Complete Mitochondrial Genome of Contracaecum sp. (Nematoda: Ascarididae) from night herons in China

Gene/region	Strand	Positions	Size (bp)	Number of aa^a	Ini/Ter codons	Anticodons	In
tRNA-Asn (N)	H	1–60	60			GTT	0
tRNA-Tyr (Y)	H	61–116	56			GTA	0
nad1	H	117–989	873	290	TTG/TAG		0
atp6	H	993–1,591	599	199	ATT/TA		+3
tRNA-Lys (K)	H	1,592–1,653	62			TTT	0
tRNA-Leu2 (L₂)	H	1,654–1,708	55			TAA	0
tRNA-Ser1 (S₁)	H	1,709–1,759	51			TCT	0
nad2	H	1,760–2,605	846	281	TTG/TAA		0
tRNA-Ile (I)	H	2,619–2,678	60			GAT	+13
tRNA-Arg (R)	H	2,679–2,732	54			GCG	0
tRNA-Gln (Q)	H	2,733–2,787	55			TTG	0
tRNA-Phe (F)	H	2,788–2,846	59			GAA	0
Cytb	H	2,847–3,953	1,107	368	TTG/TAA		0
tRNA-Leu1 (L₁)	H	3,961–4,017	57			TAG	+7
cox3	H	4,018–4,782	766	255	TTG/T		0
tRNA-Thr (T)	H	4,783–4,843	60			TGT	0
nad4	H	4,844–6,073	1,230	409	TTG/TAA		0
Intergenic region	H	6,074–6,195	122				0
cox1	H	6,196–7,771	1,576	525	TTG/T		0
tRNA-Cys (C)	H	7,772–7,829	58			GCA	0
tRNA-Met (M)	H	7,831–7,890	60			CAT	+1
tRNA-Asp (D)	H	7,907–7,963	57			GTC	+16
tRNA-Gly (G)	H	7,965–8,021	57			TCC	+1
cox2	H	8,022–8,713	692	230	TTG/TA		0
tRNA-His (H)	H	8,714–8,778	65			GTG	0
rrnL	H	8,779–9,737	959				0
nad3	H	9,738–10,073	336	111	TTG/TAG		0
nad5	H	10,077–11,659	1,583	527	ATT/TA		+3
tRNA-Ala (A)	H	11,660–11,716	57			TGC	0
tRNA-Pro (P)	H	11,724–11,780	57			TGG	+7
tRNA-Val (V)	H	11,781–11,837	57			TAC	0
nad6	H	11,838–12,272	435	144	TTG/TAA		0
nad4L	H	12,275–12,505	231	76	ATT/TAA		+2
tRNA-Trp (W)	H	12,506–12,563	58			TCA	0
tRNA-Glu (E)	H	12,565–12,624	60			TTC	+1
rrnS	H	12,625–13,335	711				0
tRNA-Ser2 (S₂)	H	13,336–13,391	56			TGA	0
Noncoding region	H	13,392–14,082	691				0

[i] ^aInferred length of aa sequence of 13 PCGs.

aa, amino acid; In, intergenic nucleotides; Ini/Ter codons, initiation and termination codons; PCGs, protein-coding genes; tRNA, transfer RNA

Table 2

Amino acid frequency of Contracaecum sp. mitochondrial PCGs.

Amino acid	Codon	Number	RSCU (%)	Amino acid	Codon	Number	RSCU (%)
Phe	TTT	480	1.92	Tyr	TAT	154	1.84
Phe	TTC	19	0.08	Tyr	TAC	13	0.16
Leu	TTA	199	2.3	Stop	TAA	5	1.43
Leu	TTG	216	2.5	Stop	TAG	2	0.57
Leu	CTT	76	0.88	His	CAT	54	1.86
Leu	CTC	2	0.02	His	CAC	4	0.14
Leu	CTA	10	0.12	Gln	CAA	20	0.98
Leu	CTG	16	0.18	Gln	CAG	21	1.02
Ile	ATT	214	1.92	Asn	AAT	100	1.79
Ile	ATC	9	0.08	Asn	AAC	12	0.21
Met	ATA	76	0.86	Lys	AAA	35	0.71
Met	ATG	101	1.14	Lys	AAG	63	1.29
Val	GTT	219	2.61	Asp	GAT	62	1.65
Val	GTC	13	0.16	Asp	GAC	13	0.35
Val	GTA	49	0.59	Glu	GAA	32	0.84
Val	GTG	54	0.64	Glu	GAG	44	1.16
Ser	TCT	139	3.08	Cys	TGT	53	1.96
Ser	TCC	6	0.13	Cys	TGC	1	0.04
Ser	TCA	14	0.31	Trp	TGA	21	0.57
Ser	TCG	5	0.11	Trp	TGG	53	1.43
Pro	CCT	66	3.11	Arg	CGT	33	3.88
Pro	CCC	7	0.33	Arg	CGC	1	0.12
Pro	CCA	9	0.42	Arg	CGA	0	0
Pro	CCG	3	0.14	Arg	CGG	0	0
Thr	ACT	89	3.24	Ser	AGT	121	2.68
Thr	ACC	6	0.22	Ser	AGC	2	0.04
Thr	ACA	9	0.33	Ser	AGA	36	0.8
Thr	ACG	6	0.22	Ser	AGG	38	0.84
Ala	GCT	72	2.5	Gly	GGT	112	2.22
Ala	GCC	24	0.83	Gly	GGC	21	0.42
Ala	GCA	11	0.38	Gly	GGA	23	0.46
Ala	GCG	8	0.28	Gly	GGG	46	0.91

[i] Excluding abbreviated stop codons (TA and T).

Stop = stop codon.

PCGs, protein-coding genes; RSCU, relative synonymous codon usage.

Table 3

Nucleotide composition and skews of Contracaecum sp. mitochondrial genome.

Gene	A	G	T	C	A + T (%)	AT-skew	GC-skew
atp6	22.0	22.0	49.1	6.9	71.1	-0.380	0.526
cox1	19.5	21.8	47.2	11.5	66.7	-0.416	0.307
cox2	21.2	22.1	46.5	10.1	67.7	-0.373	0.372
cox3	18.9	20.9	49.8	10.4	68.7	-0.449	0.333
cytb	19.7	22.0	47.6	10.7	67.3	-0.415	0.343
nad1	19.5	20.5	50.5	9.5	70.0	-0.444	0.364
nad2	20.7	18.2	54.6	6.5	75.3	-0.451	0.474
nad3	20.0	21.4	54.4	4.2	74.4	-0.464	0.674
nad4	21.4	17.0	50.9	10.7	72.3	-0.408	0.226
nad4L	22.9	17.3	55.0	4.8	77.9	-0.411	0.569
nad5	21.2	18.8	51.9	8.1	73.1	-0.420	0.398
nad6	20.7	13.3	58.2	7.8	78.9	-0.475	0.261
rrnS	30.2	19.7	40.4	9.7	70.6	-0.143	0.340
rrnL	27.3	17.5	48.3	6.9	75.6	-0.277	0.436
22 tRNA	31.5	18.7	40.8	9.0	72.3	-0.129	0.352
NCR	37.4	10.3	46.7	5.6	84.1	-0.111	0.290
Total	23.5	19.0	48.7	8.9	72.2	-0.350	0.364

[i] NCR, noncoding region.

Sliding window analysis of the alignment of complete mtDNAs of available *Contracaecum* spp. The black line shows the value of nucleotide diversity Pi (π) in a sliding window analysis of window size 300 bp with step size 25 bp, and the value is inserted at its mid-point. Gene boundaries are indicated with a variation ratio per gene.

Phylogenetic relationships of *Contracaecum* spp. with species from Ascaridoidea and Heterakoidea. Analysis trees based on amino acid sequences of 12 protein genes by complete mitochondrial genome using BI and ML with *Enterobius vermicularis* and *Wellcomia siamensis* as outgroups. BI, Bayesian inference; ML, maximum likelihood.

Polymerase chain reaction amplicons from the mitochondrial genome of *Contracaecum* sp. M: DL5,000 DNA marker; 1: Validation_01; 2: Validation_02; 3: Validation_03; 4:Validation_04.

Table S1

Primers used for assembly validation.

Name	Sequence (5^'-3^')	Size (bp)
yeluF1	AGTTGTTGAAGAAGGAGCAGTT
yeluR1	CTAAACATTGACCTAACCACCT	3,564 bp
yeluF2	AGGTGGTTAGGTCAATGTTTAG
yeluR2	ACAGAGTAAACATCAGGGAAAT	3,900 bp
yeluF3	TTGGATTTCCCTGATGTTTACT
yeluR3	CAAACTAAACATACTGCCAACA	2,816 bp
yeluF4	TTGGTCAACAAGATGGTCGTAA
yeluR4	AACTGCTCCTTCTTCAACAACT	3,757 bp

Table S2

Mitochondrial genome sequences of nematodes of superfamily Ascaridoidea and Heterakoidea were sequenced completely before the present study and used for phylogenetic analysis.

Superfamily	Family	Species	Size (bp)	GenBank accession No.
Ascaridoidea	Anisakidae	Anisakis pegreffii	14,002	NC_034329
		Anisakis simplex	13,899	MK820679
		Contracaecum ogmorhini Canada	14,010	KU558727
		Contracaecum ogmorhini Australia	14,019	KU558725
		Contracaecum ogmorhini South Africa	14,012	KU558726
		Contracaecum osculatum	13,823	NC_024037
		Contracaecum rudolphii	14,022	NC_014870
		Pseudoterranova decipiens	13,962	NC_031645
		Pseudoterranova decipiens s.l.	13,965	KU558722
		Pseudoterranova krabbei	13,948	NC_031646
		Pseudoterranova bulbosa	13,957	KU558720
		Pseudoterranova cattani	13,950	KU558721
	Ascarididae	Ascaris lumbricoides	14,281	NC_016198
		Ascaris lumbricoides China	14,303	HQ704900
		Ascaris ovis	14,288	NC_036666
		Ascaris suum	14,284	NC_001327
		Ascaris suum China	14,311	HQ704901
		Ascaris sp. Chimpanzee	14,268	KC839986
		Ascaris sp. gibbon	14,274	KC839987
		Baylisascaris ailuri	14,657	HQ671080
		Baylisascaris procyonis	14,781	NC_016200
		Baylisascaris schroederi	14,778	NC_015927
		Baylisascaris transfuga	14,898	NC_015924
		Ophidascaris baylisi	14,784	MW880927
		Ophidascaris sp.	14,660	MK106624
		Parascaris equorum	13,899	NC_036427
		Parascaris univalens	13,920	NC_024884
		Toxascaris leonina	14,310	NC_023504
	Heterocheilidae	Ortleppascaris sinensis	13,828	NC_036669
	Toxocaridae	Toxocara canis	14,322	NC_010690
		Toxocara canis Australia	14,163	EU730761
		Toxocara cati	14,029	NC_010773
		Toxocara malaysiensis	14,266	NC_010527
	Cucullanidae	Cucullanus robustus	13,972	NC_016128
Heterakoidea	Ascaridiidae	Ascaridia columbae	13,931	NC_021643
		Ascaridia galli	13,977	NC_021642
		Ascaridia sp.	13,862	JX624730
	Heterakidae	Heterakis beramporia	14,012	NC_029838
		Heterakis dispar	13,995	NC_042411
		Heterakis gallinarum	13,973	NC_029839
Oxyuroidea	Oxyuridae	Enterobius vermicularis	14,010	EU281143
		Wellcomia siamensis	14,128	NC_016129

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/jofnem-2022-0048 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X

Journal RSS Feed

Language: English

Submitted on: May 3, 2022

Published on: Oct 26, 2022

Published by: Society of Nematologists, Inc.

In partnership with: Paradigm Publishing Services

Publication frequency: 1 issue per year

Keywords:

AT content,

Contracaecum,

Contracaecum sp,

mitochondrial genome,

mitogenome

Related subjects:

Life sciences,

Life sciences, other

© 2022 Yuan-Ping Deng, Rong Li, Hui-Mei Wang, Guo-Hua Liu, Ya Tu, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.

Volume 54 (2022): Issue 1 (February 2022)

Complete Mitochondrial Genome of Contracaecum sp. (Nematoda: Ascarididae) from night herons in China

Figures & Tables

Figure 1

Table 1

Table 2

Table 3

Figure 2

Figure 3

Figure S1

Table S1

Table S2

Paradigm

My account