Introduction
Corrosion is a significant issue in various industries, especially those involving metals and alloys exposed to harsh environments. It is defined as a physicochemical reaction between a metal and its surroundings, altering its physical characteristics. This could impair its functionality, compromise environmental quality, and affect the technical systems in which it is used (Dhawan et al. 2020). The thermodynamic tendency of metals, excluding noble metals like gold and platinum, to revert to their ore state due to environmental interactions underscores the widespread nature of corrosion (Watkins 1998). Seawater, a common and highly corrosive electrolyte, presents a significant challenge to structural metals and alloys. The corrosive nature of seawater is primarily due to its high conductivity and chloride content, which promote galvanic corrosion and various localized forms of corrosion, such as pitting, stress corrosion, crevice corrosion, and erosion corrosion, in areas with high water flow velocities (Hou et al. 2018). The diverse seawater environments, including subsoil, continuously submerged, tidal, atmospheric, and splash zones, require a comprehensive understanding of corrosion mechanisms and effective management strategies (Ruba’ai 2015).
Seawater corrosion is predominantly driven by its high chloride ion concentration, elevated conductivity, mild alkaline pH, and abundant dissolved oxygen. These factors promote both uniform and localized corrosion by destabilizing passive oxide films on metal surfaces and facilitating electrochemical reactions. Chloride ions are aggressive species that penetrate protective films, inducing pitting and crevice corrosion. Concurrently, the presence of dissolved oxygen sustains the cathodic reaction, primarily oxygen reduction rather than hydrogen evolution in marine systems, thus accelerating corrosion (Revie and Uhlig 2008(. In this context, biofilm-forming bacteria play a dual role: they can either aggravate corrosion or act as natural inhibitors depending on their metabolic activity and interaction with the metal surface. Protective biofilms may limit oxygen diffusion to the steel surface and alter local electrochemical conditions, thereby reducing corrosion rates. These microbial communities may also influence the formation and stability of corrosion products through the production of metabolites or competitive colonization with corrosive microorganisms (Beech and Sunner 2004).
Traditional corrosion inhibitors, typically organic, have raised environmental concerns due to potential hazards. This has prompted the search for eco-friendly alternatives that are biodegradable and free of heavy metals and other harmful substances. Microorganisms, particularly biofilm-forming bacteria, have emerged as promising, environmentally friendly corrosion inhibitors. These microorganisms offer advantages such as cost-effectiveness, widespread availability, and renewability (Patrascu et al. 2014).
Biofilm-forming bacteria demonstrate corrosion inhibition abilities through various mechanisms in both aerobic and anaerobic environments. In aerobic conditions, they deplete oxygen, thereby impeding corrosion. In anaerobic conditions, chemoorganotrophic bacteria prevent corrosion by removing corrosion products and altering the environment for sulfate-reducing bacteria (SRB). However, certain anaerobic bacteria, such as Pseudomonas spp. and Shewanella putrefaciens, can exacerbate corrosion by consuming hydrogen molecules (Potekhina et al. 1999). Numerous studies have highlighted the crucial role of biofilm-forming bacteria in preventing corrosion. For example, Pseudomonas fragi and Escherichia coli DH5α have been found to reduce corrosion rates compared to sterile controls (Jayaraman et al. 1997a; 1997b). These findings suggest that live biofilm cells are crucial for corrosion inhibition, with bacterial metabolic processes playing a significant role in this phenomenon (Ismail et al. 2002).
This study investigates bacterial isolates from the Red Sea as eco-friendly corrosion inhibitors for mild steel (MS) in seawater. The research focuses on Alteromonas mediterranea and employs various techniques to evaluate their effectiveness in inhibiting corrosion. The study aims to assess corrosion behavior, characterize corrosion product layers, isolate and identify bacteria, analyze genetic characteristics, compare corrosion rates, investigate the impact of bacterial biofilms, and determine the corrosion protection potential of specific bacterial strains for MS in seawater.
Experimental
Materials and Methods
Study area and sample collection
Seawater samples were collected from the western region of the Red Sea near the ship maintenance area in Obhur, Jeddah, KSA (21°42′58.2″N, 39°05′53.4″E). The samples were transferred into two-liter bottles and promptly transported to the laboratory for further analysis.
Bacterial isolation
The bacterial strain was routinely grown in nutrient broth (NB) (Sigma-Aldrich, USA). The broth was prepared by combining 13 g of NB powder with 1,000 ml of seawater and sterilized for 15 minutes at 121°C. Additionally, the ammonium ferric citrate (AFC) (Sigma-Aldrich, USA) medium was used to enrich iron-interacting bacterial strains selectively. These bacteria are often associated with corrosion-related processes due to their ability to participate in iron cycling and form surface biofilms that influence the electrochemical behavior of metals. The AFC medium allows for the visual detection of such bacteria by promoting a color change from green to rust-red, resulting from the microbial oxidation of iron. This reaction indicates the presence of metabolically active strains capable of affecting corrosion either through inhibition or acceleration mechanisms in marine systems.
Gram staining and catalase test
Gram staining was performed according to the protocol outlined by Vincent in 1970. The presence of the catalase enzyme was assessed by adding 3% hydrogen peroxide to bacterial samples. The formation of bubbles indicated a positive catalase reaction.
Glycerol stocking and storage of pure isolates
Pure bacterial cultures were inoculated into tubes containing 3 ml of nutrient broth (NB), incubated for 48 hours, and then mixed with 50% glycerol (Fisher Scientific™, Thermo Fisher Scientific Inc., USA). The glycerol stocks were stored at –20°C for future use.
DNA extraction and PCR amplification of 16S rDNA gene
Genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN, Germany). Bacterial strains were cultured overnight according to the manufacturer’s guidelines, and 1 ml suspensions were centrifuged. The pellets were lysed with Buffer AL (QIAGEN, Germany) and Proteinase K, followed by adding ethanol. The mixture was then applied to QIAamp Spin Columns, washed with Buffer AW1 and AW2 (QIAGEN, Germany), and the DNA was eluted with Buffer AE (QIAGEN, Germany). Nucleic acids were quantified spectrophotometrically at 260 nm. The A260:A280 ratio was determined, and DNA integrity was verified using agarose gel electrophoresis. The 16S rRNA gene was amplified using universal primers 27F and 511R with GoTaq® Green Master Mix (Promega, USA). The thermocycler conditions included 35 cycles of denaturation, annealing, and extension. PCR products were confirmed on a 1% agarose gel.
16S rDNA gene products were produced by PCR amplification of the bacterial DNA samples using the GoTaq® Green Master Mix (2×, Promega, USA). Each reaction included 10 ng of genomic DNA from each strain, which was used to amplify this gene using universal 16S rDNA bacterial primers 27F (5′AGAGTTTGATCCTGGCTCAG3′) and 511R (5′GCGGCTGCTFGGCACRKAGT3′) (Janda et al. 2007).
For amplification, a thermocycler (Thermo Fisher Scientific Inc., USA) was utilized. The samples underwent a total of 35 cycles, starting with an initial cycle at 95°C for 3 minutes. Thereafter, they went through 32 cycles at 95°C for 45 seconds, 60°C for 45 seconds, and 72°C for 90 seconds. A final extension cycle lasting 10 minutes at 72°C was then followed by a soak at 10°C. Each PCR result was then electrophoresed in 10 μl aliquots on a 1% agarose gel that contained 0.5 μg/ml ethidium bromide. The presence of a 1,500 bp band was then verified by observing the gel under a UV transilluminator.
Automated DNA sequencing
Polymerase Chain Reaction (PCR) products were purified using the QIAquick PCR Purification Kit (QIAGEN, Germany) and sequenced with the ABI PRISM® 3700 system (Applied Biosystems™, Thermo Fisher Scientific Inc., USA). The sequences were submitted to GenBank and aligned using BLAST software for phylogenetic analysis.
Preparation of mild steel (MS) samples
Mild steel (MS) samples were obtained from the Shaaban Industry (Shaaban Steel Co.) in Jeddah, Saudi Arabia. In addition to iron, which constitutes the main component, the MS samples used in this study consist of the following elemental composition (by weight): 0.0804% C, 0.449% Mn, 0.2565% Cu, 0.119% Si, 0.0785% Ni, 0.0693% Cr, 0.015% Mo, 0.0214% S, 0.0085% P, 0.0092% N, 0.0004% V, and 0.0003% B. The specimens were cut into rods (5.0 cm length, 1.0 cm diameter), polished using grit papers, cleaned, weighed, and then immersed in seawater or seawater with inhibitors.
Aggressive solution (seawater)
The physicochemical properties of the collected Red Sea water were analyzed using standard methods, including those outlined by the American Public Health Association (APHA). Parameters included pH, electrical conductivity, total alkalinity (expressed as mg/l as CaCO3 and determined according to APHA Standard Method 2320 B) (Baird et al. 2017), total dissolved solids (TDS), and total suspended solids (TSS), with all values reported in mg/l where applicable (see Table I).
Tabel I
Chemical analysis of Red Sea water sample.
| Parameter | Value | Unit |
|---|---|---|
| Salt-related ions | ||
| Ca2+ | 496.0 | mg/l |
| Mg2+ | 1,512.0 | |
| Na+ | 11,920.0 | |
| K+ | 588.0 | |
| Cl– | 22,336.0 | |
| HCO3– | 156.0 | |
| NO3– | 1.0 | |
| SO43– | 2,440.0 | |
| PO3– | < 0.1 | |
| CO32– | < 0.1 | |
| SiO2 | < 1.0 | |
| Other Parameters | ||
| Total dissolved solid (TDS) | 43,550.0 | mg/l |
| Total suspended solids (TSS) | < 5.0 | mg/l |
| Total alkalinity | 128.0 | mg/l as CaCO3 |
| pH | 8.1 | |
| Conductivity | 72,550.0 | μS/cm2 |
Weight loss (WL) measurements
Polished and pre-weighed mild steel (MS) samples immersed in 60 ml of seawater under controlled laboratory conditions (21 ± 1°C) for varying durations ranging from 1 to 24 weeks. After each immersion period, samples were retrieved, cleaned according to ASTM G31-21 standards (2021) to remove corrosion products, rinsed with distilled water, dried, and reweighed to determine mass loss. The corrosion (CRWL) was calculated using the following equation (El Ibrahimi and Berdimurodov 2023):
weight loss ΔW, where LI IV is the weight loss (g), A is the exposed surface area (cm2), d is the metal density (g/cm3), and t is the exposure time (years). The resulting corrosion rate is expressed in micrometers per year (μm y−1). All experiments were performed in triplicate to ensure statistical reliability. Mean values and standard deviations were calculated accordingly.Microbial inhibition of mild steel (MS) corrosion
Inhibition solutions were prepared by blending cultured bacterial suspensions with natural seawater. Each bacterial isolate was cultured in nutrient broth at 37°C for 24 hours, and the bacterial density was adjusted to an optical density of OD600 = 0.5 prior to use.The final inhibition medium was prepared by mixing 10% (v/v) of the bacterial culture with 90% seawater to simulate biotic corrosion conditions. Mild steel (MS) samples were then immersed in these inhibition solutions for varying durations (1–24 weeks). Weight loss (WL) measurements were performed after each exposure period, and the inhibition efficiency (IEWL%) was calculated using the following equation:
where and CRWL are the corrosion rates in the absence and presence of inhibitors, respectively.Electrochemical measurements
were conducted using a cell system with three electrodes: a working electrode (mild steel rod), a reference electrode (Ag/AgCl), and an auxiliary electrode (Pt wire). Electrochemical impedance spectroscopy (ElS) and potentiodynamic polarization (PDP) tests were performed using an ACM Gill AC potentiostatlgalvanostat apparatus model 1649 (ACM Instruments, UK). The working electrode was prepared as previously described and subsequently immersed in the seawater test solution in the absence and presence of inhibitors.
Electrochemical impedance spectroscopy (EIS)
measurements were performed with a 10mV perturbation at open-circuit potential. The frequency range was 30 kHz to 0.1 Hz. Polarization resistance and doublelayer capacitance were determined. Inhibition efficiency was calculated using the equation:
where Rp are the polarization resistances with and without inhibitors, respectively.Potentlodynamic polarization (PDP) measurements
were carried out within a potential range of –700 mV to –200 mV at a sweep rate of 60 mV/rnin, Corrosion currents icorr and corrosion potential Ecorr were determined using the Tafel extrapolation method. Inhibition efficiency lEi% was calculated using the equation:
where and icorr are the corrosion current densities without and with inhibitors, respectively.Surface examination study (optical photographs)
Visual surface analyses of mild steel (MS) specimens were conducted using a VMS-004 USB digital microscope to assess the progression of corrosion and the effects of inhibition. Photographic documenttion was performed for uninhibited control samples after various immersion periods (1, 2, 4, 6, 9, 12, 16, and 24 weeks) in natural seawater. Additionally, specimens immersed for 12 weeks in seawater containing bacterial inhibitors (BAC1, BAC2, and BAC3) were imaged under identical conditions. All imaging was carried out immediately after retrieving the samples under the same conditions as the weight loss experiments, ensuring consistency in exposure time, temperature, and cleaning procedures. This comparative visualization was specifically intended to highlight the protective effect of the bacterial biofilms relative to the untreated control at a representative mid-exposure interval.
Statistical analysis
All experimental data were analyzed using descriptive statistics and expressed as mean ± standard deviation (SD) based on triplicate measurements. One-way analysis of variance (ANOVA) was performed to determine the significance of differences between treatment groups. A p-value of less than 0.05 was considered statistically significant.
Results
Mild steel (MS) corrosion
The progressive degradation of mild steel specimens immersed in natural seawater without corrosion inhibitors was illustrated in Fig. 1a. As the immersion period increases from week 1 to week 24, a clear visual transformation is observed. Initially, minor surface discoloration is evident; however, with extended exposure, the metal surface becomes heavily encrusted with corrosion products and localized attack becomes more pronounced. By week 12 and beyond, severe rust formation, pitting, and uneven surface deterioration indicate an aggressive corrosion environment driven by chloride ions and bioactive marine conditions. This time-dependent deterioration underscores the vulnerability of mild steel in untreated seawater and highlights the need for effective corrosion mitigation strategies, particularly in marine applications.

Fig. 1a.
Visual images of mild steel specimens after immersion in a) free seawater at different time intervals and b) after 12 weeks of exposure to seawater without and with bacterial inhibitors.
Phenotypic and molecular identification of marine bacterial isolates
Three bacterial isolates were obtained from Red Sea seawater samples using ammonium ferric citrate (AFC) broth, which selectively promotes the growth of iron-precipitating bacteria. Isolation was visually confirmed by a color change in the medium from green to a rust-red hue. Pure colonies were further subjected to phenotypic characterization, including Gram staining, catalase testing, and microscopic examination of colony and cell morphology. All isolates were identified as Gram-negative and catalase-negative, exhibiting distinct cellular structures and colony features as shown in Fig. 2. For molecular identification, genomic DNA was extracted, and the 16S rRNA gene was amplified using universal primers through polymerase chain reaction (PCR). The resulting PCR products (~1,500 bp) were verified via agarose gel electrophoresis (Fig. 3). Sequencing data were aligned with the GenBank database using BLAST, revealing 98.46% to 99.42% identity with known species. The isolates were thus identified as Pseudoalteromonas phenolica (BAC1), Pseudoalteromonas shioyasakiensis (BAC2), and Alteromonas mediterranea (BAC3), as summarized in Table II. Phylogenetic analysis using the neighbor-joining method further confirmed the taxonomic positioning of these strains (Fig. 4).

Fig. 2.
Alteromonas mediterranea isolates a) BAC1, b) BAC2, and c) BAC3. The first description was based on its motility and Gram-negative status. 100×, scale bar = 10 μm.

Fig. 3.
The agarose gel electrophoresis showing the amplification of 16S rRNA gene from seven bacterial isolates (1 to 7). M – DNA ladder: molecular size marker

Fig. 4.
The phylogenetic tree was constructed based on the alignment of the 16S rRNA gene sequences of BAC1 (OR852740.1), BAC2 (OR852741.1), and BAC3 (OR852742.1) with other bacterial accessions available in GenBank. The tree was constructed using neighbor-joining (NJ) in CLC Main Workbench V8.1.3 (QIAGEN, Germany). The numerical values at the branch nodes indicate the bootstrap values.
Table II
Information and identification for 16S rRNA gene sequences of BAC1, BAC 2, and BAC 3.
| Code | Reference accession numbers | Identified bacterial isolates | Identity % |
|---|---|---|---|
| BAC 1 (OR852740.1) | NR 113299.1 | Pseudoalteromonas phenolica | 99.42% |
| NR 028809.1 | Pseudoalteromonas phenolica | 98.27% | |
| KY073271 | Pseudoalteromonas phenolica | 99.80% | |
| BAC 2 (OR852741.1) | NR 125458.1 | Pseudoalteromonas shioyasakiensis | 96.67% |
| BAC 3 (OR852743.1) | NR 148755.1 | Alteromonas mediterranea | 98.17% |
| NR 148756.1 | Alteromonas mediterranea | 98.46% |
Corrosion behavior of mild steel in seawater and the inhibitory effects of marine bacterial strains over time
The corrosion rates (CRWL) and pit depths (Pd) of mild steel (MS) under different immersion times in seawater are presented in Table III. The corrosion rates varied, beginning at 36.54 μm y−1 in the first week and decreasing to 12.38 μm y−1 by the 24th week. Similarly, the pit depths increased from 0.70 μm to 5.70 μm.
Table III
Pit depth and corrosion rates of mild steel control at different immersion time in seawater.
| Immersion period (weeks) | Weight loss Δw (g) | Pit depth Pd (μm) | Corrosion rate CRWL (μm y−1) |
|---|---|---|---|
| 1st | 0.0097 ± 0.0006 | 0.70 ± 0.03 | 36.54 ± 1.12 |
| 2nd | 0.0161 ± 0.0011 | 1.13 ± 0.05 | 29.37 ± 0.94 |
| 4th | 0.0311 ± 0.0018 | 2.27 ± 0.07 | 29.55 ± 0.97 |
| 6th | 0.0484 ± 0.0024 | 3.36 ± 0.09 | 29.19 ± 1.03 |
| 9th | 0.0820 ± 0.0031 | 5.68 ± 0.12 | 32.93 ± 1.22 |
| 12th | 0.0398 ± 0.0042 | 2.75 ± 0.10 | 11.95 ± 0.81 |
| 16th | 0.0368 ± 0.0054 | 2.63 ± 0.09 | 8.56 ± 0.63 |
| 24th | 0.0789 ± 0.0079 | 5.70 ± 0.14 | 12.38 ± 0.77 |
Table IV summarizes the corrosion behavior of mild steel in seawater in the presence of BAC1 over a 24-week immersion period. The corrosion rate showed a gradual increase from 2.64 μm·y−1 in the first week to 3.60 μm·y−1 by the 24th week, accompanied by a consistent rise in pit depth from 0.05 μm to 1.66 μm. The inhibition efficiency fluctuated during this period, ranging from 59.74% to a maximum of 96.37%, indicating moderate to high protective performance, with varying effectiveness over time. In comparison, treatment with BAC2 exhibited relatively higher and more consistent inhibitive performance throughout the 24 weeks, as shown in Table V. The inhibition efficiency ranged from 96.96% in the early weeks to 71.55% towards the end of the immersion period. Although corrosion rates and pit depths increased with time, distinct intervals, particularly the 12th week, showed noticeable reductions, suggesting temporal stability in biofilm protection.
Table IV
Corrosion rates and inhibition efficiencies for mild steel corrosion in seawater in the presence of BAC1 (Pseudoalteromonas phenolica) over a 24-week immersion period.
| Immersion period (weeks) | Weight loss Δw (g) | Pit depth Pd (μm) | Corrosion rate CRWL (μm y−1) | IEWL% |
|---|---|---|---|---|
| 1st | 0.0008 ± 0.00003 | 0.05 ± 0.01 | 2.64 ± 0.10 | 92.78 ± 1.1 |
| 2nd | 0.0016 ± 0.00005 | 0.12 ± 0.02 | 3.04 ± 0.12 | 89.65 ± 1.2 |
| 4th | 0.0021 ± 0.00007 | 0.15 ± 0.02 | 1.95 ± 0.08 | 93.41 ± 1.0 |
| 6th | 0.0023 ± 0.00008 | 0.17 ± 0.02 | 1.44 ± 0.07 | 95.08 ± 0.9 |
| 9th | 0.0029 ± 0.00009 | 0.21 ± 0.03 | 1.19 ± 0.05 | 96.37 ± 0.8 |
| 12th | 0.0028 ± 0.00008 | 0.20 ± 0.03 | 0.86 ± 0.04 | 92.76 ± 0.7 |
| 16th | 0.0150 ± 0.0004 | 1.06 ± 0.05 | 3.45 ± 0.14 | 59.74 ± 1.5 |
| 24th | 0.0255 ± 0.0006 | 1.66 ± 0.06 | 3.60 ± 0.15 | 70.94 ± 1.4 |
Table V
Corrosion rates and inhibition efficiencies for mild steel corrosion in seawater in the presence of BAC 2 (Pseudoalteromonas shioyasakiensis) over a 24-week immersion.
| Immersion period (weeks) | Weight loss Δw (g) | Pit depth Pd (μm) | Corrosion rate CRWL (μm y−1) | IEWL% |
|---|---|---|---|---|
| 1st | 0.0003 ± 0.00001 | 0.02 ± 0.01 | 1.11 ± 0.05 | 96.96 ± 0.9 |
| 2nd | 0.0010 ± 0.00004 | 0.09 ± 0.02 | 2.43 ± 0.10 | 91.72 ± 1.1 |
| 4th | 0.0024 ± 0.00006 | 0.17 ± 0.02 | 2.26 ± 0.09 | 92.37 ± 1.0 |
| 6th | 0.0025 ± 0.00007 | 0.19 ± 0.02 | 1.67 ± 0.08 | 94.28 ± 0.9 |
| 9th | 0.0027 ± 0.00008 | 0.19 ± 0.02 | 1.12 ± 0.05 | 96.60 ± 0.8 |
| 12th | 0.0022 ± 0.00007 | 0.16 ± 0.02 | 0.69 ± 0.03 | 94.18 ± 0.7 |
| 16th | 0.0156 ± 0.0005 | 1.10 ± 0.05 | 3.57 ± 0.13 | 58.27 ± 1.6 |
| 24th | 0.0228 ± 0.0006 | 1.62 ± 0.06 | 3.52 ± 0.14 | 71.55 ± 1.4 |
Meanwhile, the data presented in Table VI reflect the corrosion parameters for mild steel (MS) treated with BAC3. The inhibition efficiency displayed wide variability, ranging from a low of 4.57% to a peak of 99.00%, with fluctuating corrosion rates and increasing pit depths. A marked reduction in corrosion rate and pit depth was notably observed at the 12th week, highlighting a transient but significant inhibitory effect. These findings collectively indicate that while all three bacterial strains exhibit inhibitory effects to varying degrees, BAC2 demonstrates the most stable performance over time, whereas BAC3 shows peak inhibition at specific intervals, particularly during the mid-immersion phase.
Table VI
Corrosion rates and inhibition efficiencies for mild steel corrosion in seawater in the presence of BAC 3 (Alteromonas mediterranea) over a 24-week immersion period.
| Immersion period (weeks) | Weight loss Δw (g) | Pit depth Pd (μm) | Corrosion rate CRWL (μm y−1) | IEWL% |
|---|---|---|---|---|
| 1st | 0.0001 ± 0.00001 | 0.007 ± 0.01 | 0.36 ± 0.02 | 99.00 ± 0.5 |
| 2nd | 0.0009 ± 0.00003 | 0.07 ± 0.02 | 1.74 ± 0.08 | 94.06 ± 0.9 |
| 4th | 0.0017 ± 0.00006 | 0.12 ± 0.02 | 1.60 ± 0.07 | 94.59 ± 0.8 |
| 6th | 0.0027 ± 0.00007 | 0.18 ± 0.03 | 1.56 ± 0.07 | 94.65 ± 0.8 |
| 9th | 0.0036 ± 0.00008 | 0.26 ± 0. 03 | 1.52 ± 0.06 | 95.39 ± 0.7 |
| 12th | 0.0038 ± 0.00009 | 0.27 ±0.04 | 1.18 ± 0.05 | 90.11 ± 0.6 |
| 16th | 0.0159 ± 0.0005 | 1.16 ± 0.05 | 3.80 ± 0.15 | 55.65 ± 1.8 |
| 24th | 0.0786 ± 0.0012 | 5.44 ± 0.10 | 11.82 ± 0.30 | 4.57 ± 2.0 |
These observations are further supported by Fig. 1b, which provides visual evidence of the MS surfaces after 12 weeks of exposure to seawater containing BAC1, BAC2, and BAC3. The images clearly show smoother and less damaged surfaces in the treated samples compared to the heavily corroded control. The presence of uniform, less-pitted areas on the steel indicates the protective role of the bacterial biofilms, with BAC2 and BAC3 exhibiting substantial surface preservation. This visual confirmation aligns with quantitative data, reinforcing the significant yet time-sensitive inhibitory action of the bacterial treatments.
Electrochemical impedance spectroscopy (EIS)
The EIS results, presented in Table VII, after 1 hour and 24 hours of immersion, reveal distinct electrochemical behavior between the uninhibited (blank) sample and those treated with bacterial isolates. All three strains, BAC1, BAC2, and BAC3, contributed to an increase in charge transfer resistance (Rct), indicating their ability to reduce corrosion activity by modifying the steel/electrolyte interface.
Table VII
Impedance parameters for corrosion of mild steel in sweater in the absence and presence of bacterial inhibitors.
| Medium | Time (h) | Rs(Ω cm2) | Rct (Ω cm2) | Cdl (μF cm-2) | IER% |
|---|---|---|---|---|---|
| Blank | 1 | 3.73 ± 0.08 | 916.7 ± 35 | 15.68 ± 0.6 | – |
| BAC 1 | 5.31 ± 0.12 | 8826.0 ± 110 | 4.48 ± 0.2 | 89.61 ± 1.2 | |
| BAC 2 | 5.67 ± 0.13 | 6914.0 ± 95 | 4.923 ± 0.2 | 86.74 ± 1.1 | |
| BAC 3 | 3.19 ± 0.09 | 6128.0 ± 90 | 5.18 ± 0.2 | 85.05 ± 1.0 | |
| Blank | 24 | 4.51 ± 0.10 | 631.6 ± 30 | 20.01 ± 0.7 | – |
| BAC 1 | 4.87 ± 0.11 | 1183.0 ± 45 | 9.61 ± 0.3 | 46.61 ± 1.1 | |
| BAC 2 | 5.09 ± 0.12 | 8112.0 ± 102 | 2.07 ± 0.1 | 92.22 ± 1.3 | |
| BAC 3 | 3.45 ± 0.10 | 1118.0 ± 42 | 10.25 ± 0.4 | 43.56 ± 1.0 |
1 IER% – Inhibition Efficiency Percentage –This indicates the percentage of inhibition achieved by the inhibitor, comparing the impedance to the blank (no inhibitor) condition.
1 Cdl: (μF cm-2) – Double Layer Capacitance – It represents the capacitance associated with the interface between the electrode and the electrolyte. It’s measured in microfarads per square centimeter (μF cm2).
Notably, BAC1 exhibited the highest after 1 hour, suggesting strong initial inhibition efficiency. However, after 24 hours of immersion, BAC2 maintained the highest, reflecting superior long-term stability and continued inhibition performance. BAC3 initially provided moderate protection, but its effectiveness diminished over time, as evidenced by a reduction at the 24-hour mark.
In terms of double-layer capacitance (Cdl), all bacterial treatments initially caused a reduction compared to the blank, which is attributed to the formation of biofilm layers that act as physical barriers, decreasing the dielectric constant and ion mobility at the metal surface. Over time, BAC2 maintained the lowest values, supporting its role in forming a more compact and persistent protective film. These electrochemical findings are corroborated by the Nyquist plots in Fig. 5, where BAC2-treated samples exhibited the largest semicircle diameters, particularly after 24 hours, indicating enhanced resistance to charge transfer and better corrosion protection.

Fig. 5.
Nyquist plots for mild steel corrosion in seawater in the absence and presence of bacterial inhibitors at a) 1 hour and b) 24 hours of immersion.
Potentiodynamic polarization (PDP)
In both the absence and presence of bacterial inhibitors, the corrosion behavior of mild steel (MS) in natural seawater was evaluated using PDP techniques. The polarization curves obtained after 1 hour and 24 hours of immersion are presented in Fig. 6, while the corresponding electrochemical parameters derived from these curves are summarized in Table VIII. After 1 hour of immersion, all three bacterial strains demonstrated remarkable corrosion inhibition efficiencies. The blank sample (uninhibited system) exhibited a corrosion current density of 0.3607 mA cm−2, which significantly decreased in the presence of bacterial inhibitors. For instance, BAC1 reduced to 0.0099 mA cm−2, corresponding to an inhibition efficiency of 97.25%. BAC2 and BAC3 exhibited even slightly higher efficiencies, achieving 97.31% and 97.75%, respectively, with similarly low values. These results confirm the rapid and effective formation of a protective film by bacterial metabolites, which suppresses the electrochemical reaction pathways on the MS surface. The observed shifts in corrosion potential and changes in both anodic (βa) and cathodic (βc) Tafel slopes further support the influence of the inhibitors on both the anodic metal dissolution and oxygen reduction processes. This mixed-type inhibition behavior reflects the comprehensive action of the bacterial inhibitors in altering the electrochemical kinetics of corrosion.

Fig. 6.
Polarization curves for mild steel corrosion in seawater in the absence and presence of bacterial inhibitors at a) 1 hour and b) 24 hours a of immersion.
Table VIII
Polarization parameters for corrosion of mild steel in sweater in the absence and presence of bacterial inhibitors.
| Medium | Time (h) | –Ecorr(mv) | βa (mV dec-1) | -βc (mV dec-1) | icorr (mA cm-2) | IEi % |
|---|---|---|---|---|---|---|
| Blank | 1 | 538.4 ± 2.1 | 80.25 ± 1.5 | 43.73 ± 1.2 | 0.3607 ± 0.012 | – |
| BAC 1 | 478.7 ± 1.8 | 70.28 ± 1.2 | 121.92 ± 1.6 | 0.0099 ± 0.0004 | 97.25 ± 0.8 | |
| BAC 2 | 449.1 ±1.7 | 84.28 ± 1.4 | 155.09 ± 1.7 | 0.0097 ± 0.0003 | 97.31 ± 0.9 | |
| BAC 3 | 429.2 ± 1.6 | 92.80 ± 1.4 | 97.73 ± 1.4 | 0.0081 ± 0.0003 | 97.75 ± 0.9 | |
| Blank | 24 | 524.1 ± 2.0 | 54.64 ± 1.3 | 57.39 ± 1.3 | 0.4991 ± 0.015 | – |
| BAC 1 | 405.0 ± 1.9 | 62.54 ± 1.1 | 123.19 ± 1.5 | 0.0229 ± 0.0006 | 95.41 ± 0.7 | |
| BAC 2 | 449.5 ± 1.8 | 97.49 ± 1.6 | 150.68 ± 1.6 | 0.0189 ± 0.0005 | 96.21 ± 0.8 | |
| BAC 3 | 566.3 ± 2.2 | 94.02 ± 1.5 | 80.17 ± 1.3 | 0.1868 ± 0.006 | 62.57 ± 1.2 |
1 IEi% – Inhibition Efficiency Percentage – Indicates the percentage of inhibition achieved by the inhibitor compared to the blank condition. icorr: Corrosion Current Density – Represents the rate of metal loss due to corrosion.
1 βc – Cathodic Tafel Slope – Denotes the slope of the cathodic Tafel line, indicating the rate of cathodic reaction in electrochemical corrosion processes.
At 24 hours of immersion, although the inhibitors maintained notable corrosion protection, a slight reduction in performance was observed. For example, BAC3, which had shown the highest efficiency at 1 hour, experienced a decline in inhibition efficiency to 62.57%, with a corresponding increase in to 0.1868 mA cm−2. This may suggest partial degradation or detachment of the protective biofilm over prolonged exposure. Nevertheless, BAC1 and BAC2 retained high efficiencies (95.41% and 96.21%, respectively), indicating better long-term stability.
The comparative analysis between the short- and long-term exposures highlights the importance of time-dependent evaluation in inhibitor studies. While all bacterial strains demonstrated high initial inhibition performance, their durability varied over time, potentially due to biofilm restructuring or interaction with corrosive ions in the seawater environment. These findings highlight the potential of marine-derived bacterial strains as sustainable and highly effective corrosion inhibitors for MS, particularly in short- to medium-term applications. Future research should investigate strategies to enhance the long-term stability of these biofilms for extended protection.
Discussion
This study investigates the corrosion behavior of mild steel (MS) in seawater, utilizing weight loss (WL) measurements and electrochemical tests, including electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization (PDP) (Yu et al. 2021). Corrosion is a degradation process that can affect the mechanical properties of MS and result in structural failure (Revie and Uhlig 2008). The research investigates the corrosive effects of seawater on MS over a 24-week immersion period, aiming to elucidate the corrosion mechanisms and the impact of immersion duration, environmental factors, and MS composition on observed corrosion rates and pit depths (Chohan et al. 2024).
FeO(OH) are known to provide some level of protection to the underlying steel substrate by acting as a barrier against further corrosion. However, the inner layer, consisting of iron sulfides (FeS), was found to be more detrimental as it promoted localized corrosion and pitting on the steel surface. The study also investigated the corrosion inhibition efficiency of the bacterial isolates by analyzing their ability to reduce the corrosion rate of MS in a simulated marine environment. The results showed that certain bacterial isolates could significantly decrease the corrosion rate, indicating their potential as eco-friendly corrosion inhibitors. These findings open new possibilities for developing sustainable corrosion protection methods in marine applications (Vignesh et al. 2024). Overall, the study provides valuable insights into the corrosion behavior of MS in marine environments and the potential of bacterial isolates as corrosion inhibitors. By understanding the mechanisms involved in corrosion processes and exploring alternative corrosion inhibition strategies, researchers can work towards mitigating the detrimental effects of corrosion in marine settings, ultimately leading to improved safety and cost savings (Kartsonakis and Charitidis 2020).
The inner layer, in contact with the steel surface, was dominated by iron (II)-based corrosion products, such as magnetite (Fe3O4) and iron sulfide compounds (FeS), which appeared black (Kartsonakis and Charitidis 2020). The formation of magnetite and iron sulfide compounds is often associated with anaerobic corrosion processes (Beech and Sunner 2004; Jiang et al. 2023). The segregation of different compounds into distinct layers indicates a multi-stage corrosion process influenced by environmental conditions. Specifically, the presence of chloride ions and dissolved oxygen plays a crucial role in the formation and evolution of these layers (Nagaoka et al. 2020; Jiang et al. 2023). Chloride ions, abundant in seawater, are known to accelerate corrosion by disrupting the passive film on the steel surface (Song et al. 2017).
Over time, the rust coating became denser and spongy, causing it to detach and fall into the solution. This detachment resulted in the accumulation of corrosion products with prolonged immersion duration (Pal and Lavanya 2022). The densification and fragility of the rust layer may indicate altered chemical compositions or structural changes due to continued exposure, leading to its disintegration (Petersen and Melchers 2023). After cleaning, the samples showed scratches that originated from pitting initially and progressed to crevice corrosion. Pitting corrosion is a localized form of corrosion that can create small holes on the metal surface, while crevice corrosion occurs in confined spaces where the electrolyte is stagnant (Roberge 2018).
Continuous corrosion leads to visible cracking on the surface, forming larger craters known as channel pattern corrosion (Revie and Uhlig 2008; Jiang et al. 2023). This progression indicates that corrosion not only changes the surface appearance but also compromises structural integrity. These observations are essential for understanding the long-term effects of seawater corrosion on MS structures (Rajput et al. 2020). The study of the corrosion behavior of MS in seawater involved WL measurements and electrochemical tests, including EIS and PDP (Chugh et al. 2020; Castaño-González et al. 2024). Despite its simplicity, the WL technique is widely used to evaluate corrosion rates (Roberge 2018; El Ibrahimi and Berdimurodov 2023).
The recorded WL and pit depth data over 24 weeks indicated a steady increase, consistent with the corrosive nature of seawater on MS under the experimental conditions. WL measurements provide an average corrosion rate over the immersion period (Al-Fozan and Malik 2008; Priyotomo et al. 2018). The duration of immersion directly impacted the WL and pit depth, with prolonged exposure resulting in higher corrosion, primarily due to the detrimental effect of chloride ions (Cl–), which are abundant in seawater (Revie and Uhlig 2008; Priyotomo et al. 2018; Chohan et al. 2024). However, the WL method provides an average corrosion rate and does not offer detailed information on the corrosion mechanisms (Taheri et al. 2020).
The build-up of corrosion products on the metal surface hinders the diffusion of substances like oxygen, slowing cathodic processes and decreasing the corrosion rate. However, it allows Cl– ions to penetrate, sustaining corrosion despite the reduced rate (Ansari et al. 2019; Yan et al. 2021). Moreover, the accumulation of corrosion products can create differential aeration cells, potentially accelerating corrosion in specific areas (Revie and Uhlig 2008).
Extremophilic bacteria from unique environments, such as the Red Sea, show great potential in various applications due to their adaptability (Margesin and Schinner 2005; Dalmaso et al. 2015). Extremophiles are microorganisms that thrive in extreme conditions, such as high salinity, temperature, or pH (Margesin and Schinner 2005; Dalmaso et al. 2015). Bacterial isolation and identification followed the methods outlined in Bergey’s Manual of Systematics of Archaea and Bacteria (Garrity 2016). The absence of black precipitate in the ammonium ferric citrate (AFC) broth medium indicates that the isolated seawater bacteria strains do not produce hydrogen sulfide (H2S) by reducing ferric citrate to ferrous iron.
Corrosion inhibitors that can mitigate H2S-induced corrosion are highly sought after in the oil and gas industry (Umoren et al. 2020). The presence of H2S, produced by sulfate-reducing bacteria (SRB), poses a significant corrosion risk to pipelines and equipment (Beech and Sunner 2004; Vigdorovich et al. 2021; Alotaibi et al. 2024). The isolates, identified through phenotypic characteristics such as cell and colony morphology, Gram staining, and catalase tests, were found to be Gram-negative and exhibited variations in shape, form, margin, and elevation (Pradhan and Tamang 2019; Holkar et al. 2024). Subsequent PCR amplification and sequencing of the 16S rRNA gene confirmed that the isolates were P. phenolica (BAC1), P. shioyasakiensis (BAC2), and A. mediterranea (BAC3) (Xu et al. 2021; Holkar et al. 2024). These findings align with previous studies on marine bacterial diversity (Barberán et al. 2017). Further genetic analysis could uncover more about their unique adaptations (Hiraishi et al. 1998, Chen et al. 2024). Identifying these bacteria lays the groundwork for understanding their role in corrosion inhibition (Karn et al. 2017; Tripathi et al. 2021). Developing sustainable and eco-friendly solutions for corrosion protection, particularly in marine environments, remains an ongoing challenge. Utilizing indigenous biofilms from local environments is an effective strategy for protecting infrastructure (Little and Lee 2007).
These investigations focused on isolating and assessing three aerobic marine bacteria known for their strong biofilm-forming abilities to evaluate their effectiveness in protecting MS against corrosion. Biofilms are complex microbial communities attached to a surface that can either accelerate or inhibit corrosion depending on their composition and activity (Beech and Sunner 2004). The study established a direct correlation between the corrosion inhibitory effect of these bacteria and their proficiency in forming biofilms. Comprehensive analyses, including biofilm characterization, electrochemical evaluations, WL assessments, and analyses of corrosion byproducts, support this conclusion. Biofilms can act as a physical barrier, preventing corrosive agents from reaching the metal surface (Dou et al. 2021; Stancu 2022).
Our study investigated the inhibition rate and corrosion dynamics of MS in seawater following treatment with BAC1, BAC2, and BAC3 over 24 weeks. The results showed that the highest inhibition efficiencies were observed at different time points for each inhibitor: week 9 for P. phenolica, week 1 for P. shioyasakiensis, and week 1 for A. mediterranea (Guo et al. 2019). This suggests that these specific weeks represent peak periods for the inhibitors, demonstrating their maximum effectiveness against corrosion. The variation in peak inhibition efficiencies among the bacterial isolates may be attributed to differences in their growth rates, biofilm formation capabilities, or the production of distinct inhibitory compounds (Guo et al. 2019). Furthermore, the presence of A. mediterranea significantly increased inhibition efficiency to 98.99%, possibly due to a synergistic effect between inhibitor molecules and active species in seawater (Ricky et al. 2021). This suggests the potential for developing multi-component corrosion inhibitors. Corrosion rates were evaluated by measuring the WL of an MS specimen submerged for 7 days in basal salts solution (BSS) control and BSS containing Pseudomonas flava and Pseudomonas stutzeri individually, as reported in the study by Xu et al. (2021). The results showed a significant decrease in the corrosion rate of the test coupons after 7 days in the medium with P. flava. Similar outcomes were observed in studies by Karn et al. (2017) and Xu et al. (2021), as well as Marsili et al. (2018), highlighting the potential of biofilm formation, especially in mixed species, as an effective corrosion control strategy. Mixed-species biofilms may offer improved corrosion inhibition compared to single-species biofilms due to synergistic interactions among different microbial species (Karn et al. 2017; Marsili et al. 2018; Xu et al. 2021). These findings suggest that microbial biofilms could be a promising, environmentally friendly option for corrosion control (Beech and Sunner 2004). However, the long-term stability and efficacy of these biofilms require further investigation.
The results of PDP tests conducted in seawater with various bacterial inhibitors provide valuable insights into the effectiveness of these inhibitors in mitigating corrosion over both short and long durations. In particular, BAC1, BAC2, and BAC3 demonstrated impressive inhibition efficiencies of over 97% after just one hour of exposure, indicating their potential to reduce corrosion rates in seawater environments significantly. This is crucial for various industrial applications where corrosion poses a significant threat to equipment and structures (Chang et al. 2024). The high inhibition efficiencies observed in the PDP tests suggest that these bacterial isolates can form a protective layer on the steel surface, thereby preventing the access of corrosive agents (Shaban et al. 2023; Chang et al. 2024). This rapid inhibition is crucial for applications that require immediate corrosion protection. The studies by Ghazaee et al. (2024) and Răuţă et al. (2025) support the findings from PDP tests, showing that the presence of inhibitors effectively reduces corrosion rates without altering the underlying corrosion mechanism. The observed shifts in corrosion potential towards more positive values with the addition of inhibitors, indicating the inhibition of anodic reactions, are consistent with the alterations in cathodic and anodic Tafel slopes seen in the PDP tests. This suggests that the inhibitors may impact the kinetics of cathodic and anodic reactions, influencing the overall corrosion process. Additionally, EIS could provide further insights into the mechanisms (Royani et al. 2024). EIS can offer information on the resistance and capacitance of the protective film formed by the inhibitors.
However, fluctuations in inhibition performance after 24 hours suggest potential variability in long-term effectiveness. These fluctuations could be due to factors such as inhibitor degradation, environmental conditions, or the formation of protective films on the metal surface that may deteriorate over time. While the inhibitors maintain significant efficiency even after 24 hours, further research is necessary to comprehend the underlying mechanisms of these fluctuations and enhance inhibitor formulations for improved stability and durability in practical applications. Additional research is necessary to elucidate the precise mechanisms by which these bacterial isolates inhibit corrosion and enhance their performance for long-term corrosion protection in marine environments (Liu et al. 2017). These studies should identify the specific factors contributing to these fluctuations and devise strategies to address them.
Conclusion
This study investigated the protective effects of selected bacterial isolates against mild steel (MS) corrosion in natural seawater environments. Based on weight loss (WL) measurements, electrochemical analyses, and surface characterizations, the findings lead to several key conclusions: Firstly, the research confirmed that MS is highly susceptible to corrosion in natural seawater, primarily due to the aggressive action of chloride ions. These ions destabilize protective surface layers, accelerating corrosion rates and pit formation. Additionally, molecular characterization identified three promising bacterial isolates from the Red Sea: P. phenolica (BAC1), P. shioyasakiensis (BAC2), and A. mediterranea (BAC3). The results indicated that all three bacterial strains significantly improved the corrosion resistance of MS, with maximum inhibition efficiencies observed over different immersion periods: week 9 for BAC1 (96.37%) and week 1 for both BAC2 (96.96%) and BAC3 (99.00%). This highlights the time-dependent protective capabilities of these strains. Moreover, electrochemical measurements demonstrated that all bacterial isolates considerably enhanced corrosion protection for MS by increasing charge transfer resistance (Rct), reducing double-layer capacitance (Cdl), and lowering corrosion current densities (icorr). This confirms that the presence of these bacterial inhibitors modifies the steel’s electrochemical behavior. Surface analysis through optical imaging verified the formation of bacterial biofilms, which contributed to corrosion resistance by acting as a physical barrier against aggressive seawater species. Among the tested strains, BAC2 demonstrated the most consistent long-term inhibition, whereas BAC3 exhibited high but less stable performance. BAC1 showed strong early-stage protection. This comparative assessment underscores the strain-specific dynamics of biofilm formation and inhibitor efficacy. Utilizing eco-friendly, naturally sourced bacteria as corrosion inhibitors presents a sustainable and effective alternative to traditional chemical inhibitors for protecting metals in marine environments. In conclusion, this study highlights the potential of utilizing bacterial biofilms as a green strategy for corrosion mitigation, encouraging further exploration into the development of biologically based corrosion protection systems.
Notes
[9] Contributed by Author contributions
H.S. conducted the experimental work. A.M.A.T., H.E.A.A., and R.M.G. conceptualized the study and designed the methodology. H.S. and R.M.G. contributed to sample collection. H.S., and A.H.A-M performed data analysis and interpretation. H.S., A.A.A-N, and L.A.D wrote the initial manuscript and A.A.A-N and L.A.D. edited the manuscript. A.A-H and N.M.B. supervised the laboratory work. R.A.A. oversaw the project, provided critical revisions, and approved the final manuscript. All authors reviewed and agreed to the published version of the manuscript.
[10] Conflicts of interest Conflict of interest
The authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication.