Evaluation of Silkworm Pupae Meal and Fish Protein Hydrolysate as a Sustainable Fish Meal Replacement in Striped Murrel (Channa Striata) Diet: Impact on Growth Performance, Enzyme Activity and IGF-1 Gene Expression

Govindharaj Sathishkumar; Nathan Felix; Amit Ranjan; Arumugam Uma; Kalaivanan Rajalakshmi

doi:10.2478/aoas-2025-0041

Figures & Tables

Digestive enzyme activities (U mg−1 protein) of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

Antioxidant and metabolic enzyme activities (U mg−1 protein) of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

Transverse sections of the mid intestine from C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets; The sections were stained in H & E to enhance the contrast (100× magnification; scale bar with 20 μm); (A, 35% FM (control); B, 25% FM replaced with SWP (25 SWP); C, 50% FM replaced with SWP (50 SWP); D, 25% FM replaced with a combination of SWP and 3.5% FPH (25 SWP+FPH); E, 50% FM replaced with a combination of SWP and 3.5% FPH) (VL, Villi length; VW, Villi width and MT, Muscular thickness)

Relative mRNA expression of IGF-I in the liver of C. striata. Bars with different superscripts indicate significant differences determined by Duncan’s test (P<0.05)

Primer sequences used for qRT-PCR analysis of striped murrel

Gene name	Gen Bank number	Primer	Primer sequence (5´−3´)
Hepatic insulin like growth factor-1 (IGF-1)	JK546357.1	Forward	TCTGTGATGTTGACGAGTGGT
Hepatic insulin like growth factor-1 (IGF-1)	JK546357.1	Reverse	AGCCTGAAATGTTGGGAGTG
β-actin	KC967219	Forward	GCCTTCCTTCCTTGGTATGG
β-actin	KC967219	Reverse	GTGTTGGCGTACAG GTCCTT

Intestinal morphology of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

	Control	25SWP	50SWP	25SWP+FPH	50SWP+FPH	P-value
Villi length (μm)	210.80±4.50 a	197.23±4.87 b	186.10±3.89 c	200.35±4.65 b	205.14±6.79 ab	0.001
Villi width (μm)	32.89±1.90 a	29.47±1.16 c	27.45±0.58 c	31.45±0.78 ab	33.73±1.71 a	0.001

Growth performance and survival rate of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

	Control	25SWP	50SWP	25SWP+FPH	50SWP+FPH	P-value
Initial weight (g)	10.03±0.16	9.90±0.02	9.95±0.10	10.07±0.15	10.04±0.30	0.733
Final weight (g)	46.03±1.11 a	41.12±1.31 b	38.18±0.37 c	43.62±2.20 a	45.37±0.85 a	<0.001
Weight gain (g)	36.00±1.26 a	31.21±1.32 b	28.23±0.29 c	33.54±2.11 ab	35.33±1.15 a	<0.001
Average daily growth (g)	0.60±0.02 a	0.52±0.02 b	0.47±0.01 c	0.56±0.03 ab	0.59±0.02 a	<0.001
Survival rate (%)	98.33±2.88	95.00±0.00	93.33±2.89	93.33±2.89	98.33±2.89	0.080
Specific growth rate (% day⁻¹)	2.54±0.06 a	2.37±0.05 b	2.24±0.01 c	2.44±0.07 ab	2.51±0.08 a	0.001
Hepatosomatic index (%)	1.75±0.03	1.76±0.02	1.75±0.01	1.75±0.03	1.76±0.04	0.961
Viscerosomatic index (%)	6.79±0.29	6.98±0.06	6.93±0.08	7.09±0.12	7.02±0.11	0.249

Whole-body proximate composition (% wet weight) of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

	Initial	Control	25SWP	50SWP	25SWP+FPH	50SWP+FPH	P-value
Moisture	72.55	72.11±0.20	71.87±0.29	71.91±0.32	72.01±0.18	71.99±0.14	0.757
Crude protein	16.97	17.21±0.05	17.44±0.19	17.27±0.16	17.47±0.33	17.51±0.07	0.296
Crude lipid	4.61	5.40±0.31	5.29±0.16	5.37±0.12	5.24±0.21	5.17±0.05	0.595
Total ash	4.43	3.65±0.15	3.18±0.42	3.21±0.27	3.07±0.37	3.16±0.20	0.224

Feed formulation and nutritional compositions (% dry weight) of experimental diets

Ingredients	Control	25SWP	50SWP	25SWP+FPH	50SWP+FPH
Fish meal¹	35	26.25	17.5	25.03	16.28
Silkworm pupae meal²	0	9.59	19.17	9.59	19.17
Fish protein hydrolysate³	0	0	0	1	1
Soybean meal⁴	17	17	17	17	17
Squid meal⁵	9	9	9	9	9
Corn gluten⁶	10	10	10	10	10
Wheat flour⁷	11	11	11	11	11
Broken rice⁸	6.2	6.56	6.43	6.78	6.65
Fish oil⁹	3	3	3	3	3
Palm oil¹⁰	2.2	1.2	0.5	1.2	0.5
Soy lecithin¹¹	2	2	2	2	2
Di-calcium phosphate¹²	1	1	1	1	1
Vitamin mix¹³	1	1	1	1	1
Mineral mix¹⁴	1	1	1	1	1
Vitamin C	0.2	0.2	0.2	0.2	0.2
DL-methionine¹⁵	0.4	0.2	0.2	0.2	0.2
Pega bind¹⁶	1	1	1	1	1
Nutrient composition (%)
dry matter	90.18	90.08	90.01	90.13	90.06
crude protein	43.76	44.22	44.20	44.15	44.09
crude lipid	10.91	11.21	11.28	11.12	11.09
crude fiber	1.16	1.25	1.89	1.19	1.89
total ash	10.83	9.63	9.82	9.61	9.76
gross energy (MJ/kg)	18.33	18.64	18.58	18.40	18.45

Feed conversion, nutrient utilization, and retention of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

	Control	25SWP	50SWP	25SWP+FPH	50SWP+FPH	P-value
Feed conversion ratio	1.47±0.02 c	1.73±0.06 b	1.82±0.05 a	1.64±0.08 b	1.52±0.02 c	<0.001
Protein efficiency ratio	1.54±0.02 a	1.32±0.04 bc	1.25±0.03 c	1.38±0.07 b	1.49±0.02 a	<0.001
Lipid efficiency ratio	6.17±0.09 a	5.27±0.18 bc	4.99±0.12 c	5.53±0.27 b	5.97±0.09 a	<0.001
Protein retention (%)	26.64±0.43 a	26.07±0.28 a	20.99±0.83 b	28.20±1.62 a	22.85±0.76 b	<0.001
Lipid retention (%)	34.66±2.65 a	32.06±1.21 a	27.21±1.00 b	34.09±4.05 a	27.65±1.00 b	0.006

Amino acid composition (% dry weight) of experimental diets

Amino acids	Control	25SWP	50SWP	25SWP+FPH	50SWP+FPH
Essential amino acids
arginine	2.88	3.15	3.42	3.16	3.43
histidine	1.03	1.00	0.97	1.00	0.97
isoleucine	1.82	1.77	1.72	1.77	1.72
leucine	4.36	4.11	3.86	4.10	3.85
lysine	2.53	2.35	2.16	2.36	2.18
methionine	1.50	1.25	1.20	1.27	1.22
phenylalanine	1.89	1.89	1.88	1.89	1.89
threonine	1.65	1.55	1.44	1.56	1.45
tryptophan	0.45	0.42	0.38	0.42	0.39
valine	1.95	1.92	1.89	1.92	1.89
Non-essential amino acids
alanine	2.77	2.53	2.28	2.53	2.28
aspartic acid	3.98	3.77	3.57	3.78	3.57
cystine	0.65	0.67	0.69	0.66	0.68
glutamic acid	6.56	6.23	5.90	6.23	5.90
glycine	2.52	2.30	2.08	2.31	2.09
serine	1.85	1.81	1.77	1.82	1.78
tyrosine	2.63	2.63	2.64	2.65	2.65
Total sum of amino acids	41.02	39.15	37.66	39.23	37.74

Hemato-biochemical responses of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

Hemato-biochemical parameters	Control	25 SWP	50 SWP	25 SWP+FPH	50 SWP+FPH	P-value
Hematological parameters
Hb (g dl⁻¹)	10.93±0.58	11.77±0.47	11.37±0.42	11.43±0.61	11.20±0.56	0.455
Leuk (1000/cu.mm)	22.93±1.69	22.94±0.41	23.35±1.02	22.60±1.08	22.72±0.88	0.931
Ery (million/cu.mm)	2.60±0.20	2.59±0.23	2.67±0.31	2.73±0.34	2.70±0.24	0.957
Ht (%)	42.47±0.57	42.57±0.90	42.30±0.40	42.87±0.25	41.93±1.00	0.579
MCV (fl)	164.02±13.52	165.14±13.83	159.96±19.61	158.85±22.01	156.17±15.13	0.963
MCH (pictograms)	25.75±1.55	27.66±1.59	26.87±0.75	26.67±1.46	26.71±1.24	0.578
MCHC (g dl⁻¹)	42.26±4.69	45.64±3.84	43.00±5.69	42.19±3.88	41.82±5.76	0.868
NBT (OD at 450 nm)	1.06±0.06	1.02±0.03	1.04±0.05	1.01±0.02	1.07±0.02	0.420
Biochemical parameters
GLU (mg dl⁻¹)	44.73±1.06	44.30±1.98	44.98±1.54	43.56±0.79	44.85±1.11	0.710
TRY (mg dl⁻¹)	243.58±2.38	247.02±3.61	248.60±2.60	245.01±2.71	246.53±1.60	0.257
CHO (mg dl⁻¹)	105.08±3.73	107.74±3.80	106.47±3.03	104.28±2.05	107.35±3.28	0.658
TP (mg dl⁻¹)	4.29±0.33	4.09±0.18	4.23±0.29	4.23±0.21	4.40±0.17	0.676
ALB (mg dl⁻¹)	2.43±0.31	2.58±0.22	2.63±0.27	2.54±0.37	2.58±0.34	0.941
GLB (mg dl⁻¹)	1.86±0.57	1.51±0.05	1.59±0.01	1.69±0.17	1.82±0.38	0.655
ALT (U ml⁻¹)	29.02±5.47	27.42±1.66	26.66±3.35	29.94±1.92	29.35±4.52	0.791
AST (U ml⁻¹)	31.45±0.80	31.50±1.18	32.05±0.45	32.83±0.75	31.91±0.71	0.301
ALP (U ml⁻¹)	13.43±0.88	13.07±0.78	13.03±0.52	12.75±0.41	12.81±0.40	0.710
APA (%, trypsin inhibition)	67.04±1.93	65.76±0.96	65.46±1.96	66.69±1.35	66.40±1.80	0.755
lysozyme (µg/mL)	42.80±3.00	41.66±1.04	43.44±1.09	42.95±1.09	43.89±1.01	0.564

Evaluation of Silkworm Pupae Meal and Fish Protein Hydrolysate as a Sustainable Fish Meal Replacement in Striped Murrel (Channa Striata) Diet: Impact on Growth Performance, Enzyme Activity and IGF-1 Gene Expression

Figures & Tables

Figure 1.

Figure 2.

Figure 3.

Figure 4.

Primer sequences used for qRT-PCR analysis of striped murrel

Intestinal morphology of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

Growth performance and survival rate of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

Whole-body proximate composition (% wet weight) of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

Feed formulation and nutritional compositions (% dry weight) of experimental diets

Feed conversion, nutrient utilization, and retention of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

Amino acid composition (% dry weight) of experimental diets

Hemato-biochemical responses of C_ striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets

Paradigm

My account