Skip to main content
Have a personal or library account? Click to login
Antimicrobial Resistance and the Prevalence of the Panton-Valentine Leukocidin Gene among Clinical Isolates of Staphylococcus aureus in Lithuania Cover

Antimicrobial Resistance and the Prevalence of the Panton-Valentine Leukocidin Gene among Clinical Isolates of Staphylococcus aureus in Lithuania

Open Access
|Mar 2024

Full Article

Introduction

The Gram-positive bacterium Staphylococcus aureus is an asymptomatic colonizer of the anterior nares (Wertheim et al. 2005). It is a common bacterial pathogen responsible for a wide range of human infections, including skin infections, pneumonia, respiratory tract infections, surgical wound infections, prosthetic joint infections, cardiovascular infections, and nosocomial bacteremia (Tong et al. 2015). While various antimicrobial compounds are used to treat staphylococcal infections, the emergence of antimicrobial resistance is an increasing concern (Vestergaard et al. 2019). Unsuc- cessful treatment due to antimicrobial resistance leads to significant financial and human losses (Rungelrath and DeLeo 2021). There are numerous mechanisms by which antibiotic resistance arises, including changes in drug targets, enzymatic drug inactivation, enhanced efflux of antimicrobial substances, and altered drug accessibility (Boyle-Vavra and Daum 2016). Horizontal acquisition of the mecA gene, which encodes PBP2a, an alternative transpeptidase with poor affinity for the majority of β-lactam antibiotics, confers resistance to methicillin as well as almost all other members of the broad class of β-lactam antibiotics (Vestergaard et al. 2019). Resistance to macrolide, lincosamide, streptogramin B (MLSb) compounds (including erythromycin) is encoded by the erm genes, primarily ermA and ermC, which encode proteins responsible for ribosomal-binding site alteration (by mutation or/and methylation of the 23S rRNA gene) (Alekshun and Levy 2007; Toh et al. 2007; Cetin et al. 2008). Active efflux or target-site protection has been linked to clinically relevant tetracycline resistance (Jensen and Lyon 2009). The genes tetK and tetL encode efflux pumps of the main facilitator superfamily, which facilitate active efflux by exchanging a proton for a tetracycline molecule (Jensen and Lyon 2009), while the tetM gene encodes a protein responsible for ribosomal site protection (Burdett 1991).

Furthermore, virulence factors such as the Panton-Valentine leukocidin gene have been identified a a significant concern for public health. Both methicillin-resistant S. aureus (MRSA) and methicillin-susceptible S. aureus (MSSA) strains can possess the lukS-lukF gene, which is transcribed as a tandem mRNA sequence with two open reading frames and encodes a pore-forming protein called Panton-Valentine leukocidin (PVL) (Prévost et al. 1995; Löffler et al. 2010; Chi et al. 2014). PVL causes these cells to degranulate prematurely, severely damaging the surrounding tissue. As a result, this process allows the bacteria to avoid the local immune system within the tissue, increasing the invasiveness and virulence of S. aureus producing PVL (Shallcross et al. 2013; Sakr et al. 2018). In Lithuania, the prevalence of MRSA infections has remained constant, with rates between 5% and 10% (ECDC 2020). While the number of invasive MRSA infections in other EU countries, such as Italy, Slovakia, Greece, Romania, and Portugal, has dropped to 25% (ECDC 2020), MRSA still poses a threat because of the high rates of hospitalization and mortality associated with MRSA infection, as well as its resistance to antimicrobial drugs (Yahav et al. 2016). Therefore, it is critical to continue developing innovative prevention and treatment strategies for MRSA infections. The main aim of this study was to investigate the prevalence of antimicrobial resistance and virulence genes, including the Panton-Valentine leukocidin gene, among clinical isolates of S. aureus in Lithuanian hospitals. This study may provide valuable insights into managing and preventing staphylococcal infections, particularly MRSA infections in Lithuania, and contribute to developing more effective infection prevention and treatment strategies.

Experimental
Materials and Methods
Study design

A retrospective study was conducted from June 1, 2019, to September 2, 2021. Two hospitals in Vilnius, Lithuania, took part in the study: Vilnius City Clinical Hospital (a 510-bed regional hospital) and Vilnius University Hospital Santaros Klinikos Center of Infectious Diseases (a 50-bed centre). All consecutive adult patients (≥ 18 years) with S. aureus isolated from clinical specimens were included in this study. S. aureus strain isolated from the same person repeatedly was excluded from the study. The patients’ sociodemographic data were evaluated using a questionnaire.

Phenotypic identification of isolates

Collected specimens were assigned into five groups: skin and soft tissue, blood, respiratory tract, urine, and other specimens (peritoneal cavity, joint cavity, prostheses, and cerebrospinal fluid). All specimens were inoculated onto blood agar with 5% sheep blood (Graso, Poland) and the selective chromogenic media ChromID® (bioMèrieux, France) and ChromID® MRSA SMART (bioMèrieux, France). All plates were aerobically incubated for 24–48 h at 35 ± 2°C. The MRSA and MSSA clinical isolates were identified with the MALDI--TOF VITEK® MS Microbial Identification System (bioMérieux, France).

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing and interpretation of the results for the tested S. aureus strains were performed using the disk diffusion method on Muller-Hinton agar (Bio-Rad, France) according to the recommendations of the European Committee on Antimicrobial Susceptibility Testing (EUCAST 2022). The susceptibility of all S. aureus isolates to cefoxitin (30 μg), rifampin (5 μg), clindamycin (2 μg), erythromycin (15 μg), norfloxacin (10 μg), fusidic acid (10 μg), benzylpenicillin G (1 U), ciprofloxacin (5 μg), tetracycline (30 μg), gentamicin (10 μg) and trimethoprim-sulfamethoxazole (1.25–23.75 μg) was tested using commercial discs (Liofilchem®, Italy). Inducible or constitutive clindamycin resistance was examined using the double-disk method (D-test). Susceptibility to vancomycin was determined by using the gradient method (Liofilchem®, Italy). For quality control, Staphylococcus aureus ATCC® 29213™ was used (EUCAST 2022).

Molecular typing

All S. aureus strains were analysed for detection of the mecA, mecC (methicillin resistance), ermA, ermC (erythromycin resistance), tetK, tetM (tetracycline resistance) and lukF-PV (virulence) genes by our designed multiplex real-time PCR protocols. The 16S rRNA coding sequence was applied as an internal PCR control. The primer and probe sequences were designed using the Vector NTI Advance™ program (Thermo Fisher Scientific, Inc., USA) for sequence alignment and FastPCR online (http://primerdigital.com/tools/pcr.html) Java applet for primer tests (Table I). The multiplex reactions were divided into the mixture I (targeting ermA, lukF-PV, ermC, and 16S rRNA), mixture II (targeting tetK, tetM, mecA, and 16S rRNA), and mixture III (targeting mecC and 16S rRNA). The reactions were carried out in a total volume of 15 μl with 1 μl of S. aureus lysate DNA. The multiplex real-time PCR mixture composition was 7.5 μl of 2 × SensiMix™ II Probe (Bioline Reagents Ltd., UK), 200 nM of each primer (Biolegio, The Netherlands), and 100 nM of each hydrolysis probe (Biolegio, The Netherlands). The reactions were performed using a Rotor-Gene Q 5plex HRM thermal cycler (QIAGEN, Germany) under the following conditions: initial denaturation at 95°C for 10 min (1 cycle) followed by 40 cycles of denaturation at 95°C for 20 s and primer annealing and extension at 55°C for 1 min.

Table I

Sequences of primers and detection hydrolysis probes.

Target geneDetection primers and hydrolysis probes
ermA
ermA_F  CAATGGTTGATGTCGYTCAAGAAC
ermA_R  ATCTGCAACGAGCTTTGGG
ermA_P  FAM/TCAATACAGAGTCTACACTTGGCTTAGGATG/BHQ1
ermC
ermC_F  ATCTTTGAAATYGGCTCAGGAA
ermC_R  AACAAGTTTATKTTCTGTARTYTTGCA
ermC_P  ROX/AGTACAG+AGGTGTAATTTCGTAACTGCYA/BHQ2
mecA
mecA_F  CTTTACGATAAAAAGCTCCAACATGA
mecA_R  CTATTAATGTATGTGCGATTGTATTGC
mecA_P  ROX/TGGCTATCGTGTCACAATCGTTGACGA/BHQ2
mecC
mecC_F  ACTAATGGTATGGAACGTGTAGT
mecC_R  CCAACCTATTTGTCTTCCRGTTTC
mecC_P  FAM/TTTT+TAATTCTGCTGTKCCAGATTTACC/BHQ1
tetK
tetK_F  GATTGCTTTTATTGGTCACAATCAC
tetK_R  CTTGTAATATTTCTAGCTACAACCACC
tetK_Pr  FAM/TGAAGGGAATGCAGCAGATCCTACTCCT/BHQ1
tetM
tetM_F  AGAACTAAAAGAGCCTACAGTCA
tetM_R  TACAGATAAACCAATGGAAGCCC
tetM_Pr  HEX/TGGCGGCACTTCGATGTGAATGGTA/BHQ1
lukF-PV
Pvl_F  TGGTTGGGATGTTGAAGCACA
Pvl_R  TTGCAGCGTTTTGTTTTCGAG
Pvl_P HEX/TGCCAGTGTTATCCAGAGGTAACT/BHQ1
16S rRNA
Frrs_m  ACAGGATTAGATACCCTGGTAGTCC
Rrrs_m  CGTTGCGGGACTTAACCCAAC
Rrrs_Pr  Cy5/TCACRACACGAGCTGACGACAGCCA/BHQ2
Statistical analysis

Statistical analyses were performed using SPSS® 24.0 software (IBM® SPSS® Statistics for Windows, Version 24.0, IBM Corp., USA). Standard descriptive analysis was applied for the continuous variables using the mean, standard deviation, and minimal and maximal values. For the categorical data, the p-value was calculated using χ2 statistics. Fisher’s exact iterative test was applied if the expected values were less than 5. Differences were considered statistically significant at p ≤ 0.05.

Results

The study included 745 patients from whose specimens S. aureus was isolated. The mean age of the participants was 57.4 years (median −60, SD − 20.7). The youngest patient and study participant was 18 years old, and the oldest was 98 years old. Fifty-one percent (n = 380) of patients were female, and 49% (n = 365) were male.

The most significant number of strains was isolated from patients’ skin and soft tissues (69.0%, n = 514), with additional strains from blood (14.5%, n = 108), respiratory tract (11.7%, n = 87), urine (2.7%, n = 20), and 2.1% (n = 16) from other specimens (reproductive system, peritoneal cavity, breast milk, joint cavity, prostheses, feces, and cerebrospinal fluid) (Table II).

Table II

Antimicrobial resistance profile of Staphylococcus aureus strains isolated from different clinical specimens.

Skin and soft tissues (n = 514, 69.0%)Blood (n = 108, 14.5%)Respiratory tract (n = 87, 11.7%)Urine (n = 20, 2.7%)Other specimens (n = 16, 2.1%)Total (n = 745)
Susceptible to all antimicrobials114 (22.2%)19 (17.6%)16 (18.4%)6 (30.0%)2 (12.5%)157 (21.1%)
FOXR33 (6.4%)8 (7.4%)4 (4.6%)0 (0.0%)0 (0.0%)45 (6.0%)
S481 (93.6%)100 (92.6%)83 (95.4%)20 (100%)16 (100%)700 (94.0%)
CDR25 (4.9%)5 (4.6%)11 (12.6%)0 (0.0%)0 (0.0%)41 (5.5%)
S489 (95.1%)103 (95.4%)76 (87.4%)20 (100%)16 (100%)704 (94.5%)
ER53 (10.3%)8 (7.4%)24 (27.6%)1 (5.0%)1 (6.3%)87 (11.7%)
S461 (89.7%)100 (92.6%)63 (72.4%)19 (95.0%)15 (93.8%)658 (88.3%)
NORR40 (7.8%)8 (7.4%)4 (4.6%)2 (10.0%)0 (0.0%)54 (7.2%)
S474 (92.2%)100 (92.6%)83 (95.4%)18 (90.0%)16 (100%)691 (92.8%)
FAR22 (4.3%)2 (1.9%)2 (2.3%)0 (0.0%)1 (6.3%)27 (3.6%)
S492 (95.7%)106 (98.1%)85 (97.7%)20 (100%)15 (93.8%)718 (96.4%)
PR378 (73.5%)84 (77.8%)65 (74.7%)13 (65.0%)13 (81.3%)553 (74.2%)
S136 (26.5%)24 (22.2%)22 (25.3%)7 (35.0%)3 (18.8%)192 (25.8%)
CIPR38 (7.4%)8 (7.4%)2 (2.3%)1 (5.0%)0 (0.0%)49 (6.6%)
S476 (92.6%)100 (92.6%)85 (97.7%)19 (95.0%)16 (100%)696 (93.4%)
TER29 (5.6%)4 (3.7%)5 (5.7%)1 (5.0%)0 (0.0%)39 (5.2%)
S485 (94.4%)104 (96.3%)82 (94.3%)19 (95.0%)16 (100%)706 (94.8%)
GNR23 (4.5%)1 (0.9%)11 (12.6%)0 (0.0%)0 (0.0%)35 (4.7%)
S491 (95.5%)107 (99.1%)76 (87.4%)20 (100%)16 (100%)710 (95.3%)
SXTR1 (0.2%)1 (0.9%)0 (0.0%)0 (0.0%)0 (0.0%)2 (0.3%)
S513 (99.8%)107 (99.1%)87 (100%)20 (100%)16 (100%)743 (99.7%)
RDR0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)
S514 (100%)108 (100%)87 (100%)20 (100%)16 (100%)745 (100%)
VAR0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)0 (0.0%)
S514 (100%)108 (100%)87 (100%)20 (100%)16 (100%)745 (100%)

R – resistant, S – susceptible, FOX – cefoxitin, CD – clindamycin, E – erythromycin, NOR – norfloxacin, FA – fusidic acid, P – penicillin, CIP – ciprofloxacin, TE – tetracycline, GN – gentamicin, SXT – trimethoprim-sulfamethoxazole, RD – rifampin, VA – vancomycin

Susceptibility to antimicrobials

In total, 21.1% (157/745) of S. aureus strains were susceptible to all tested antimicrobials. All 745 isolates were susceptible to rifampin and vancomycin. More than 95% of the S. aureus strains were susceptible to trimethoprimsulfamethoxazole, fusidic acid, and gentamicin (99.7%, 96.4%, and 95.3%, respectively). Susceptibility to tetracycline was found in 94.8% (706/745) of isolates, to clindamycin in 94.5% (704/745), and to erythromycin in 88.3% (658/745). The lowest susceptibility rate was to penicillin (25.8%, 192/745). Most S. aureus strains resistant to clindamycin showed inducible resistance (65.9%, 27/41) to this lincosamide. MRSA comprised 6% (45/745) of the tested strains. Methicillin-resistant strains were isolated from skin and soft tissues (73.3%, 33/45), blood (17.8%, 8/45), and the respiratory tract (8.9%, 4/45). The antimicrobial resistance profiles of the clinical S. aureus isolates are shown in Table II.

All isolated MRSA strains were resistant to penicillin. MRSA strains showed significantly lower susceptibility to clindamycin, erythromycin, norfloxacin, ciprofloxacin, tetracycline, and gentamicin than MSSA isolates (p < 0.05). A comparison of MRSA and MSSA susceptibility patterns is shown in Table III.

Table III

Comparison of the antimicrobial susceptibility of MSSA and MRSA strains.

AntimicrobialMSSA (n = 700)MRSA (n = 45)p-valueOR (95% CI)
Clindamycin670 (95.7%)34 (75.6%)0.000*7.23 (2.99–16.34)
Erythromycin641 (91.6%)17 (37.8%)0.000*17.89 (8.81–36.76)
Norfloxacin683 (97.6%)8 (17.8%)0.000*185.82 (70.11–518.18)
Fusidic acid674 (96.3%)44 (97.8%)0.8200.59 (0.01–3.77)
Penicillin192 (27.4%)0 (0.0%)NANA
Ciprofloxacin686 (98.0%)10 (22.2%)0.000*171.50 (65.93–457.45)
Tetracycline677 (95.3%)39 (86.7%)0.0253.11 (1.00–8.12)
Gentamicin673 (96.1%)37 (82.2%)0.0015.39 (1.97–13.24)
Trimethoprimsulfamethoxazole699 (99.9%)44 (97.8%)NANA
*

p < 0.0001, NA – not applicable, OR – odds ratio, CI – confidence interval

Antimicrobial resistance and virulence genes

Eighty-seven erythromycin-resistant S. aureus isolates were found, and the presence of the ermA and ermC genes in these isolates was determined. The most prevalent erm gene was ermC (41.4%, 36/87), followed by ermA (32.2%, 28/87). Neither the ermA nor the ermC gene was detected in 26.4% (23/87) of the tested erythromycin-resistant S. aureus strains (Table IV). The frequency of the ermC gene was higher in MSSA strains than in MRSA strains (49.2%, 29/59 vs. 25.0%, 7/28) (χ2 = 5.033, p = 0.037). The erythromycin-resistant MRSA isolates exhibited higher frequencies of ermA than the erythromycin-resistant MSSA isolates (60.7%, 17/28 vs. 18.6%, 11/59) (χ2 = 14.323, p < 0.0001). A total of 0.5% (3/658) of S. aureus isolates susceptible to erythromycin had the ermC gene.

Table IV

The prevalence of erythromycin and tetracycline resistance and virulence genes in MSSA and MRSA strains.

GeneMSSAMRSAIn total
ermA11 (18.6%)17 (60.7%)28 (32.2%)
ermC29 (49.2%)7 (25.0%)36 (41.4%)
ND erm genes19 (32.2%)4 (14.3%)23 (26.4%)
tetM8 (24.2%)3 (50.0%)11 (28.2%)
tetK24 (72.7%)3 (50.0%)27 (69.2%)
ND tet genes1 (3.0%)0 (0.0%)1 (2.6%)
pvl35/700 (5.0%)19/45 (42.2%)54/745 (7.3%)

ND – not detected

A total of 97.4% (38/39) of tetracycline-resistant isolates carried the tetracycline resistance gene tet (Table IV). The prevalence of tetK and tetM were 69.2% (27/39) and 28.2% (11/39), respectively. The most prevalent gene in the tetracycline-resistant MSSA isolates was tetK (72.7%, 24/33), followed by tetM (24.2%, 8/33). One MSSA strain had inducible lincosamide resistance and the ermA gene, and it was sensitive to tetracycline but positive for tetM. The tetM and tetK genes were equally found in tetracycline-resistant MRSA strains (3/6 and 3/6, respectively).

All 745 S. aureus strains were tested for the mecA and mecC genes. The mec genes were found in 6.4% (48/745) of the tested isolates. Forty-five S. aureus strains were cefoxitin resistant, and the analysis showed that 95.6% (43/45) of them harboured the mecA gene, whereas 4.4% (2/45) harboured mecC.

An analysis of the S. aureus virulence gene lukF-PV, which encodes the PVL protein, was performed in all 745 strains. A total of 7.3% (54/745) of the isolates had the pvl gene. The frequency of pvl was significantly higher in the MRSA isolates than in the MSSA isolates (42.2%, 19/45 vs. 5.0%, 37/700; p < 0.0001). The highest proportion of pvl-positive strains was among those isolated from skin and soft tissue specimens – 72.2% (39/54).

Discussion

This study shows that the skin and soft tissues were the most common sites for infection, probably because S. aureus colonizes typically the skin. Antimicrobial resistance testing revealed that the highest resistance rate was to penicillin, as has been previously demonstrated by others (from 69 to 78.9%) (Resman et al. 2016; Davido et al. 2018). On the other hand, the rate of S. aureus resistance to penicillin is decreasing, and there are suggestions to use penicillin to treat penicillin-susceptible S. aureus infections (Cheng et al. 2016; Davido et al. 2018). Differences in tetracycline and erythromycin resistance vary between various countries. In our study, tetracycline resistance differed from that reported in Poland (5.2% and 10.7%, respectively) (Kot et al. 2020). The rate of resistance to erythromycin in this study was lower than that reported by Romaniszyn et al. (2015) in Poland (32.6%) and Karki et al. (2001) in Estonia (25.3%). According to our study data, the prevalence of MRSA is comparable with that reported by other countries that have sampled patients in hospitals (ECDC 2020). Similar MRSA prevalence rates were reported in Latvia, Germany, Austria, Slovenia, Belgium, and Luxemburg for invasive strains, where 5–10% of the isolated S. aureus strains were reportedly MRSA (ECDC 2020). All S. aureus isolates were found to be susceptible to rifampin and vancomycin. Based on data from a recent systematic review and meta-analysis, the prevalence of vancomycin-resistance S. aureus (VRSA) was 1% in Europe, but a higher prevalence rate of vancomycin resistance was reported in developing countries. In Egypt, 5.5–8.8% of S. aureus isolates were VRSA (Amr and Gammal 2017; ElSayed et al. 2018). The determination of S. aureus resistance is crucial for optimal antimicrobial therapy, as well as for epidemiological knowledge and effective infection control strategies (Prestinaci et al. 2015; Coia et al. 2021). Since 2008, Lithuania has applied a national prevention program to control the spread of antimicrobial resistance (Ministry of Health of The Republic of Lithuania 2007). The differences in the resistance of isolated S. aureus strains to antimicrobials in our study as compared to the data presented by other scientists (Gianino et al. 2018) may be linked not only to the consumption of antibiotics in the country but also to the internal policy of antibiotics consumption in the hospitals under study. In Lithuania, first- and second-generation cephalosporins and broad-spectrum penicillins are the most common antimicrobials in the treatment of nosocomial infections (Ašembergienė et al. 2009). Also, according to the data of the Institute of Hygiene, penicillins with inhibitors are the most often prescribed group of antimicrobials (39.2% of all bacterial diseases in Intensive care units). Other often-prescribed groups of antibiotics are first and second-generation cephalosporins (16.1% of all bacterial diseases in Intensive care units) (Institute of Hygiene 2020). In our study, we observe S. aureus resistance to the most used group of antibiotics. Only two groups of antibiotics are prescribed for treating MRSA: glycopeptide (vancomycin) and oxazolidinone (linezolid). Antimicrobials of other groups (cyclic lipopeptides, streptogramins, glycyclins) are not registered in our country (Institute of Hygiene 2020). Considering the existing antibiotic prescribing practice in primary healthcare in Lithuania, we assume that it may have influenced our findings that the susceptibility to some antimicrobials is the same or higher as in other European countries. Further research is needed to confirm the findings.

Our results indicated that erythromycin and tetracycline resistance in S. aureus strains from Vilnius hospitals was dependent on the presence of corresponding resistance genes. This study’s predominant erythromycin resistance gene was ermC (41.4%), while the less predominant gene was ermA (32.2%).

These findings differed from those of earlier research, which indicated that most erythromycin-resistant bacteria possessed ermA (Lim et al. 2012). In France, the prevalence of ermA and ermC in erythromycin-resistant strains was 63.2% and 25.0%, respectively. Among MRSA strains, the prevalence of ermA was higher than that of the ermC gene (60.7% and 25.0%, respectively), consistent with previous studies (Lina et al. 1999). Interestingly, a significant proportion (26.4%) of S. aureus bacteria resistant to erythromycin tested negative for both the ermC and ermA genes. This result can occur because other genes, such as msr, lun, and others in the erm gene cluster, are responsible for bacterial resistance to erythromycin (Khodabandeh et al. 2019). Regarding tetracycline resistance, our study showed that the predominant gene among tetracyclineresistant S. aureus from Vilnius hospitals was tetK, with a prevalence of 69.2%. This differed from the results of other studies, which showed that the tetracycline gene tetM was more prevalent (Trzcinski et al. 2000; Schmitz et al. 2001). These results suggest that S. aureus strains from Vilnius contain characteristic resistance genes for tetracycline resistance. The mecA gene was found in 6.4% of all 745 tested S. aureus strains. In 95.6% of MRSA strains, the presence of mecA was detected. The prevalence of mecA was consistent with that reported in North American and European hospitals, where mecA prevalence was also found to be 95% (Wielders et al. 2002). Even though MRSA bacteria are resistant to β-lactam antibiotics due to the presence of the mecA gene, the level of resistance can vary significantly among MRSA strains. Some MRSA strains exhibit resistance that is barely above that of susceptible isolates (methicillin minimum inhibitory concentrations (MICs) < 3 μg/ml). In contrast, other strains show high resistance (methicillin MICs up to 1,600 μg/ml) (Parvez et al. 2008). The reasons for these differences in resistance are not fully understood. However, some research suggests that increased expression or duplication of the mecA gene or enhanced transcription of this gene may contribute to higher resistance levels (Gallagher et al. 2017). Finally, the virulence factor PVL plays a vital role during infections caused by S. aureus (Shallcross et al. 2013; Sakr et al. 2018). All S. aureus strains were genotypically tested for the prevalence of the lukF-PV gene. A total of 7.3% of strains were found to carry the pvl gene. The gene was found in both MRSA and MSSA strains. However, out of all strains carrying the pvl gene, there were more bacteria resistant to methicillin (42.2%) than strains susceptible to methicillin (5.0%). These results are consistent with data from other studies (Dufour et al. 2002; Wannet et al. 2005; Diederen and Kluytmans 2006).

Conclusions

All tested strains were susceptible to rifampicin and vancomycin. MRSA consisted of 6% of the strains. The lowest susceptibility rate was found to penicillin. The tetK gene was predominant among S. aureus strains resistant to tetracycline, and the ermC gene was predominant among erythromycin-resistant strains. Seven percent of S. aureus isolates harbored the pvl gene, which was more prevalent in methicillin-resistant strains. S. aureus resistance to tested antimicrobials is lower than in other European countries due to the low antibiotic consumption in primary health care and rational antibiotic use strategy in Lithuania.

DOI: https://doi.org/10.33073/pjm-2024-003 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 21 - 28
Submitted on: Sep 29, 2023
Accepted on: Dec 18, 2023
Published on: Mar 4, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2024 Agnė Kirkliauskienė, Jonas Kriščiūnas, Jolanta Miciulevičienė, Daiva Radzišauskienė, Tomas Kačergius, Maksim Bratchikov, Lina Kaplerienė, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.