Skip to main content
Have a personal or library account? Click to login
Analysis of TGFB1, CD105 and FSP1 expression in human granulosa cells during a 7-day primary in vitro culture Cover

Full Article

Introduction

The human granulosa cells (GCs) surround the oocyte and form the ovarian follicle’s proper architecture. In the initial period of development, the number of GCs surrounding the oocyte is relatively low. However, with time, the intensity of their proliferation increases, which leads to the formation of a granulosa layer. The further development of this layer leads to the creation of an antrum and the development of three granulosa cell subpopulations. These sub-populations include mural granulosa cells, antral granulosa cells, and cumulus granulosa cells. Their main functions are to support the oocyte’s growth (cumulus granulosa) and estradiol production (mural granulosa cells). After ovulation, the granulosa cells transform into the luteal cells of the corpus luteum and produce progesterone.

In the recent years, the ability of GCs to proliferate and differentiate in the conditions of in vitro culture has been demonstrated. However, there is still a large field for extensive investigation of molecular basics, as well as marker genes, responsible for these processes. Therefore, in this study, the expression of TGFB1, CD105, and FSP1 in GCs was examined.

The transforming growth factor-beta (TGFB) superfamily consists of more than 35 structurally related members [1]. It is expressed both in mammalian ovarian somatic cells and oocytes [2,3]. The most important TGFB superfamily genes include bone morphogenic proteins (BMPs) and growth differentiation factor 9 (GDF9) that are regulate critical steps of follicle growth and development. Moreover, it has also been shown that TGFB1 is involved in the regulation of follicular processes. In addition, it was postulated that TGFB might play a significant role in regulating GCs proliferation [4,5] and that TGFB1 stimulated the growth of preantral follicles isolated from adult mice ovaries and cultured in vitro [1].

Endoglin (CD105, ENG) is a 180 kDa homodimeric transmembrane glycoprotein. Its expression was determined in the luteinizing granulosa cells of the human ovary after culture in the presence of leukaemia inhibiting factor (LIF) [6,7]. It is also known as a mesenchymal stem cells (MSCs) marker. Its expression may indicate the multipotency of granulosa cells, which was confirmed by differentiation into neurons, chondrocytes, and osteoblasts [6].

Fibroblast-Specific Protein 1, or S100 calcium-binding protein A4 (FSP1, S100A4), is a member of the calmodulin S100 troponin C superfamily. It is a fibroblast-specific protein related to the morphology and mobility of mesenchymal cells, expressed during epithelial-mesenchymal transformations [8]. Fibrosis-related cytokines are responsible for the induction of FSP1. These include TGFB and epidermal growth factor (EGF) [8]. Additionally, factors promoting fibroblasts’ growth may affect the growth, proliferation, and survival of granulosa cells [9].

Our study aimed to analyse the expression profile of these three genes during the 7-day in vitro culture.

Material and Methods
Granulosa cell collection

The study group consisted of 7 patients, aged 18–40 years, enrolled in in vitro fertilization (IVF) procedure in the Division of Infertility and Reproductive Endocrinology, Poznan University of Medical Sciences, Poland. Follicular fluid containing the GCs from patients undergoing in vitro fertilization (IVF) procedures was collected.

The IVF procedure was based on a controlled ovarian hyperstimulation protocol adapted to the patient’s initial cause of infertility, as well as predicted and current ovarian response. Stimulation with human recombinant FSH (Gonal-F; Merck, Darmstadt, Germany) and highly purified human menopausal gonadotropin (hMG-HP; Menopur; Ferring) has been performed according to protocol. Gonadotropin-releasing hormone (GnRH) antagonist-cetrorelix acetate (Cetrotide; Merck, Darmstadt, Germany), injection has been given at the appropriate dose to suppress the function of the pituitary gland. Induction of ovulation was based on the subcutaneous injection of 6.500 h of human chorionic gonadotropin (hCG; Ovitrelle; Merck, Darmstadt, Germany). The doses of gonadotropins and GnRH antagonist have been precisely controlled and recorded for every patient. The follicular fluid has been collected during transvaginal ultrasound-guided oocyte pick-up, 36 h after administration of human chorionic gonadotropin. GCs have been taken from follicles with a diameter of over 16 mm. Directly after ovarian puncture, the complete content of the ovarian follicle (follicular fluid containing GCs and oocytes) was passed on to a qualified embryologist that extracted all of contained oocytes that were subsequently used in further stages of the IVF procedure (conducted at Division of Infertility and Reproductive Endocrinology, Department of Gynecology, Obstetrics and Gynecological Oncology, Poznan University of Medical Sciences, Poznan, Poland). Meanwhile, the remaining granulosa cell containing follicular fluid, usually discarded after this step, was passed on to the employees of Department of Anatomy, Poznan University of Medical Sciences, in which the further research was conducted.

Primary cell culture

The procedure of GCs isolation was performed as described previously [10,11]. Briefly, the follicular fluid, were washed twice by centrifugation at 200 × g for 10 min at RT. Medium consisted of Dulbecco’s Modified Eagle’s Medium (DMEM; Merck, Darmstadt, Germany), 2% Fetal Bovine Serum FBS (FBS; Merck, Darmstadt, Germany), 4 mM L-glutamine (Invitrogen; Thermo Fisher Scientific, Inc.), 10 mg/ml gentamycin (Invitrogen; Thermo Fisher Scientific, Inc.), 10,000 U/ ml penicillin, and 10,000 μg/ml streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.). Cells were cultivated at 37°C under aerobic conditions (5% CO2). The medium was changed every 48 hours of culture.

Total RNA isolation and real-time quantitative polymerase chain reaction (RT-qPCR) analysis

RNA was isolated at 7 time periods, after each day of cultivation. Total RNA was isolated using the Chomczyński-Sacchi method [12]. The GCs were suspended in 1 ml mixture of guanidine thiocyanate and phenol in monophase solution (TRI Reagent; Merck, Darmstadt, Germany). In the next step, the chloroform solution (Merck, Darmstadt, Germany) was added and centrifuged to separate 3 phases. RNA has been located in an aqueous phase. In the last step, the RNA has been precipitated with 2-propanol (Merck, Darmstadt, Germany), in amount accurate per 1 ml of TRI-reagent and has been washed with 75% ethanol. Resulting RNA has been used for further analysis. The total RNA was determined from the optical density at 260 nm and the RNA purity was estimated using the 260/280 nm absorption ratio (NanoDrop spectrophotometer, Thermo Fisher Scientific, Inc).

The obtained cDNA was used to perform the RT-qPCR reaction. The RT-qPCR analysis was performed using LightCycler real-time PCR detection system (Roche Diagnostics, Mannheim, Germany), with SYBR® Green I (Qiagen, Hilden, Germany) serving as a detection dye. The relative abundance of TGFB1, CD105 and FSP1 was standardized to the internal standards ACTB. For amplification, 2 μl of cDNA solution was added to 18 μl of Quanti-Tect® SYBR® Green PCR (Master Mix Qiagen GmbH, Hilden, Germany) and primers (Tab. 1). One RNA sample of each preparation was processed without the RT-reaction to provide a negative control for subsequent PCR.

Table 1

Oligonucleotide sequences of primers used for RT-qPCR analysis

GENEGENE ACCESSION NUMBERPRIMER SEQUENCE (5’-3’)PRODUCT SIZE (BP)
TGFB1NM_000660CCTTGCGGAAGTCAATGTACA GGCCTTTCCTGCTTCTCATG150
CD(ENG) 105BC014271CACTAGCCAGGTCTCGAAGG CTGAGGACCAGAAGCACCTC165
(SFSP1001 A4)CR450345TCTTGGGGAAAAGGACAGATGA CCCAACCACATCAGAGGAGT195
ACTBNM_001101CTCAGGAGGAGCAATGATCTTG AAAGACCTGTACGCCAACAC132
Statistical analysis

The data obtained from the RT-qPCR analysis were calculated using the 2-ΔΔCt method [13]. The change in expression of the target genes was normalized to ACTB. In the next step, normalized values were compared to the control. The time point for which the normalized Ct value was the highest was selected as a control. After the results were obtained, statistical analysis was performed using Python 3.8 and the SciPy 1.5.4 library. To check that the data was drawn from a normal distribution, the Shapiro-Wilk test was used [14,15]. To determine the statistical significance between the time intervals of the analysed genes, Student’s T-test was used.

Ethical approval

The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance the tenets of the Helsinki Declaration, and has been approved with resolution 558/17 by Poznan University of Medical Sciences Bioethical Committee.

Informed consent

Informed consent has been obtained from all individuals included in this study.

Results

Changes in the expression of CD105 and FSP1 could be observed during the 7-day in vitro culture. In the case of TGFB, the expression level remained unchanged, and no statistically significant differences in its expression level were observed (Fig. 1).

Figure 1

TGFB 1, CD105 and FSP1 expression in granulosa cells during 7-day in vitro culture. Data was presented like logarithm of fold change. Statistical analysis of the data was performed using the T-test and the differences were considered to be significant at the level of p<0.001 (***), p<0.01 (**), p<0.05 (*)

In the case of CD105, a low level of expression was observed on the first day of in vitro culture, followed by an increase in CD105 expression until day 5. Thereafter, CD105 expression decreased and remained similar on days 6 and day 7.

With FSP1, there was an irregular expression pattern. The highest level of expression was noticed on day 3. On days 2, 4, and 6, FSP1 expression was lower than on days 3, 5, and 7. However, the expression level on all days was higher than at the start of in vitro culture.

Discussion

The conducted research shows that follicular fluid is rich in proteins and functional cells. In addition to oocyte cells, the follicular fluid contains granulosa, theca, and ovarian surface epithelial cells [16]. To confirm the absence of epithelial cells in the culture, we performed an analysis of keratin 14 (KRT14) expression. The identified value of KRT14 expression was below the detection level (data not presented).

TGFB proteins affect many different cells in the body and perform various functions. Early studies showed that products of the TGFB might have a capacity for autocrine or paracrine modulation of granulosa cell differentiation [17]. On the other hand, TGFB may exhibit tumour-promoting activity through the ability to repress apoptosis in the juvenile form of granulosa cell tumours [18]. It was also showed that abnormal TGFB signalling in granulosa cells is related to the pathological conditions of polycystic ovary syndrome (PCOS) [19].

In our research, due to the regulatory role in the proliferation and differentiation of GCs, TGFB1 expression was maintained at a similar level during the 7 days of in vitro culture.

The second analysed molecule, endoglin (CD105), is associated with the TGFB superfamily. CD105 is a cell-surface co-receptor for TGFB1 and TGFB3 iso-forms [7,20]. It is a glycoprotein that is expressed in various cell types, with high expression identified in endothelial cells [21]. CD105 is also expressed in female gonadal cells [7], as well as is one of the mesenchymal stem cells (MSCs) markers. Since GCs originate from the mesoderm, they should show a mesenchymal cell expression pattern. Kossowska-Tomaszczuk K. et al. showed that the freshly collected GCs were positive for CD29, CD44, CD90, CD105, CD166, and negative for CD73 [6]. Using immunohistochemistry, the expression of CD105 was demonstrated in the cytoplasmic area of the oocyte and in all groups of granulosa cells. However, CD105 was more concentrated in oocytes than granulosa cells [7]. Our research showed that the expression of CD105 on the first day after seeding was on a low level, raising in the following days. The highest level of CD105 expression was confirmed on day 5. It needs to be noted that GCs may lose their properties during multiple passages, which may also affect the process of cell immortalization. Furthermore, the expression of CD105 in immortalized granulosa cells was not confirmed by Ai et al. [16].

It is known that CD105 plays a role in vasculature development, and it was confirmed that follicle development is dependent on the establishment and continual remodelling of a complex vascular system. It was suggested that GCs might behave as endothelial cells and contribute to follicular angiogenesis [22].

Fibroblast-Specific Protein 1 (FSP1) is a member of the calmodulin S100 troponin C superfamily [23]. The FSP1 gene encodes a filament-binding S100 protein with paired EF-hands, specifically expressed in fibroblasts [24]. FSP1 was indicated as an improved marker for lung fibroblasts that could be useful for investigating pulmonary fibrosis’s pathogenesis [23]. Studies have shown that FSP1 protein is present in the cytoplasm of fibroblasts, but not the epithelium. However, in kidney fibrosis occurring due to persistent inflammation, many fibroblasts could be identified in interstitial sites. This may be related to the local transition from epithelium to fibroblasts, with focal FSP1 overexpression observed [25]. In the case of granulosa cells, the process of fibrosis may affect their proliferation and development [9]. In our studies, FSP1 expression showed significant changes on the individual days of in vitro culture, which may indicate the dynamics of their internal changes.

Conclusions

Our study showed that the expression of TGFB1 was high relative to CD105 and FSP1 and remained at a similar level during 7-day in vitro culture. This may highlight the important role of TGFB1 in the growth and differentiation of GCs. In contrast to TGFB1, FSP1 expression showed a heterogeneous pattern, indicating dynamic changes during culture. In the case of CD105, an increase in expression up to day 5 and subsequent stabilization of the expression level was observed. This may indicate a high proliferation potential on day 5.

Language: English
Page range: 152 - 157
Submitted on: Oct 6, 2020
Accepted on: Nov 17, 2020
Published on: Dec 31, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 Artur Bryja, Wojciech Pieńkowski, Katarzyna Stefańska, Błażej Chermuła, Rut Bryl, Maria Wieczorkiewicz, Jakub Kulus, Grzegorz Wąsiatycz, Dorota Bukowska, Kornel Ratajczak, Jędrzej M. Jaśkowski, James N. Petitte, Paul Mozdziak, Leszek Pawelczyk, Robert Z. Spaczyński, Paweł Antosik, published by Foundation for Cell Biology and Molecular Biology
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.