society of Nematologists, Inc.
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2022 Yuan-Ping Deng, Rong Li, Hui-Mei Wang, Guo-Hua Liu, Ya Tu, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.