Antimicrobial Resistance Mechanisms in Carbapenem-Resistant Pseudomonas aeruginosa Clinical Strains Isolated in Shanghai, China

Target gene	Primers	Sequence (5′ to 3′)
mexB	mexB-F	CAACATCCAGGACCCACTCT
mexB	mexB-R	AGGAAATCTGCACGTTCTGC
mexD	mexD-F	CTACCCTGGTGAAACAGC
mexD	mexD-R	AGCAGGTACATCACCATCA
mexF	mexF-F	TGTACGCGAACGACTTCAAC
mexF	mexF-R	GAGGTGTCGCTGACCTTGAT
mexY	mexY-F	TCAGGCCGACCTTGAAGTAG
mexY	mexY-R	TCTCGGTGTTGATCGTGTTC
rpsL	rpsL-F	TACTTCGAACGACCCTGCTT
rpsL	rpsL-R	TTTCCTCGTACATCGGTGGT

Distribution of sequence types and antimicrobial resistance genes. In the phylogenetic tree, each branch is labeled with numerical values representing its length, which directly reflects the genetic distance. The 40 CRPAs can be divided into two major evolutionary branches in the upper and lower parts. Heat map of the antimicrobial resistance genes of 40 CRPAs showed the prevalence of resistance genes in different isolates, green represent the presence of the resistance gene, and blue represent its absense.

Table II

Resistance rates of CRPA and C SPA isolates to commonly used antibiotics.

Antibiotics	CRPA (n = 40)		CSPA (n = 222)		p
Antibiotics	No.	Rate (%)	No.	Rate (%)	p
TCC	29	72.50	37	16.67	< 0.001*
TZP	28	70.00	33	14.86	< 0.001*
MEM	29	72.50	0	0.00	< 0.001*
IMP	40	100.00	0	0.00	< 0.001*
FEP	10	25.00	4	1.80	< 0.001*
CSL	25	62.50	20	9.01	< 0.001*
CAZ	11	27.50	16	7.21	< 0.001*
ATM	11	27.5	24	10.81	0.004*
TOB	14	35.00	5	2.25	< 0.001*
AMK	3	7.5	1	0.45	0.012*
CIP	24	60	16	7.21	< 0.001*
LVX	29	72.50	37	16.67	< 0.001*
COL	5	12.50	1	0.45	< 0.001*

1 TCC – ticarcillin/clavulanic acid, TZP – piperacillin/tazobactam, MEM – meropenem, IMP – imipenem, FEP – cefepime, CSL – cefoperazone/sulbactam, CAZ – ceftazidime, ATM – aztreonam, TOB – tobramycin, AMK – amikacin, CIP – ciprofloxacin, LVX – levofloxacin, COL – colistin

1* – p < 0.05

Schematic structures of the different class 1 integrons. Solid black arrows represent variable region promoters; ovals represent *attC* sites of gene cassettes; hollow arrows represent *intI1* gene, insertion sequence and resistant genes.

Table III

Mutations of porin OprD in 40 carbapenem-resistant Pseudomonas aeruginosa isolates.

Isolate		Amino acid changes in OprD sequence^a	Indels/gain of stop codon^a
RPA22	ST207	S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347M	insertion of 30bp at nt1114
RPA34	ST1632	D43N, S57E, S59R, E202Q	deletion of 1bp at nt630
RPA35, RPA42	ST207	S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A	premature codon stops at AA277
RPA48	ST277	T103S, K115T, F170L	insertion of 7bp at nt557
RPA59, RPA130, RPA139	ST277	T103S, K115T	deletion of 1bp at nt354
RPA53, RPA58, RPA90, RPA154, RPA174, RPA204, RPA227, RPA233, RPA237, RPA253	ST270	V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T	insertion of 2bp at nt729
RPA67	ST245	T103S, K115T	deletion of 32bp at nt426
RPA101, RPA239	ST3874	D43N, S57E, S59R	insertion of 1bp at nt174
RPA123	ST234	V127L, E185R	deletion of 1bp at nt558
RPA125	ST871	T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315G	insertion of 1bp at nt1206
RPA140	ST357	S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, 276A, A281G, K296Q, Q301E, R310E, A315G, L347M	insertion of 30bp at nt1114
RPA143	ST871	None	premature codon stops at AA6
RPA150	ST1021	T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315G	insertion of 55bp at 1089nt
RPA161	ST773	T103S, K115T, V129I	deletion of 1bp at nt460
RPA153	ST235	None	deletion of 11bp at nt55
RPA167, RPA208, RPA209, RPA211, RPA251	ST235	T103S, K115T, F170L, E185Q, P186G, V189T	premature codon stops at AA277
RPA182	ST773	T103S, K115T, V129I	deletion of 10bp at nt463
RPA186	ST242	D43N, S57E, S59R	insertion of 2bp at nt383
RPA224	ST313	S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347M	insertion of 30bp at nt1114
RPA225	ST4	D43N, S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S	insertion of 1bp at nt821
RPA247	ST316	S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347M	insertion of 30bp at nt1114
RPA232	ST676	D43N, S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359L,	insertion of 30bp at nt1114
RPA256	T1182	S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347M	insertion of 30bp at nt1114

1a – In all isolations collected in this study, mutations particularly present in carbapenem-resistant P. aeruginosa compared to carbapenem-sensitive P. aeruginosa are indicated in bold and underlined.

Table IV

Mutations of porin OprD in 15 carbapenem-sensitive Pseudomonas aeruginosa isolates.

Isolate	MLST	Amino acid changes in OprD sequence	Indels/gain of stop codon
CSPA31	ST244	None	insertion of 1 bp at nt1206
CSPA261	ST244	None	None
CSPA33, CSPA56, CSPA142, CSPA200, CSPA221, CSPA254, CSPA259	ST491, ST2060, ST992, ST849, ST3360, ST796, ST16	S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359L	Insertion of 30bp at nt1114
CSPA84	ST849	S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G	Insertion of 81bp at nt1019
CSPA159	ST871	T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315G, G425A	None
CSPA170	ST1337	None	None
CSPA218, CSPA223	ST277, ST261	T103S, K115T, F170L	None
CSPA252	ST4931	S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359L	Insertion of 30bp at nt1114

Table V

Resistance rates of mexB overexpressed CRPAs and none-overexpressed mexB CRPAs.

Antibiotics	Overexpression of mexB (n = 5)		None-overexpression of mexB (n = 35)		^p
Antibiotics	Number	Rate (%)	Number	Rate (%)	^p
Penicillin/β-lactamase inhibitor combinations	5	100	25	71.43	0.306
Meropenem	5	100	24	68.57	0.298
Cephalosporins	3	60.00	23	65.71	1.000
Monocyclic β-lactams	4	80.00	7	20.00	0.015*
Aminoglycosides	0	0	15	42.86	0.137
Fluoroquinolones	5	100	25	71.43	0.306

1* – p < 0.05

Table VI

Resistance rates of mexY overexpressed CRPAs and none-overexpressed mexY CRPAs.

Antibiotics	Overexpression of mexY (n = 23)		None-overexpression of mexY (n = 17)		p
Antibiotics	Number	Rate (%)	Number	Rate (%)	p
Penicillin/β-lactamase inhibitor combinations	21	91.30	10	58.82	0.006*
Meropenem	21	91.30	8	47.06	0.001*
Cephalosporins	21	91.30	5	29.41	< 0.001*
Monocyclic β-lactams	6	26.09	5	29.41	1.000
Aminoglycosides	13	56.52	2	11.76	0.002*
Fluoroquinolones	21	91.30	8	47.06	0.001*

1* – p < 0.05

Diagram of biofilm production capacity of CRPAs. Cutoff value (ODc) was calculated based on the negative control. ODc = average OD of negative control + (3 × SD of negative control). None: OD < ODc; Weak: ODc < OD < 2 × ODc; Moderate: 2 × ODc < OD < 4 × ODc; Strong: OD ≥ 4 × ODc.

Articles in this issue

DOI: https://doi.org/10.33073/pjm-2025-022 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331

Journal RSS Feed

Language: English

Page range: 275 - 288

Submitted on: Jan 3, 2025

Accepted on: May 29, 2025

Published on: Sep 1, 2025

Published by: Polish Society of Microbiologists

In partnership with: Paradigm Publishing Services

Publication frequency: 4 issues per year

Keywords:

Pseudomonas aeruginosa,

carbapenem,

efflux pump,

integron,

whole-genome sequencing (WGS)

Related subjects:

Life sciences,

Microbiology and virology

© 2025 KEYING ZHU, SUTING LI, ZIYAN GUO, CHENGCHAO XIAO, QUHAO WEI, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Volume 74 (2025): Issue 3 (September 2025)

Antimicrobial Resistance Mechanisms in Carbapenem-Resistant Pseudomonas aeruginosa Clinical Strains Isolated in Shanghai, China

Figures & Tables

Table I

Fig. 1.

Table II

Fig. 2.

Table III

Table IV

Table V

Table VI

Fig. 3.

Paradigm

My account