Introduction
Acinetobacter species are known as the primary causes of many severe infections and illnesses in recent years (Migliaccio et al. 2023). Acinetobacter baumannii has a high capacity for survival and causes outbreaks and long-lasting epidemics in hospitals. The difficulty with clinical treating these infections is increased by the growing number of strains resistant to many drugs because of their pan-drug and all-drug resistance (Lee et al. 2017). Human health is at risk because A. baumannii strains resistant to carbapenem are wide-spread (Harding et al. 2018). A. baumannii can build biofilms on non-living and biologic surfaces (Greene et al. 2016). Biofilm formation can promote the emergence of new and more antimicrobial-resistant phenotypes (Khoshnood et al. 2023). In a multicenter cohort study, all catheter-related urinary or bloodstream infections due to A. baumannii were caused by biofilm-forming strains, highlighting the unique role that bio-film formation plays in the development of infections related to medical devices (Rodríguez-Baño et al. 2008). A. baumannii cells in biofilms have the ability to go dormant and become metabolically inactive in unfavorable environmental conditions, allowing them to withstand environmental stress (Greene et al. 2016). Therefore, forming biofilms makes it easier for A. baumannii to adhere to medical implants and biological surfaces, facilitating colonization and infection. In addition, integrons also play a crucial role in the spread of bacterial drug resistance. Site-specific recombination allows integrons to express and capture external drug-resistance gene cassettes, a vital process in developing and disseminating drug resistance in bacteria. By identifying the presence of integrons and drug-resistance gene cassettes in multi-drug resistant strains, we can comprehend the associated drug-resistance mechanisms and their patterns of spread, as well as offer recommendations for clinical anti-infection treatments and nosocomial infection prevention (Gillings 2014). Understanding carbapenem-resistant A. baumannii (CRAB), including its epidemiology, distribution of integron, virulence factors, and carbapenem resistance mechanisms, is essential to preventing the continuing development of resistance to antibiotics in this species. Therefore, the primary purpose of this study was to identify the distribution of biofilm-formation-related virulence genes and integrons in CRAB isolates and their relationship with drug resistance.
Experimental
Materials and Methods
Bacterial isolates and susceptibility testing
Two hundred and sixty-nine non-repetitive clinical A. baumannii isolates, including 219 CRAB and 50 carbapenem-sensitive A. baumannii (CSAB), were collected at Anhui University of Science and Technology Affiliated Fengxian Hospital, Shanghai, from January 2022 to December 2022. MALDI-TOF Mass Spectrometry Microflex® LT/SH (Bruker Daltonics GmbH & Co., Germany) was used to identify each isolate. The VITEK® 2 Compact Automatic Microbial Analyzer (bioMérieux, France) and VITEK® 2 AST-N335 were used to test antibiotic susceptibilities (including imipenem, meropenem, ticacillin/clavulanate, ceftazidime, ciprofloxacin, tobramycin, doxycycline, trimethoprim/ sulfamethoxazole, levofloxacin, amikacin, cefepime, minocycline, tigecycline, and colistin). The susceptibility data were interpreted in accordance with the 2021 standards of the Clinical and Laboratory Standard Institute (CLSI) (CLSI 2021). Escherichia coli ATCC® 25922™ and Pseudomonas aeruginosa ATCC® 27853™ were used as quality control strains. Proteus mirabilis 47437 (positive control in screening for class 1 integron integrase gene) and E. coli DH5α were preserved in our laboratory (Wei et al. 2014).
Detection of carbapenemase and biofilm formation genes
Following the supplier’s instructions, total genomic DNA was isolated using the Ezup Column Bacterial Genomic DNA Extraction Kit (Sangon Biotech (Shanghai) Co., Ltd., China). Common carbapenemase genes, including blaKPC, blaVIM, blaIMP, blaNDM, and blaOXA-23-like, and biofilm formation genes abal, bfms, bap, and cusE were screened with PCR. Primers used in this study were listed in Table I, and PCR conditions were the same as those described in corresponding references.
Table I
Primers used in this study.
| Primer | Primer sequence (5’–3’) | Target gene | References |
|---|---|---|---|
| intF | CCAAGCTCTCGGGTAACATC | intI1 | Wang et al. 2023 |
| P2R | CCCGAGGCATAGACTGTA | ||
| 5CS | GGCATCCAAGCAGCAAG | variable region | Wang et al. 2023 |
| 3CS | AAGCAGACTTGACCTGA | ||
| AACF | ATCTCATATCGTCGAGTGG | aac(6’)-Ib | Wang et al. 2023 |
| AACR | TGCGTGTTCGCTCGAATGC | ||
| AADAF | GCAGCGCAATGACATTCTTG | aadA1 | Wang et al. 2023 |
| AADAR | ATCCTTCGGCGCGATTTTG | ||
| CATF | TTACTCTGGCTACTATCAC | catB8 | Wang et al. 2023 |
| CATR | TGATGGCATAAGGCTCTAC | ||
| KPC-F | CGTCTAGTTCTGCTGTCTTG | blaKPC | Wang et al. 2023 |
| KPC-R | CTTGTCATCCTTGTTAGGCG | ||
| VIM-F | GATGGTGTTTGGTCGCATA | blaVIM | Wang et al.2023 |
| VIM-R | CGAATGCGCAGCACCAG | ||
| NDM-F | GGTTTGGCGATCTGGTTTTC | blaNDM | Wang et al. 2023 |
| NDM-R | CGGAATGGCTCATCACGATC | ||
| OXA-23-like-F | CCGTCGTTTACGACATTCA | blaOXA-23-like | Wang et al.2023 |
| OXA-23-like-R | AAAGAGCGCATTGCTTTGAT | ||
| IMP-F | GGAATAGAGTGGCTTAAYTCTC | blaIMP | Wang et al.2023 |
| IMP-R | GGTTTAAYAAAACAACCACC | ||
| bfmS-F | ATATATGCGGGGCTGGTAATTC | bfms | Cai et al. 2017 |
| bfmS-R | ATGCAGGTGCTTTTTTATTGGT | ||
| cusE-F | ATGCATGTTCTCTGGACTGATGTTGAC | cusE | Cai et al. 2017 |
| cusE-R | CGACTTGTACCGTGACCGTATCTTGATAAG | ||
| bap-F | CGTTTCCTGGGTCTGATGTATT | bap | Cai et al. 2017 |
| bap-R | GTTATTGAAGGCTTCTTTAGTG | ||
| abal-F | GTGGCTCAAGACAGAGAATC | abal | Wang and Ye 2021 |
| abal-R | TCAATCATCATTGGTGGACC | This study |
Detection of class 1 integrons
Primers intF and P2R (Table I) were used in PCR screening for the class 1 integron integrase gene (intI1). Each round included a blank control (distilled water), a negative control (E. coli DH5α), and a positive control (P. mirabilis 47437).
Identification of the variable regions of class 1 integrons
Using TaKaRa LA Taq® DNA Polymerase (Takara Bio Inc., Japan) and primers intF or 5CS and 3CS (Table I), variable regions of class 1 integrons in intI1-positive isolates were amplified. Same-sized amplicons were compared by restriction analysis with Hinf I (Takara Bio Inc., Japan). Primer walking was used to sequence at least one representative of each type of amplicon, starting with the primers intF, 3CS, and 5CS. Sequence comparisons were carried out using BLAST programs (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Gene cassette arrays in variable regions, and common promoters Pc and P2, were identified as previously described (Wei et al. 2013).
Whole-genome sequencing of the selected isolate
The whole-genome sequencing of the blaOXA-23-like-negative isolate CRAB-134 was conducted by Novogene Bioinformatics Technology Co., Ltd. (China). A total of 0.2 μg DNA per sample was used as input material for the DNA library preparations. Briefly, each genomic DNA sample was fragmented by sonication to a size of about 350 bp. After that, DNA fragments were amplified by PCR once more after being end-polished, A-tailed, and ligated with the full-length adaptor for Illumina® sequencing. Following PCR product purification using the AMPure® XP system (Beckman Coulter, Inc., USA), library quality was assessed on the Agilent 5400 system (Agilent Technologies, Inc., USA) and quantified by qPCR (1.5 nM). The qualified libraries were sequenced on Illumina® platforms with the NovaSeq™ 6000 sequencer (Illumina, Inc., USA) by Novogene Co., Ltd. (UK), according to effective library concentration and data amount required. De novo assembly was completed using the Unicycler v0.5.0 (https://github.com/rrwick/Unicycler) assembler (Wick et al. 2017). Sequence analysis was performed using several bioinformatics tools. The isolate AB-134 was reconfirmed via in silico methods using SpeciesFinder v2.0 (https://cge.cbs.dtu.dk/services/SpeciesFinder) in the Center for Genomic Epidemiology (CGE) (Larsen et al. 2014). Drug resistance genes were screened using ResFinder v4.4.2 (https://cge.cbs.dtu.dk/services/ResFinder) with default software settings (thresholds for ID% were 90%, minimum length of 60%). The flanking sequences of blaADC-259 were analyzed using BLAST programs (http://www.ncbi.nlm.nih.gov/gorf/gorf.html).
Multilocus sequence typing (MLST)
The whole genome of the isolate was submitted to PubMLST (http://pubmlst.org/abaumannii), and the housekeeping genes gltA, gyrB, gdhB, recA, cpn60, gpi, rpo, and cpn60, fusA, gltA, pyrG, recA, rplB, and rpoB of A. baumannii were matched and compared via two schemes (Oxford and Pasteur, respectively) to obtain the sequence type (ST) of the isolate.
Statistical analysis
SPSS statistical software 26.0 (IBM, Armonk, NY, USA) was used for statistical analysis. Student’s test and Fisher’s exact tests were carried out for data analysis. p< 0.05 in all experiments was considered statistically significant.
Results
Clinical distribution and drug resistance of CRAB and CSAB isolates
Two hundred and nineteen isolates of CRAB were mainly collected from the ICU (Intensive Care Unit, 72/219), NICU (Neurosurgery Intensive Care Unit, 54/219), and EICU (Emergency Intensive Care Unit, 50/219). A total of 176 (80.37%) CRAB isolates were collected from these three wards. While only 44.00% (22/50) of CSAB isolates were from ICU (8/50), EICU (8/50), and NICU (6/50) (Fig. 1). Both CRAB and CSAB were mainly isolated from sputum or throat swabs (CRAB 86.76%, CSAB 88.00%) (Fig. 2).

Fig. 1.
Clinical ward distribution of CRAB and CSAB isolates.

Fig. 2.
Clinical specimen type distribution of CRAB and CSAB isolates.
In addition to resistance to the carbapenem antibiotics imipenem and meropenem, 219 isolates of CRAB also had a drug resistance rate of 100% to ticacillin/ clavulanate. The drug resistance rates to ceftazidime (99.54%), ciprofloxacin (99.09%), doxycycline (98.63%), and tobramycin (94.06%) were over 90%. CRAB isolates resistant to tigacycline (5.02%) and colistin (1.37%) also appeared in this study. The resistance rates of 50 CSAB isolates to these commonly used antibiotics were only 10% to 16%, and the resistance rate to minocycline was 4%. All these CSAB isolates were sensitive to tigacycline and colistin (Table II).
Table II
Resistance rates of CRAB and CSAB isolates to commonly used antibiotics.
| Antibiotics | CRAB (n = 219) | CSAB (n = 50) | p | ||
|---|---|---|---|---|---|
| No. | Rate (%) | No. | Rate (%) | ||
| CAZ | 218 | 99.54 | 6 | 12.00 | 0.000* |
| CIP | 217 | 99.09 | 6 | 12.00 | 0.000* |
| TOB | 206 | 94.06 | 6 | 12.00 | 0.000* |
| DOX | 216 | 98.63 | 6 | 12.00 | 0.000* |
| SXT | 166 | 75.80 | 8 | 16.00 | 0.000* |
| LVX | 175 | 79.91 | 5 | 10.00 | 0.000* |
| AMK | 131 | 59.82 | 6 | 12.00 | 1.000 |
| FEP | 169 | 77.17 | 6 | 12.00 | 0.384 |
| MNO | 78 | 35.62 | 2 | 4.00 | 0.000* |
| TGC | 11 | 5.02 | 0 | 0.00 | 0.226 |
| COL | 3 | 1.37 | 0 | 0.00 | 1.000 |
1 CAZ – ceftazidime, CIP – ciprofloxacin, TOB – tobramycin, DOX – doxycycline, SXT – trimethoprim/sulfamethoxazole, LVX – levofloxacin, AMK – amikacin, FEP – cefepime, MNO minocycline, TGC – tigecycline, COL – colistin, CRAB – carbapenem-resistant Acinetobacter baumannii, CSAB – carbapenem-sensitive A. baumannii
n – the number of strains in the group
Presence of carbapenem resistance and biofilm formation genes
The abal, bfms, bap, and cusE detection rates were 93.15%, 63.93%, 88.13%, and 77.63%, respectively, in the 219 CRAB isolates. The blaOXA-23-like gene was detected in 218 of 219 CRAB isolates (99.54%). All the 219 CRAB isolates were negative for blaKPC, blaVIM, blaIMP, and blaNDM. No carbapenem resistance genes were detected in 50 CSAB isolates, and the detection rates of abal, bfms, bap, and cusE were 38%, 62%, 10%, and 48%, respectively. Among them, the rates of abal-, bap-, cusE-, and blaOXA-23-like-positivity in CRAB were higher than those in CSAB, with statistical differences (p < 0.05) (Table III).
Table III
Virulence- and resistance-gene-carrying status of CRAB and CSAB.
| Genes | CRAB (n = 219) | CSAB (n = 50) | p |
|---|---|---|---|
| abal + | 204 | 19 | 0* |
| – | 15 | 31 | |
| bfmS + | 140 | 31 | 0.798 |
| – | 79 | 19 | |
| bap + | 193 | 5 | 0* |
| – | 26 | 45 | |
| cusE + | 170 | 24 | 0* |
| – | 49 | 26 | |
| blaOXA-23-like + | 218 | 0 | 0* |
| – | 1 | 50 |
In CRAB, the drug resistance rate of bfmS-negative isolates to trimethoprim/sulfamethoxazole was higher than that of bfmS-positive isolates (p < 0.05). In contrast, the drug resistance rates of cusE-positive isolates to levofloxacin and cefepime were higher than those of negative isolates (p < 0.05) (Table IV). The resistance rates of bap-positive isolates to tobramycin were higher than those of bap-negative isolates (p < 0.05) (Table IV).
Table IV
Correlations between virulence genes and antibiotic resistance in 219 CRAB isolates.
| Antibiotics | abal | bfmS | cusE | bap | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| + (n = 204) | – (n = 15) | p | + (n = 140) | – (n = 79) | p | + (n = 170) | – (n = 49) | p | + (n = 193) | – (n = 26) | p | |
| MNO | 72 | 6 | 0.782 | 47 | 31 | 0.4 | 59 | 19 | 0.6 | 68 | 10 | 0.747 |
| DOX | 201 | 15 | 1 | 139 | 77 | 0.296 | 168 | 48 | 0.534 | 191 | 25 | 0.317 |
| SXT | 154 | 12 | 1 | 98 | 68 | 0.008* | 124 | 42 | 0.066 | 145 | 21 | 0.528 |
| CIP | 202 | 15 | 1 | 139 | 78 | 1 | 168 | 49 | 1 | 192 | 25 | 0.224 |
| LVX | 163 | 12 | 1 | 109 | 66 | 0.313 | 141 | 34 | 0.037* | 152 | 23 | 0.246 |
| TOB | 191 | 15 | 0.607 | 129 | 77 | 0.142 | 161 | 45 | 0.494 | 185 | 21 | 0.011* |
| AMK | 125 | 6 | 0.105 | 79 | 52 | 0.173 | 96 | 35 | 0.06 | 119 | 12 | 0.13 |
| TGC | 11 | 0 | 1 | 9 | 2 | 0.335 | 9 | 2 | 1 | 11 | 0 | 0.369 |
| CAZ | 203 | 15 | 1 | 139 | 79 | 1 | 169 | 49 | 1 | 192 | 26 | 1 |
| FEP | 156 | 13 | 0.74 | 112 | 57 | 0.184 | 141 | 28 | 0* | 148 | 21 | 0.641 |
| COL | 3 | 0 | 1 | 2 | 1 | 1 | 2 | 1 | 0.534 | 2 | 1 | 0.317 |
1 CAZ – ceftazidime, CIP – ciprofloxacin, TOB – tobramycin, DOX – doxycycline, SXT – trimethoprim/sulfamethoxazole, LVX – levofloxacin, AMK – amikacin, FEP – cefepime, MNO minocycline, TGC – tigecycline, COL – colistin, CRAB – carbapenem-resistant Acinetobacter baumannii
n – the number of strains in the group
Integron and variable region analysis
There were 75 intI1-positive isolates among the 219 CRAB isolates, while only three intI1-positive isolates were detected among the 50 CSAB isolates. Seventy-five variable regions were successfully amplified from 78 intI1-positive isolates, while we failed to amplify the variable region in 3 intI1-positive CRAB isolates. All amplified fragments of the variable region had the same restriction enzyme digestion pattern. The gene cassette array of the variable region was aacA4-catB8-aadA1, which had more than 99% homology to the sequences of fragment corresponding to GenBank accession number CP050904. This gene cassette array can confer resistance to chloramphenicol and aminoglycoside. The Pc promoters of variable regions were all relatively strong (PcH2).
Correlation between class 1 integron and antibiotic resistant rates in CRAB
The resistance rates of the 219 CRAB isolates to commonly used antibiotic agents are shown in Table V. Compared with the intI1-negative CRAB isolates, the intI1-positive CRAB isolates had significantly increased tobramycin-, trimethoprim/sulfamethoxazole-, amikacin-, and minocycline-resistant rates; however, the resistance rate of the intI1-positive isolates to cefepime was lower than that of the intI1-negative isolates, and the difference was statistically significant (p < 0.05), as shown in Table V. As to the correlation between class 1 integron and biofilm formation genes, the positive rates of intI1-positive CRAB isolates for abal (100%) and bap (96%) were significantly higher than those of intI1-negative CRAB isolates (p < 0.05) (Table VI).
Table V
Correlation between class 1 integron and antibiotic resistant rates in 219 CRAB isolates.
| Antibiotics | intI1(+) (n = 75) | intI1(−) (n = 144) | p | ||
|---|---|---|---|---|---|
| No. | Rate (%) | No. | Rate (%) | ||
| CAZ | 75 | 100 | 143 | 99.31 | 1.000 |
| CIP | 75 | 100 | 142 | 98.61 | 0.548 |
| TOB | 75 | 100 | 132 | 91.67 | 0.009* |
| DOX | 74 | 98.67 | 142 | 98.61 | 1.000 |
| SXT | 73 | 97.33 | 93 | 64.58 | 0.000* |
| LVX | 62 | 82.67 | 113 | 78.47 | 0.462 |
| AMK | 58 | 77.33 | 78 | 54.17 | 0.001* |
| FEP | 44 | 58.67 | 125 | 86.81 | 0.000* |
| MNO | 36 | 48 | 42 | 29.17 | 0.006* |
| TGC | 1 | 1.33 | 10 | 6.94 | 0.103 |
| COL | 1 | 1.33 | 2 | 1.39 | 1.000 |
1 CAZ – ceftazidime, CIP – ciprofloxacin, TOB – tobramycin, DOX – doxycycline, SXT – trimethoprim/sulfamethoxazole, LVX – levofloxacin, AMK – amikacin, FEP – cefepime, MNO minocycline, TGC – tigecycline, COL – colistin CRAB – carbapenem-resistant Acinetobacter baumannii
n – the number of strains in the group
Analysis of whole-genome sequencing of AB-134
The isolate AB-134 was reconfirmed by in silico methods using SpeciesFinder v2.0 in CGE. The drug-resistance genes blaOXA-72, blaOXA-259, and blaADC-26 were also found in this isolate through ResFinder v4.4.2. In the MLST, we searched for the ST of AB-134 in the public database of PubMLST, and the results showed unknown sequence types. The data were uploaded to PubMLST and new STs ST3272 (Oxford) and ST2520 (Pasteur) were obtained. The types of different house-keeping genes of AB-134 are shown in Table VII. The whole-genome sequence of AB-134 was submitted to GenBank with accession No. JAZGUW000000000. Using BLAST programs, the flanking sequences (5 kbp upstream and 5 kbp downstream) of blaOXA-259 were found to be the same as those flanking blaOXA-98 in A. baumannii ATCC19606 (GenBank accession No. AP025740), with the FxsA family protein coding gene and GNAT family N-acetyltransferase coding gene flanking blaOXA-259. The blaOXA-72-containing assembly contig was very short and did not have any meaningful information, and no further analysis was conducted on the flanking sequences of blaOXA-72.
Discussion
CRAB is a significant cause of nosocomial infections that are associated with high mortality rates. It is commonly spread in ICUs (Chukamnerd et al. 2022). This is consistent with the report in this study. CRAB was mostly isolated from intensive care wards, while CSAB was widely distributed in different wards. The reason for this may be that most patients in intensive care wards have primary diseases, severe diseases with many complications, long hospitalization times, long-term indwelling catheters, and have been subjected to invasive operations for examination or treatment. In addition, the long-term use of broad-spectrum antibiotics increases the chance of infection. Sputum or throat swabs were the primary sources of the isolates, which is consistent with previous reports in our hospital (Xiao et al. 2019). It may be because A. baumannii is mainly related to respiratory infections, especially ventilator-associated pneumonia (Huang et al. 2019).
The mechanisms of drug resistance in A. baumannii include β-lactamases, aminoglycoside-modifying enzymes, permeability defects, the alteration and replacement of antibiotic target sites, enzymatic inactivation, and multidrug efflux pumps (Ibrahim et al. 2021). In this study, the resistance rates of 219 CRAB isolates to levofloxacin, cefepime, trimethoprim/sulfamethoxazole, amikacin, and minocycline were 79.91%, 77.17%, 75.80%, 59.82%, and 35.62%, respectively, while the resistance rates to other commonly used antibiotics were over 90%. Some isolates were resistant to tigecycline (5.02%) and colistin (1.37%). However, 50 CSAB isolates were sensitive to tigecycline and colistin, and the resistance rates to other commonly used antibiotics were only between 4% and 16%, indicating that the CRAB isolated in our hospital had severe drug resistance.
Bacteria can also spread drug-resistance genes between different isolates through horizontal gene transfer, spreading bacterial resistance. This gene transfer occurs through gene-moving elements such as plasmids or transposons. A large-scale survey in Colombia (Villegas et al. 2007) found that 33.6% of A. baumannii was resistant to carbapenems, and 98.5% of resistant isolates carried the blaOXA-23 group. IMP and VIM enzymes have specific detection rates in the Far East and Europe and are related to the carbapenem resistance of A. baumannii (El-Ageery and Al-Hazmi 2014; Ibrahim 2019; Nikibakhsh et al. 2021). In 2013, 13 (38.2%) of 34 CRAB isolates from a hospital in Huaibei (a city in Anhui province, China) produced the KPC-2 carbapenem enzyme (Zhang et al. 2015). The detection rate for blaNDM-1 in CRAB from Algeria was 10.6% (Khorsi et al. 2015). It is worth noting that blaIMP, blaVIM, blaKPC, and blaNDM were not detected in this study. Most of the 219 CRAB isolates in this study carried blaOXA-23-like (99.54%), which is consistent with previous reports, and carbapenem-resistant A. baumannii in our country mainly carry blaOXA-23-like (Xiao et al. 2019).
In this study, whole-genome sequencing analysis of a blaOXA-23-like-negative isolate indicated that this isolate carried blaOXA-72, blaOXA-259, and blaADC-26 at the same time, which could confer β-lactam resistance. blaOXA-72 is one of the most important allelic variants of blaOXA-24/40-like (Lasarte-Monterrubio et al. 2022). However, blaOXA-259 is a member of the blaOXA-51 family and has only been reported in one hospital in Hangzhou, China (Jia et al. 2019). Acinetobacter-derived cephalosporinases (ADC) are cephalosporinases produced by Acinetobacter; blaADC-26 is a variant of ADC and was first discovered in France (Rodríguez-Martínez et al. 2010). In this study, the resistance phenotype of AB-134 provided resistance not only to carbapenems but also to ceftazidime, and the detection of blaADC-26 indicated that this gene might mediate ceftazidime resistance. In addition, MLST typing of this isolate resulted in the discovery of new STs, ST3272 (Oxford) and ST2526 (Pasteur).
One of the most important virulence factors of A. baumannii is its formation of biofilms, which facilitate the bacterial adherence to medical equipment and colonization of the surface of human skin for long-term survival (Dolma et al. 2022). Studies have confirmed that abal, cusE, bap, and bfmS genes are all related to the formation of biofilms. CsuE is a key gene for the fimbriae synthesis in A. baumannii (Pakharukova et al. 2018). The expression of fimbrial synthesis genes is regulated by the bfmRS two-component regulatory system (Roy et al. 2022). In addition, the quorum sensing system also governs the formation of bacterial biofilms, and the quorum sensing signaling-molecule-encoding gene abal plays a role in forming bacterial biofilms on abiotic surfaces (Sun et al. 2021). Studies have shown that mutations of the bap gene mainly affect the volume and thickness of the biofilms formed by A. baumannii (Azizi et al. 2016). In this study, the detection rates of the virulence genes abal, bap, and cusE in CRAB were higher than those of CSAB, with a statistical difference (p < 0.05). In CRAB, the resistance rates of cusE-positive isolates to levofloxacin and cefepime were higher than those of cusE-negative CRAB isolates (p < 0.05). The resistance rates of bap-positive isolates to tobramycin were higher than those of bap-negative isolates (p < 0.05). When bacteria exist in the form of a biofilm, drug resistance is significantly enhanced (10–1,000 times); antibiotics cannot effectively remove the bacterial biofilm and can also induce drug resistance (Aliramezani et al. 2016), thus aggravating clinical infection and increasing the difficulty of treatment. While the resistance rates of bfmS-negative isolates to trimethoprim/sulfamethoxazole were higher than those of bfmS-positive isolates (p < 0.05), this may have been due to bfmS negatively regulating antimicrobial resistance in A. baumannii (Kim et al. 2019).
Integrons can capture and express resistance gene cassettes through site-specific recombination and play important roles in the production and spread of drug resistance genes (Lee et al. 2017). In this study, we screened for intI1 in 269 A. baumannii isolates. Among them, 75 isolates of CRAB and three isolates of CSAB were positive for intI1, consistent with our previous reports (Xiao et al. 2019). The amplified 75 variable regions in 78 intI1-positive isolates were all aacA4-catB8-aadA1, which can confer resistance to chloramphenicol and aminoglycoside. It can explain, in part, how the drug resistance rates of the intI1-positive isolates to tobramycin and amikacin were higher than those of the intI1-negative isolates (p < 0.05). Apart from tobramycin and amikacin, the resistance rates of intI1-positive CRAB isolates to trimethoprim/sulfamethoxazole and minocycline were also higher than those of intI1-negative CRAB. The sul1-qacEΔ1 regions in the 3’ conserved segment of the class 1 integron may partly explain the higher resistance rates of intI1-positive CRAB isolates to trimethoprim/sulfamethoxazole. In addition, the class 1 integron was often embedded in transposons or located in drug-resistance plasmids, in which many other drug-resistance genes were also carried. This can partly explain the relatively higher resistance rates of intI1-positive isolates to other antibiotics that cannot be conferred by antibiotic-resistance gene cassettes in variable regions of class 1 integrons.
In this study, the Pc promoters of the variable regions in 78 intI1-positive isolates, such as PcH2, were all relatively strong, and the expression levels of downstream gene cassettes were relatively high, which can confer a higher level of drug resistance to bacteria (Wei et al. 2011; Barraud and Ploy 2015). Meanwhile, the efficiency of exogenous gene cassette integration into the attI1 site downstream of strong Pc promoters was also lower (Wei et al. 2011). The integrase protein corresponding to a stronger Pc (PcS or PcH2) has a weaker ability to capture exogenous gene cassettes to maintain the relative stability of integrons (Barraud and Ploy 2015). This may be one of the reasons for the identity of gene cassette array aacA4-catB8-aadA1 found in this study.
Because the Pc of class 1 integrons is opposite to the promoter of integrase, there is mutual interference, and studies have shown that the stronger Pc of class 1 integrons can affect the expression of integrase (Lacotte et al. 2017). The SOS stress response system regulates the expression of intI1, and binding the LexA protein to the adjacent sites of the −10 region of the intI1 promoter Pint can inhibit the transcription of intI1. Studies have shown that A. baumannii lacks LexA-driven integrase repression but restricts the expression of intI1 through the selective retention of the strong Pc to prevent the toxic effects caused by the massive expression of integrase protein (Couvé-Deacon et al. 2019). This may explain why the Pc of the class 1 integron in this study’s clinical isolates of A. baumannii was relatively strong.
Conclusions
In summary, blaOXA-23-like may be the main reason for CRAB’s resistance to carbapenem. A new (Oxford 3272, Pasteur 2520) CRAB isolate ST carrying the blaOXA-72, blaOXA-259, and blaADC-26 was discovered.
Acknowledgments
We thank Liwen Bianji (Edanz) for editing the English text of a draft of this manuscript.
Notes
[11] Availability of data and material
The data used to support this study are available from the corresponding author upon request.
[12] Conflicts of interest Conflict of interest
The authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication.