Table 1.
Feed formulation and nutritional compositions (% dry weight) of experimental diets
| Ingredients | Control | 25SWP | 50SWP | 25SWP+FPH | 50SWP+FPH |
|---|---|---|---|---|---|
| Fish meal1 | 35 | 26.25 | 17.5 | 25.03 | 16.28 |
| Silkworm pupae meal2 | 0 | 9.59 | 19.17 | 9.59 | 19.17 |
| Fish protein hydrolysate3 | 0 | 0 | 0 | 1 | 1 |
| Soybean meal4 | 17 | 17 | 17 | 17 | 17 |
| Squid meal5 | 9 | 9 | 9 | 9 | 9 |
| Corn gluten6 | 10 | 10 | 10 | 10 | 10 |
| Wheat flour7 | 11 | 11 | 11 | 11 | 11 |
| Broken rice8 | 6.2 | 6.56 | 6.43 | 6.78 | 6.65 |
| Fish oil9 | 3 | 3 | 3 | 3 | 3 |
| Palm oil10 | 2.2 | 1.2 | 0.5 | 1.2 | 0.5 |
| Soy lecithin11 | 2 | 2 | 2 | 2 | 2 |
| Di-calcium phosphate12 | 1 | 1 | 1 | 1 | 1 |
| Vitamin mix13 | 1 | 1 | 1 | 1 | 1 |
| Mineral mix14 | 1 | 1 | 1 | 1 | 1 |
| Vitamin C | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 |
| DL-methionine15 | 0.4 | 0.2 | 0.2 | 0.2 | 0.2 |
| Pega bind16 | 1 | 1 | 1 | 1 | 1 |
| Nutrient composition (%) | |||||
| dry matter | 90.18 | 90.08 | 90.01 | 90.13 | 90.06 |
| crude protein | 43.76 | 44.22 | 44.20 | 44.15 | 44.09 |
| crude lipid | 10.91 | 11.21 | 11.28 | 11.12 | 11.09 |
| crude fiber | 1.16 | 1.25 | 1.89 | 1.19 | 1.89 |
| total ash | 10.83 | 9.63 | 9.82 | 9.61 | 9.76 |
| gross energy (MJ/kg) | 18.33 | 18.64 | 18.58 | 18.40 | 18.45 |
1 Bismi Fisheries Pvt. Ltd., Mayiladuthurai, Tamil Nadu, India (CP: 65.03% DM; CL: 8.3% DM; Ash: 12.88% DM).
3 Janatha Fishmeal and Oil Products, Pvt. Ltd. Karnataka, India (CP: 80.3% DM; CL: 1.1% DM; Ash: 13.5% DM).
4 Mahindra Feeds Pvt. Ltd., Namakkal, Tamil Nadu, India (CP: 50.6% DM; CL: 1.99% DM; Ash: 6.31% DM).
5 Mahindra Feeds Pvt. Ltd., Namakkal, Tamil Nadu, India (CP: 47.54% DM; CL: 6.54% DM; Ash: 19.39% DM).
6 SPAC Starch Products (India) Pvt Ltd., Erode, Tamil Nadu, India (CP: 63.7% DM; CL: 2.5% DM; Ash: 1.25% DM).
7 Mahindra feeds Pvt. Ltd., Namakkal, Tamil Nadu, India (CP: 12.21% DM; CL: 2.78% DM; Ash: 0.92% DM).
8 Mahindra feeds Pvt. Ltd., Namakkal, Tamil Nadu, India (CP: 10.06% DM; CL: 1.82% DM; Ash: 0.58% DM).
13 Anicare Pvt. Ltd., Chennai, Tamil Nadu, India. Composition of vitamin premix (quantity/kg): Vit. A – 10,000,000 IU, Vit. B1 – 5000 mg, Vit. B2 – 5000 mg, Vit. B3 – 6000 mg, Vit. B5 – 6000 mg, Vit. B6 – 6000 mg, Vit. C – 60,000 mg, Vit. D3 – 2,000,000 IU, Vit. E – 10,000 IU, Vit. H – 200 mg.
14 Anicare Pvt. Ltd., Chennai, Tamil Nadu, India. Composition of mineral premix (quantity/kg): Magnesium – 2800 mg, Iodine – 7.4 mg, Iron – 7400 mg, Copper – 1200 mg, Manganese – 11,600 mg, Zinc – 9800 mg, Chlorides cobalt – 4 mg, Potassium – 100 mg, Selenium – 4 mg, Calcium carbonate – 27.25%, Phosphorus – 7.45 mg, Sulfur – 0.7 mg, Sodium – 6 mg, Calpan – 200 mg, Aluminium – 1500 mg and Choline chloride – 10,000 mg.
Table 2.
Amino acid composition (% dry weight) of experimental diets
| Amino acids | Control | 25SWP | 50SWP | 25SWP+FPH | 50SWP+FPH |
|---|---|---|---|---|---|
| Essential amino acids | |||||
| arginine | 2.88 | 3.15 | 3.42 | 3.16 | 3.43 |
| histidine | 1.03 | 1.00 | 0.97 | 1.00 | 0.97 |
| isoleucine | 1.82 | 1.77 | 1.72 | 1.77 | 1.72 |
| leucine | 4.36 | 4.11 | 3.86 | 4.10 | 3.85 |
| lysine | 2.53 | 2.35 | 2.16 | 2.36 | 2.18 |
| methionine | 1.50 | 1.25 | 1.20 | 1.27 | 1.22 |
| phenylalanine | 1.89 | 1.89 | 1.88 | 1.89 | 1.89 |
| threonine | 1.65 | 1.55 | 1.44 | 1.56 | 1.45 |
| tryptophan | 0.45 | 0.42 | 0.38 | 0.42 | 0.39 |
| valine | 1.95 | 1.92 | 1.89 | 1.92 | 1.89 |
| Non-essential amino acids | |||||
| alanine | 2.77 | 2.53 | 2.28 | 2.53 | 2.28 |
| aspartic acid | 3.98 | 3.77 | 3.57 | 3.78 | 3.57 |
| cystine | 0.65 | 0.67 | 0.69 | 0.66 | 0.68 |
| glutamic acid | 6.56 | 6.23 | 5.90 | 6.23 | 5.90 |
| glycine | 2.52 | 2.30 | 2.08 | 2.31 | 2.09 |
| serine | 1.85 | 1.81 | 1.77 | 1.82 | 1.78 |
| tyrosine | 2.63 | 2.63 | 2.64 | 2.65 | 2.65 |
| Total sum of amino acids | 41.02 | 39.15 | 37.66 | 39.23 | 37.74 |
Table 3.
Primer sequences used for qRT-PCR analysis of striped murrel
| Gene name | Gen Bank number | Primer | Primer sequence (5´−3´) |
|---|---|---|---|
| Hepatic insulin like growth factor-1 (IGF-1) | JK546357.1 | Forward | TCTGTGATGTTGACGAGTGGT |
| Reverse | AGCCTGAAATGTTGGGAGTG | ||
| β-actin | KC967219 | Forward | GCCTTCCTTCCTTGGTATGG |
| Reverse | GTGTTGGCGTACAG GTCCTT |
Figure 1.
Digestive enzyme activities (U mg−1 protein) of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets
Figure 2.
Antioxidant and metabolic enzyme activities (U mg−1 protein) of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets
Figure 3.
Transverse sections of the mid intestine from C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets; The sections were stained in H & E to enhance the contrast (100× magnification; scale bar with 20 μm); (A, 35% FM (control); B, 25% FM replaced with SWP (25 SWP); C, 50% FM replaced with SWP (50 SWP); D, 25% FM replaced with a combination of SWP and 3.5% FPH (25 SWP+FPH); E, 50% FM replaced with a combination of SWP and 3.5% FPH) (VL, Villi length; VW, Villi width and MT, Muscular thickness)
Table 4.
Growth performance and survival rate of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets
| Control | 25SWP | 50SWP | 25SWP+FPH | 50SWP+FPH | P-value | |
|---|---|---|---|---|---|---|
| Initial weight (g) | 10.03±0.16 | 9.90±0.02 | 9.95±0.10 | 10.07±0.15 | 10.04±0.30 | 0.733 |
| Final weight (g) | 46.03±1.11 a | 41.12±1.31 b | 38.18±0.37 c | 43.62±2.20 a | 45.37±0.85 a | <0.001 |
| Weight gain (g) | 36.00±1.26 a | 31.21±1.32 b | 28.23±0.29 c | 33.54±2.11 ab | 35.33±1.15 a | <0.001 |
| Average daily growth (g) | 0.60±0.02 a | 0.52±0.02 b | 0.47±0.01 c | 0.56±0.03 ab | 0.59±0.02 a | <0.001 |
| Survival rate (%) | 98.33±2.88 | 95.00±0.00 | 93.33±2.89 | 93.33±2.89 | 98.33±2.89 | 0.080 |
| Specific growth rate (% day−1) | 2.54±0.06 a | 2.37±0.05 b | 2.24±0.01 c | 2.44±0.07 ab | 2.51±0.08 a | 0.001 |
| Hepatosomatic index (%) | 1.75±0.03 | 1.76±0.02 | 1.75±0.01 | 1.75±0.03 | 1.76±0.04 | 0.961 |
| Viscerosomatic index (%) | 6.79±0.29 | 6.98±0.06 | 6.93±0.08 | 7.09±0.12 | 7.02±0.11 | 0.249 |
Table 5.
Feed conversion, nutrient utilization, and retention of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets
| Control | 25SWP | 50SWP | 25SWP+FPH | 50SWP+FPH | P-value | |
|---|---|---|---|---|---|---|
| Feed conversion ratio | 1.47±0.02 c | 1.73±0.06 b | 1.82±0.05 a | 1.64±0.08 b | 1.52±0.02 c | <0.001 |
| Protein efficiency ratio | 1.54±0.02 a | 1.32±0.04 bc | 1.25±0.03 c | 1.38±0.07 b | 1.49±0.02 a | <0.001 |
| Lipid efficiency ratio | 6.17±0.09 a | 5.27±0.18 bc | 4.99±0.12 c | 5.53±0.27 b | 5.97±0.09 a | <0.001 |
| Protein retention (%) | 26.64±0.43 a | 26.07±0.28 a | 20.99±0.83 b | 28.20±1.62 a | 22.85±0.76 b | <0.001 |
| Lipid retention (%) | 34.66±2.65 a | 32.06±1.21 a | 27.21±1.00 b | 34.09±4.05 a | 27.65±1.00 b | 0.006 |
Table 6.
Whole-body proximate composition (% wet weight) of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets
| Initial | Control | 25SWP | 50SWP | 25SWP+FPH | 50SWP+FPH | P-value | |
|---|---|---|---|---|---|---|---|
| Moisture | 72.55 | 72.11±0.20 | 71.87±0.29 | 71.91±0.32 | 72.01±0.18 | 71.99±0.14 | 0.757 |
| Crude protein | 16.97 | 17.21±0.05 | 17.44±0.19 | 17.27±0.16 | 17.47±0.33 | 17.51±0.07 | 0.296 |
| Crude lipid | 4.61 | 5.40±0.31 | 5.29±0.16 | 5.37±0.12 | 5.24±0.21 | 5.17±0.05 | 0.595 |
| Total ash | 4.43 | 3.65±0.15 | 3.18±0.42 | 3.21±0.27 | 3.07±0.37 | 3.16±0.20 | 0.224 |
Table 7.
Intestinal morphology of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets
| Control | 25SWP | 50SWP | 25SWP+FPH | 50SWP+FPH | P-value | |
|---|---|---|---|---|---|---|
| Villi length (μm) | 210.80±4.50 a | 197.23±4.87 b | 186.10±3.89 c | 200.35±4.65 b | 205.14±6.79 ab | 0.001 |
| Villi width (μm) | 32.89±1.90 a | 29.47±1.16 c | 27.45±0.58 c | 31.45±0.78 ab | 33.73±1.71 a | 0.001 |
Table 8.
Hemato-biochemical responses of C. striata fed varying inclusion levels of SWP and SWP supplementation with FPH diets
| Hemato-biochemical parameters | Control | 25 SWP | 50 SWP | 25 SWP+FPH | 50 SWP+FPH | P-value |
|---|---|---|---|---|---|---|
| Hematological parameters | ||||||
| Hb (g dl−1) | 10.93±0.58 | 11.77±0.47 | 11.37±0.42 | 11.43±0.61 | 11.20±0.56 | 0.455 |
| Leuk (1000/cu.mm) | 22.93±1.69 | 22.94±0.41 | 23.35±1.02 | 22.60±1.08 | 22.72±0.88 | 0.931 |
| Ery (million/cu.mm) | 2.60±0.20 | 2.59±0.23 | 2.67±0.31 | 2.73±0.34 | 2.70±0.24 | 0.957 |
| Ht (%) | 42.47±0.57 | 42.57±0.90 | 42.30±0.40 | 42.87±0.25 | 41.93±1.00 | 0.579 |
| MCV (fl) | 164.02±13.52 | 165.14±13.83 | 159.96±19.61 | 158.85±22.01 | 156.17±15.13 | 0.963 |
| MCH (pictograms) | 25.75±1.55 | 27.66±1.59 | 26.87±0.75 | 26.67±1.46 | 26.71±1.24 | 0.578 |
| MCHC (g dl−1) | 42.26±4.69 | 45.64±3.84 | 43.00±5.69 | 42.19±3.88 | 41.82±5.76 | 0.868 |
| NBT (OD at 450 nm) | 1.06±0.06 | 1.02±0.03 | 1.04±0.05 | 1.01±0.02 | 1.07±0.02 | 0.420 |
| Biochemical parameters | ||||||
| GLU (mg dl−1) | 44.73±1.06 | 44.30±1.98 | 44.98±1.54 | 43.56±0.79 | 44.85±1.11 | 0.710 |
| TRY (mg dl−1) | 243.58±2.38 | 247.02±3.61 | 248.60±2.60 | 245.01±2.71 | 246.53±1.60 | 0.257 |
| CHO (mg dl−1) | 105.08±3.73 | 107.74±3.80 | 106.47±3.03 | 104.28±2.05 | 107.35±3.28 | 0.658 |
| TP (mg dl−1) | 4.29±0.33 | 4.09±0.18 | 4.23±0.29 | 4.23±0.21 | 4.40±0.17 | 0.676 |
| ALB (mg dl−1) | 2.43±0.31 | 2.58±0.22 | 2.63±0.27 | 2.54±0.37 | 2.58±0.34 | 0.941 |
| GLB (mg dl−1) | 1.86±0.57 | 1.51±0.05 | 1.59±0.01 | 1.69±0.17 | 1.82±0.38 | 0.655 |
| ALT (U ml−1) | 29.02±5.47 | 27.42±1.66 | 26.66±3.35 | 29.94±1.92 | 29.35±4.52 | 0.791 |
| AST (U ml−1) | 31.45±0.80 | 31.50±1.18 | 32.05±0.45 | 32.83±0.75 | 31.91±0.71 | 0.301 |
| ALP (U ml−1) | 13.43±0.88 | 13.07±0.78 | 13.03±0.52 | 12.75±0.41 | 12.81±0.40 | 0.710 |
| APA (%, trypsin inhibition) | 67.04±1.93 | 65.76±0.96 | 65.46±1.96 | 66.69±1.35 | 66.40±1.80 | 0.755 |
| lysozyme (µg/mL) | 42.80±3.00 | 41.66±1.04 | 43.44±1.09 | 42.95±1.09 | 43.89±1.01 | 0.564 |
[ii] Abbreviations: Hb, Hemoglobin; Leuk, Leukocytes; Ery, Erythrocytes; Ht, Hematocrit; MCV, Mean corpuscular volume; MCH, Mean corpuscular hemoglobin; MCHC, Mean corpuscular hemoglobin concentration; NBT, Nitroblue tetrazolium test; GLU, Glucose; TRY, Triglycerides; CHO, Cholesterol; TP, Total protein; ALB, Albumin, GLB, Globulin; ALT, Alanine transaminase; AST, Aspartate aminotransferase; ALP, Alkaline phosphatase; APA, Antiprotease activity.
Figure 4.
Relative mRNA expression of IGF-I in the liver of C. striata. Bars with different superscripts indicate significant differences determined by Duncan’s test (P<0.05)