Screening of Potential Probiotic Lactobacillaceae and Their Improvement of Type 2 Diabetes Mellitus by Promoting PI3K/AKT Signaling Pathway in db/db Mice

Screening of Potential Probiotic Lactobacillaceae and Their Improvement of Type 2 Diabetes Mellitus by Promoting PI3K/AKT Signaling Pathway in db/db Mice

Polish Journal of Microbiology

Volume 72 (2023): Issue 3 (September 2023)

By:

Yueyang Li, Tong Tong, Peifan Li, Yian Peng, Michael Zhang, Jia Liu, Yongxin She, Zuming Li and Yongli Li

Open Access

|Sep 2023

Figures & Tables

Changes of body weight (a) and fasting blood glucose (FBG) levels (b) in mice. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Morphological alterations in the liver (a), kidney (b), pancreas (c), and colon (d).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Colon inflammatory factor mRNA expression. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

PI3K, AKT protein expression electropherogram, and protein relative expression. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

SCFAs content of mice in each group. Significant differences exist between values with different letters (p < 0.05).N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Specific gene primers used for qRT-PCR_

Gene	Primers	Length (bp)
IL-6	F: CCCCAATTTCCAATGCTCTCCR: CGCACTAGGTTTGCCGAGTA	141
IL-10	F: TTTAAGGGTTACTTGGGTTGCCR: AATGCTCCTTGATTTCTGGGC	106
IL-1β	F: TCAAATCTCGCAGCAGCACATCR: CGTCACACACCAGCAGGTTATC	206
GAPDH	F: CCTCGTCCCGTAGACAAAATGR: TGAGGTCAATGAAGGGGTCGT	133

Identification of Lactobacillaceae isolated based on 16S rDNA sequences and gene accession number assigned by NCBI_

Isolate number	Species	GenBank accession number	Similarity (%)
4	Limosilactobacillus fermentum	MT482589	99.73
5	Limosilactobacillus fermentum	MT482590	99.93
6	Limosilactobacillus fermentum	MT482591	99.93
8	Lactiplantibacillus plantarum	MT482586	99.93
10	Lactiplantibacillus plantarum	MT482587	99.80
11	Limosilactobacillus fermentum	MT463724	99.93
12	Limosilactobacillus fermentum	MT482592	99.93
13	Limosilactobacillus fermentum	MT482593	99.93
14	Limosilactobacillus fermentum	MT482594	99.93
16	Limosilactobacillus fermentum	MT482595	99.93
18	Limosilactobacillus fermentum	MT482596	99.93
20	Lactiplantibacillus plantarum	MT482588	99.93
22	Lactiplantibacillus plantarum	MT463726	99.86
25	Lactiplantibacillus plantarum	MT463727	99.86
26	Limosilactobacillus fermentum	MT482597	99.93
27	Limosilactobacillus fermentum	MT482598	99.93
28	Limosilactobacillus fermentum	MT482599	99.93
29	Limosilactobacillus fermentum	MT482600	99.93
30	Limosilactobacillus fermentum	MT482601	99.93
33	Limosilactobacillus fermentum	MT482602	99.93
38	Limosilactobacillus fermentum	MT482603	99.79
39	Limosilactobacillus fermentum	MT482604	99.86
305	Limosilactobacillus fermentum	MT463725	99.30

Orthogonal test of the inhibitory activities to α-amylase of Lactobacillaceae powders_

Trial	A	B	C	D	Inhibitory activity (%)
1	1	1	3	2	70.00
2	1	2	1	1	82.50
3	1	3	2	3	38.00
4	2	1	2	1	71.50
5	2	2	3	3	7.50
6	2	3	1	2	31.00
7	3	1	1	3	43.00
8	3	2	2	2	30.00
9	3	3	3	1	25.50
K₁	63.50	61.50	52.17	59.83
K₂	36.67	40.00	46.33	43.67
K₃	32.83	31.50	34.33	29.50
R	30.67	30.00	17.84	30.33
Optimum technologies	A₁B₁C₁D₁				93.18 ± 1.19
SS	0.334	0.294	0.096	0.279
df	2	2	2	2
F	10.969	9.637	3.156	9.143
Significance	^*	^*		^*

Orthogonal test of Lactobacillaceae powders’ inhibitory activities to α-glucosidase_

Trial	A	B	C	D	Inhibitory activity (%)
1	1	1	3	2	73.57
2	1	2	1	1	63.28
3	1	3	2	3	54.32
4	2	1	2	1	71.93
5	2	2	3	3	35.05
6	2	3	1	2	62.74
7	3	1	1	3	64.79
8	3	2	2	2	24.18
9	3	3	3	1	54.39
K₁	63.72	70.10	63.60	63.20
K₂	56.57	40.84	53.50	53.50
K₃	47.79	57.15	51.39	51.39
R	15.94	29.26	12.22	11.81
Optimum technologies	A₁B₁C₁D₁				75.33 ± 2.89
SS	0.076	0.258	0.057	0.048
df	2	2	2	2
F	74.785	252.387	55.709
Significance	^*	^*	^*	^*

Simulated digestion test and adhesion rates_

Isolate	Survival rate (%)	Adhesion rate (%)
Lactiplantibacillus plantarum 22	12.42 ± 2.84	6.94 ± 0.27
Lactiplantibacillus plantarum 25	9.10 ± 1.12	6.91 ± 0.11
Limosilactobacillus fermentum 11	5.86 ± 0.52	6.09 ± 0.39
Limosilactobacillus fermentum 305	8.82 ± 2.50	6.37 ± 0.28

Factors and levels of the orthogonal experiment of Lactobacillaceae powders_

Level	A (Limosilactobacillus fermentum 11 (CFU/ml))	B (Limosilactobacillus fermentum 305 (CFU/ml))	C (Lactiplantibacillus plantarum 22 (CFU/ml))	D (Lactiplantibacillus plantarum 25 (CFU/ml))
1	10⁸	10⁸	10⁸	10⁸
2	10⁹	10⁹	10⁹	10⁹
3	10¹⁰	10¹⁰	10¹⁰	10¹⁰

The inhibitory activities to α-amylase and α-glucosidase, and the viable count of the isolates_

	Isolate	Viable bacteria count (10⁹CFU/ml)	α-amylase inhibitory activities (%)	α-glucosidase inhibitory activities (%)
Lactiplantibacillus plantarum	8	1.71 ± 0.47^ab	49.93 ± 2.06^c	12.39 ± 3.05^a
	10	2.61 ± 0.38^a	56.72 ± 8.78^ab	12.60 ± 3.22^a
	20	2.29 ± 0.73^ab	17.33 ± 5.03^d	11.45 ± 4.18^a
	22	1.22 ± 0.47^b	62.29 ± 0.44^a	14.89 ± 0.38^a
	25	1.84 ± 0.70^ab	51.81 ± 3.65^bc	15.32 ± 0.89^a
Limosilactobacillus fermentum	4	2.11 ± 0.64^b	20.96 ± 4.95^f	28.51 ± 5.73^b
	5	2.15 ± 0.25^b	16.84 ± 8.34^f	15.91 ± 0.91^d
	6	2.93 ± 0.28^ab	44.94 ± 3.72^c	19.33 ± 1.02^cd
	11	2.55 ± 0.30^b	58.40 ± 1.68^a	52.63 ± 3.07^a
	12	0.93 ± 0.66^c	44.05 ± 4.51^c	17.98 ± 9.09^cd
	13	2.85 ± 0.69^ab	51.86 ± 4.20^b	17.60 ± 1.84^cd
	14	2.96 ± 0.52^ab	37.19 ± 7.29^d	4.93 ± 0.94^e
	16	3.92 ± 0.38^a	32.29 ± 9.59^de	15.35 ± 8.28^d
	18	2.16 ± 0.80^b	27.35 ± 7.43^e	15.94 ± 1.38^d
	26	2.53 ± 0.98^b	49.95 ± 6.54^bc	15.60 ± 2.62^d
	27	2.49 ± 0.92^b	41.39 ± 2.52^cd	20.83 ± 4.58^c
	28	3.59 ± 0.50^ab	47.92 ± 3.62^bc	20.53 ± 0.17^c
	29	2.23 ± 0.67^b	46.74 ± 3.31^bc	4.99 ± 0.56^e
	30	2.41 ± 1.43^b	55.38 ± 0.48^ab	15.69 ± 1.93^d
	33	1.70 ± 0.90^bc	47.49 ± 2.27^bc	14.19 ± 2.13^d
	38	3.16 ± 0.77^ab	50.59 ± 3.12^bc	8.10 ± 4.18^e
	39	1.89 ± 0.59^bc	37.77 ± 8.18^d	5.24 ± 0.89^e
	305	2.04 ± 0.51^bc	57.48 ± 5.04^ab	51.79 ± 1.13^e

DOI: https://doi.org/10.33073/pjm-2023-028 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331

Journal RSS Feed

Language: English

Page range: 285 - 297

Submitted on: Apr 4, 2023

Accepted on: Jun 9, 2023

Published on: Sep 20, 2023

Published by: Polish Society of Microbiologists

In partnership with: Paradigm Publishing Services

Publication frequency: 4 times per year

Keywords:

type 2 diabetes mellitus,

PI3K/AKT pathway,

probiotics properties,

short chain fatty acids

Related subjects:

Life sciences,

Microbiology and virology

© 2023 Yueyang Li, Tong Tong, Peifan Li, Yian Peng, Michael Zhang, Jia Liu, Yongxin She, Zuming Li, Yongli Li, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Previous article Volume 72 (2023): Issue 3 (September 2023)Next article

Screening of Potential Probiotic Lactobacillaceae and Their Improvement of Type 2 Diabetes Mellitus by Promoting PI3K/AKT Signaling Pathway in db/db Mice

Figures & Tables

Fig 1.

Fig 2.

Fig 3.

Fig 4.

Fig 5.

Specific gene primers used for qRT-PCR_

Identification of Lactobacillaceae isolated based on 16S rDNA sequences and gene accession number assigned by NCBI_

Orthogonal test of the inhibitory activities to α-amylase of Lactobacillaceae powders_

Orthogonal test of Lactobacillaceae powders’ inhibitory activities to α-glucosidase_

Simulated digestion test and adhesion rates_

Factors and levels of the orthogonal experiment of Lactobacillaceae powders_

The inhibitory activities to α-amylase and α-glucosidase, and the viable count of the isolates_

Paradigm

My account