Skip to main content
Have a personal or library account? Click to login
Antimicrobial Resistance Mechanisms in Carbapenem-Resistant Pseudomonas aeruginosa Clinical Strains Isolated in Shanghai, China Cover

Antimicrobial Resistance Mechanisms in Carbapenem-Resistant Pseudomonas aeruginosa Clinical Strains Isolated in Shanghai, China

Open Access
|Sep 2025

Figures & Tables

Fig. 1.

Distribution of sequence types and antimicrobial resistance genes. In the phylogenetic tree, each branch is labeled with numerical values representing its length, which directly reflects the genetic distance. The 40 CRPAs can be divided into two major evolutionary branches in the upper and lower parts. Heat map of the antimicrobial resistance genes of 40 CRPAs showed the prevalence of resistance genes in different isolates, green represent the presence of the resistance gene, and blue represent its absense.

Fig. 2.

Schematic structures of the different class 1 integrons. Solid black arrows represent variable region promoters; ovals represent attC sites of gene cassettes; hollow arrows represent intI1 gene, insertion sequence and resistant genes.

Fig. 3.

Diagram of biofilm production capacity of CRPAs. Cutoff value (ODc) was calculated based on the negative control. ODc = average OD of negative control + (3 × SD of negative control). None: OD < ODc; Weak: ODc < OD < 2 × ODc; Moderate: 2 × ODc < OD < 4 × ODc; Strong: OD ≥ 4 × ODc.

Resistance rates of CRPA and C SPA isolates to commonly used antibiotics_

AntibioticsCRPA (n = 40)CSPA (n = 222)p
No.Rate (%)No.Rate (%)
TCC2972.503716.67< 0.001*
TZP2870.003314.86< 0.001*
MEM2972.5000.00< 0.001*
IMP40100.0000.00< 0.001*
FEP1025.0041.80< 0.001*
CSL2562.50209.01< 0.001*
CAZ1127.50167.21< 0.001*
ATM1127.52410.810.004*
TOB1435.0052.25< 0.001*
AMK37.510.450.012*
CIP2460167.21< 0.001*
LVX2972.503716.67< 0.001*
COL512.5010.45< 0.001*

Mutations of porin OprD in 15 carbapenem-sensitive Pseudomonas aeruginosa isolates_

IsolateMLSTAmino acid changes in OprD sequenceIndels/gain of stop codon
CSPA31ST244Noneinsertion of 1 bp at nt1206
CSPA261ST244NoneNone
CSPA33, CSPA56, CSPA142, CSPA200, CSPA221, CSPA254, CSPA259ST491, ST2060, ST992, ST849, ST3360, ST796, ST16S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359LInsertion of 30bp at nt1114
CSPA84ST849S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310GInsertion of 81bp at nt1019
CSPA159ST871T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315G, G425ANone
CSPA170ST1337NoneNone
CSPA218, CSPA223ST277, ST261T103S, K115T, F170LNone
CSPA252ST4931S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359LInsertion of 30bp at nt1114

Mutations of porin OprD in 40 carbapenem-resistant Pseudomonas aeruginosa isolates_

Isolate Amino acid changes in OprD sequenceaIndels/gain of stop codona
RPA22ST207S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347Minsertion of 30bp at nt1114
RPA34ST1632D43N, S57E, S59R, E202Qdeletion of 1bp at nt630
RPA35, RPA42ST207S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276Apremature codon stops at AA277
RPA48ST277T103S, K115T, F170Linsertion of 7bp at nt557
RPA59, RPA130, RPA139ST277T103S, K115Tdeletion of 1bp at nt354
RPA53, RPA58, RPA90, RPA154, RPA174, RPA204, RPA227, RPA233, RPA237, RPA253ST270V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240Tinsertion of 2bp at nt729
RPA67ST245T103S, K115Tdeletion of 32bp at nt426
RPA101, RPA239ST3874D43N, S57E, S59Rinsertion of 1bp at nt174
RPA123ST234V127L, E185Rdeletion of 1bp at nt558
RPA125ST871T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315Ginsertion of 1bp at nt1206
RPA140ST357S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, 276A, A281G, K296Q, Q301E, R310E, A315G, L347Minsertion of 30bp at nt1114
RPA143ST871Nonepremature codon stops at AA6
RPA150ST1021T103S, K115T, F170L, E185Q, P186G, V189T, R310E, A315Ginsertion of 55bp at 1089nt
RPA161ST773T103S, K115T, V129Ideletion of 1bp at nt460
RPA153ST235Nonedeletion of 11bp at nt55
RPA167, RPA208, RPA209, RPA211, RPA251ST235T103S, K115T, F170L, E185Q, P186G, V189Tpremature codon stops at AA277
RPA182ST773T103S, K115T, V129Ideletion of 10bp at nt463
RPA186ST242D43N, S57E, S59Rinsertion of 2bp at nt383
RPA224ST313S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347Minsertion of 30bp at nt1114
RPA225ST4D43N, S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267Sinsertion of 1bp at nt821
RPA247ST316S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347Minsertion of 30bp at nt1114
RPA232ST676D43N, S57E, S59R, E202Q, I210A, E230K, S240T, N262T, A267S, A281G, K296Q, Q301E, R310G, V359L,insertion of 30bp at nt1114
RPA256T1182S57E, S59R, V127L, E185Q, P186G, V189T, E202Q, I210A, E230K, S240T, N262T, T276A, A281G, K296Q, Q301E, R310E, A315G, L347Minsertion of 30bp at nt1114

Resistance rates of mexY overexpressed CRPAs and none-overexpressed mexY CRPAs_

AntibioticsOverexpression of mexY (n = 23)None-overexpression of mexY (n = 17)p
NumberRate (%)NumberRate (%)
Penicillin/β-lactamase inhibitor combinations2191.301058.820.006*
Meropenem2191.30847.060.001*
Cephalosporins2191.30529.41< 0.001*
Monocyclic β-lactams626.09529.411.000
Aminoglycosides1356.52211.760.002*
Fluoroquinolones2191.30847.060.001*

Primers used for reverse transcription-quantitative PCR_

Target genePrimersSequence (5′ to 3′)
mexBmexB-FCAACATCCAGGACCCACTCT
mexB-RAGGAAATCTGCACGTTCTGC
mexDmexD-FCTACCCTGGTGAAACAGC
mexD-RAGCAGGTACATCACCATCA
mexFmexF-FTGTACGCGAACGACTTCAAC
mexF-RGAGGTGTCGCTGACCTTGAT
mexYmexY-FTCAGGCCGACCTTGAAGTAG
mexY-RTCTCGGTGTTGATCGTGTTC
rpsLrpsL-FTACTTCGAACGACCCTGCTT
rpsL-RTTTCCTCGTACATCGGTGGT

Resistance rates of mexB overexpressed CRPAs and none-overexpressed mexB CRPAs_

AntibioticsOverexpression of mexB (n = 5)None-overexpression of mexB (n = 35)p
NumberRate (%)NumberRate (%)
Penicillin/β-lactamase inhibitor combinations51002571.430.306
Meropenem51002468.570.298
Cephalosporins360.002365.711.000
Monocyclic β-lactams480.00720.000.015*
Aminoglycosides001542.860.137
Fluoroquinolones51002571.430.306
DOI: https://doi.org/10.33073/pjm-2025-022 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 275 - 288
Submitted on: Jan 3, 2025
Accepted on: May 29, 2025
Published on: Sep 1, 2025
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2025 KEYING ZHU, SUTING LI, ZIYAN GUO, CHENGCHAO XIAO, QUHAO WEI, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.