Skip to main content
Have a personal or library account? Click to login
Screening of Potential Probiotic Lactobacillaceae and Their Improvement of Type 2 Diabetes Mellitus by Promoting PI3K/AKT Signaling Pathway in db/db Mice Cover

Screening of Potential Probiotic Lactobacillaceae and Their Improvement of Type 2 Diabetes Mellitus by Promoting PI3K/AKT Signaling Pathway in db/db Mice

Open Access
|Sep 2023

Full Article

Introduction

With the increasing number of diabetic patients, diabetes, especially type 2 diabetes mellitus (T2DM), is becoming an increasingly prevalent health issue in the 21st century (Cao et al. 2020; Wang et al. 2021a). Hyperglycemia is the main symptom of T2DM, primarily caused by insulin resistance or inadequate insulin production (Wu et al. 2021). The treatment of T2DM mainly includes two standard methods. The one is insulin injections, which could result in insulin resistance. Another method is orally administered hypoglycemic medications, which may cause adverse reactions and subsequent failures (Sun et al. 2020). It necessitates the development of non-toxic treatment options with hypoglycemic effects without side effects.

Many drugs used to treat diabetes, acarbose and miglitol are among the most commonly used. Unfortunately, these drugs have some adverse effects, including diarrhea, flatulence, and abdominal pain (Rosas-Ramírez et al. 2018). Probiotics have a promising future in treating T2DM in humans, so it is important to develop alternatives to current antidiabetic medicine (Awad et al. 2018). It has been demonstrated that probiotics, which are generally considered to be ingested microorganisms that have favorable effects on the host, are effective in preventing and alleviating T2DM through different mechanisms, such as lowering blood glucose or inhibiting pro-inflammatory markers (Hill et al. 2014; Sharma and Shukla 2020; Sun et al. 2020; Zendeboodi et al. 2020; Zepeda-Hernández et al. 2021). Limosilactobacillus fermentum 21828 showed probiotic and hypoglycemic activities in vitro (Wang et al. 2021b). Ligilactobacillus salivarius AP-32 and Limosilactobacillus reuteri GL-104 improved T2DM by reducing fasting blood glucose (FBG) levels and attenuating liver and kidney damage (Hsieh et al. 2020). L. fermentum MCC2759 and MCC2760 have shown positive results in a T2DM model by modifying lipid and glucose profiles, reducing inflammatory factors in the liver, and strengthening intestinal barrier function (Archer et al. 2021). After Lactiplantibacillus plantarum LRCC5314 intervened in diabetic model mice, the expressions of glucose transport-related genes Glut4 and adiponectin were increased, and the expressions of TNF-α and IL-6 decreased (Youn et al. 2021). It was reported in both in vitro and in vivo studies that L. plantarum YJ7 showed antihyperglycemic potential (Zhong et al. 2021). The effects of probiotics from different sources are not identical. Vemuri et al. (2018) found that compared with plant-derived L. plantarum UALp-05 and dairy-derived Streptococcus salivarius subsp. thermophilus UASt-09, only human-derived probiotics Limosilactobacillus acidophilus DDS-1 and Bifidobacterium animalis ssp. lactis UABla-12 could induce human colon cancer cells to secrete IL-10. Therefore, probiotics may be used as a non-toxic treatment with hypoglycemic effects and no side effects, and human-derived probiotics may be more suitable.

By inhibiting the action of α-amylase and α-glucosidase, carbohydrates are not broken down and absorbed as quickly, reducing the glucose rate that enters the bloodstream after a meal (Barros et al. 2021; Zhang et al. 2022). It helps reduce post-meal spikes in blood glucose levels, which benefits people with diabetes. Therefore, inhibiting the action of α-amylase and α-glucosidase is critical to treating T2DM (Gong et al. 2020). The probiotics that may improve T2DM were screened by examining the inhibitory activities of α-amylase and α-glucosidase. The effects of multiple probiotic strains are superior to those of a single strain in terms of gut function, gut microbiota regulation, intestinal inflammation, depression, and neurological disorders (Chapman et al. 2011; Li et al. 2019; Dehghani et al. 2022).

The 16S rDNA sequencing was used to confirm the identification of the selected strain (Jomehzadeh et al. 2020; Lin et al. 2020). Therefore, four novel strains of Lactobacillaceae with high inhibitory activity against α-glucosidase and α-amylase were isolated from the feces of healthy adults and identified by the 16S rDNA sequencing in this study. This study is the first that investigates the hypoglycemic ability of the Lactobacillaceae mixture with good probiotic properties from the feces of healthy adults. A theoretical foundation is provided for applying human-derived lactic acid bacteria to T2DM research in the future.

Experimental

Materials and Methods

Isolation of human Lactobacillaceae

The use of fecal samples is approved by a healthy fecal provider who has not taken any medication in the past year and has undergone a professional physical examination at the Chinese People's Liberation Army (PLA) General Hospital (Beijing, China). Fecal samples (10 g) from healthy adults were resuspended in 100 ml de Man, Rogosa and Sharp medium (MRS; Beijing Land Bridge Technology Co., Ltd., China) and stationary cultivated for 24 h at 37°C. Then, cultures were diluted and spread onto the MRS agar plates. After cultivation for 24 h at 37°C, colonies were picked up and added to 10 ml MRS medium. After cultivation for 12 h at 37°C, the culture broth was added to 10 ml MRS medium with 5% (v/v) inoculation volume. Finally, a diluted suspension of the culture broth was plated onto MRS agar plates, and colonies were counted.

Identification of isolates

Total DNA was extracted from bacterial cultures in MRS broth. 200 μl of cultures was collected in 1.5 ml tube and centrifuged at 9,000 × g for 2 min. After the cells were washed, excess liquid was removed, and 20 μl bacterial lysate (NaOH/SDS) was added, then incubated at room temperature for 20 min and diluted 20 times. Finally, 2 μl of supernatant was centrifuged for 2 min. The amplification procedure was pre-denaturation (94°C, 5 min), 40 cycles of denaturation (94°C, 1 min), annealing (55°C, 60 s), extension (72°C, 60 s), and a final extension at 72°C for 10 min. DNA templates were amplified by PCR using the universal primers amplifying a region of the 16S rRNA gene: 27F (5′-AGAGTTTGATCMTGGCTCAG-3′) and 1492R (5′-TACGGYTACCTTGTTACGACTT-3′) (Kunduhoglu and Hacioglu 2021). After purification of the PCR product from the agarose gel, the samples were sent for sequencing. The resulting sequences were compared with the online tool BLAST.

α-Amylase inhibitory activity assay

Based on Barapatre et al. (2015) with some variations, the α-amylase inhibitory activity was measured. 10 μl of 0.02 M sodium phosphate buffer (pH 6.9) containing α-amylase (0.5 mg/ml) and 50 μl bacterial suspension (109 CFU/ml) were mixed and incubated at 37°C for 10 min. Then, 50 μl of 1% (w/v) starch dissolved in 0.02 M sodium phosphate buffer (pH 6.9) was added and further incubated at 37°C for 10 min. The reaction was terminated by adding 20 μl of DNS reagent. Then, the reaction mixture was centrifuged at 8,000 × g at 4°C for 5 min. The α-amylase activity was detected at 540 nm, and inhibitory activity was calculated by using the formula below:

(1)
Inhibition(%)=[1((γ1δ1)/(α1β1))]×100%
where α1 – the absorbance with α-amylase and without the sample, β1 – the absorbance without α-amylase or the sample, γ1 – the absorbance with α-amylase and the sample, and δ1 – the absorbance with the sample but without α-amylase.

α-Glucosidase inhibitory activity assay

The α-glucosidase inhibitory activity was determined by the method of Nguyen et al. (2018). The mixture included 50 μl of 0.1 M phosphate buffer (pH 6.9), 20 μl of bacterial suspension (109 CFU/ml), and 20 μl of p-nitro-phenyl-α-d-glucopyranoside (PNPG, 5 mM). After the mixture was incubated for 10 min at 37°C, 10 μl of 0.5 U/ml α-glucosidase solution was added. The mixture was incubated for 10 min at 37°C; then the reaction was stopped by adding 100 μl of sodium carbonate (0.02 M). The reaction mixture was centrifuged at 8,000 × g for 5 min (4°C). Then, the supernatant was diluted with 1 ml distilled water, and the absorbance was measured at 405 nm. The inhibitory activity was calculated by using the formula below:

(2)
Inhibition(%)=[1((γ2δ2)/(α2β2))]×100%
where α2 – the absorbance with α-glucosidase and without the sample, β2 – the absorbance without α-glucosidase or the sample, γ2 – the absorbance with α-glucosidase and the sample, and δ2 – the absorbance with the sample but without α-glucosidase.

Resistance to gastrointestinal juice

Strain survivability was assessed using an in vitro digestion model. Artificial saliva, gastric juice, and intestinal juice were manufactured as described by Zhu et al. (2015). Following washing, bacteria (1 ml, 1.0 × 109 CFU/ml) were simulated digestion at 37°C with peristaltic contraction, including a) suspension in 5 ml artificial saliva for 5 min; b) resuspension in 10 ml artificial gastric juice, incubation for 2 h; c) resuspension in 10 ml artificial intestinal juice, incubation for 2 h. Then, a diluted suspension of simulated digested bacteria was plated onto MRS agar plates and cultivated for 24 h at 37°C. The colonies were counted:

(3)
Survivalrate(%)=M1M0×100%
where M1 – the number of viable bacteria after the process, M0 – the number of viable bacteria before the process.

Adhesion to Caco-2 cell

Bacterial adhesion to Caco-2 cell cultures was investigated according to Fonseca et al. (2021). After cultivation in MRS broth for 24 h at 37°C and washing twice with phosphate-buffered solution, the bacteria were resuspended in Dulbecco's Modified Eagle Medium (DMEM; Sigma-Aldrich Co., Ltd., USA) at a density of 109 CFU/ml. Caco-2 cells were then cultivated for 1 h at 37°C in an atmosphere of 5% CO2 with a 1 ml culture suspension of bacteria. After being washed three-time with PBS, treated with 1 ml Triton-X solution, and cultivated for 5 min at 37°C, the culture medium was serially diluted and plated onto MRS agar to count the bacterial colonies:

(4)
Adhesionability(%)=N1N0×100%
where N1 – the number of viable bacteria after the process, N0 – the number of viable bacteria before the process.

Preparation and counting of Lactobacillaceae powder

After incubating at 37°C for 24 h, four Lactobacillaceae strains were centrifuged for 5 min at 4°C and twice washed with sterile water to extract the bacterial cells. Then, the bacteria were freeze-dried to produce powders. Four Lactobacillaceae powders were suspended in sterile water, respectively. A diluted powder suspension was plated onto MRS agar plates to encounter the number of bacterial colonies.

Inhibitory activities to α-glucosidase and α-amylase of Lactobacillaceae powders

An L9 (34) orthogonal table was designed. The inhibitory activities to α-amylase and α-glucosidase were used as the inspection index. L. fermentum 11 (A), L. fermentum 305 (B), L. plantarum 22 (C), and L. plantarum 25 (D) were used as the experimental factors. Each factor was designed with three levels, and the factors and levels of orthogonal tests for the inhibitory activities to α-amylase and α-glucosidase were shown in Table I.

Table I

Factors and levels of the orthogonal experiment of Lactobacillaceae powders.

LevelA (Limosilactobacillus fermentum 11 (CFU/ml))B (Limosilactobacillus fermentum 305 (CFU/ml))C (Lactiplantibacillus plantarum 22 (CFU/ml))D (Lactiplantibacillus plantarum 25 (CFU/ml))
1108108108108
2109109109109
31010101010101010

Animal experiment

All animals were maintained in a specific pathogen-free (SPF) environment. Under the 12-hour light cycle, the animals were permitted to access food and water at any time. In the following experiment, mice were divided into three groups after an adjustment period of 7 days: the control group (N group, 12 wt/wt mice), the diabetic model group (M group, 12 db/db mice), and the probiotic-treated group (ML group, 12 db/db mice with the Lactobacillaceae mixture intervention). The freeze-dried bacterial powders of four strains (L. plantarum 22, L. plantarum 25, L. fermentum 11, and L. fermentum 305) were mixed (the number of viable bacteria was 1.0 × 109 CFU/ml for each strain). A dose of 10 ml/kg body weight was administered intragastrically to the ML group. The body weights (BW) and the FBG level of mice were recorded every week. A standard glucometer was used to determine the FBG level in the blood from the tail vein (F. Hoffmann-La Roche Co., Ltd., Switzerland).

Histopathological analysis

The liver, kidney, and pancreas tissues were fixed in 4% (w/v) paraformaldehyde for 24 h, embedded in paraffin, and sectioned (5 μm). Sections were observed using an optical microscope (Motic China Group Co., Ltd., China). The sections were stained with hematoxylin and eosin (H&E), according to Zhao et al. (2021).

Quantitative Real-time PCR

The colon tissues (100 mg) were homogenized in pre-cold RNA extraction solutions (1 ml), and centrifuged at 12,000 × g at 4°C for 10 min to obtain the total RNA. Reverse transcription was performed using the PrimeScript RT kit (Promega Corporation, USA), and the conditions were 42°C for 60 min then 70°C for 5 min. cDNA was amplified using SYBR Green Real-Time PCR Master Mix Kit (Servicebio Co., Ltd., China).. The amplification procedure was as follows: pre-denaturation (95°C, 10 min), denaturation (95°C, 15 s), and annealing/extension (60°C, 60 s), the dissolution curve (60–95°C, the temperature is increased by 0.3°C every 15 s). Relative fold changes were performed using the 2−ΔΔCt method. The internal reference was GAPDH, and the primers used for qRT-PCR are shown below (Table II).

Table II

Specific gene primers used for qRT-PCR.

GenePrimersLength (bp)
IL-6F: CCCCAATTTCCAATGCTCTCC
R: CGCACTAGGTTTGCCGAGTA
141
IL-10F: TTTAAGGGTTACTTGGGTTGCC
R: AATGCTCCTTGATTTCTGGGC
106
IL-1βF: TCAAATCTCGCAGCAGCACATC
R: CGTCACACACCAGCAGGTTATC
206
GAPDHF: CCTCGTCCCGTAGACAAAATG
R: TGAGGTCAATGAAGGGGTCGT
133

Western blot

The liver tissue (100 mg) was homogenized in pre-chilled RIPA lysis buffer solution (1 ml), and centrifuged at 12,000 × g and 4°C for 10 min to extract total cell lysate. The protein concentration of cell lysate was measured using the BCA protein concentration assay kit (Servicebio Co., Ltd., China). Proteins were separated using 10% SDS-PAGE, transferred to nitrocellulose (PVDF) membranes, then blocked with 5% skim milk for 1 h at room temperature on a shaker. PVDF membranes were incubated with primary antibodies against PI3K and AKT at a 1 : 1000 dilution overnight at 4°C, followed by incubation with secondary antibodies for 30 min at room temperature. Finally, protein bands were visualized by enhanced ECL reagents, using β-actin as an internal control, and quantification of the bands was performed using the Image J program.

UPLC-MS/MS analysis

The cecal contents (50 mg) were vortexed in methanol/water solution (1 : 1 v/v, 1 ml) and centrifuged at 12,000 × g and 4°C for 5 min to collect the supernatant. Then the supernatant (50 μl) was derivatized in 50 μl derivatizing reagent and analyzed with UPLC-MS/MS. UPLC-MS/MS analysis was performed using an Ultra Performance Liquid Chromatography I-Class (Waters Co., Ltd., USA) coupled with a Tandem Mass Spectrometry (Waters Co., Ltd., USA). A 13-min linear gradient flow rate of 0.3 ml/min was used to inject samples into a UPLC RP Column (1.6 μm, 2.1 mm × 100 mm). Eluents A (0.1% formic acid in water) and B (methanol : isopropyl alcohol is 4 : 1) were used for the system. As follows, the solvent gradient: 5% B, 0 min; 5–15% B, 2.0 min; 15–55% B, 9.0 min; 55–100% B, 11.0 min; 100–5% B, 11.1 min; 5% B, 13 min. The Ultra Performance Liquid Chromatography operated with 150°C source temperature, 2.0 kV capillary voltage, 30.0 V cone voltage, 450°C desolvation temperature, 150 l/h cone gas flow, 1000 l/h desolvation gas flow, 0.15 ml/min collision gas flow rate. The collision gas used high-purity argon, and the rest of the gas paths used high-purity nitrogen. The data were analyzed by MassLynx software (Waters Co., Ltd., USA).

Statistical analysis

Data were analyzed with IBM® SPSS® 19.0 (IBM, USA) expressing as mean ± standard deviation. A one-way ANOVA was used to compare means. Statistical significance was determined by a p-value of less than 0.05.

Results

Isolation and identification of isolates from human feces

Twenty-three isolates were obtained from human feces samples and confirmed by 16S rDNA sequencing. The sequences of isolates were uploaded to the NCBI database, and the accession number of all isolates are listed in Table III. The similarity of each isolate is over 99%. Eighteen strains were L. fermentum, and five strains were L. plantarum.

Table III

Identification of Lactobacillaceae isolated based on 16S rDNA sequences and gene accession number assigned by NCBI.

Isolate numberSpeciesGenBank accession numberSimilarity (%)
4Limosilactobacillus fermentumMT48258999.73
5Limosilactobacillus fermentumMT48259099.93
6Limosilactobacillus fermentumMT48259199.93
8Lactiplantibacillus plantarumMT48258699.93
10Lactiplantibacillus plantarumMT48258799.80
11Limosilactobacillus fermentumMT46372499.93
12Limosilactobacillus fermentumMT48259299.93
13Limosilactobacillus fermentumMT48259399.93
14Limosilactobacillus fermentumMT48259499.93
16Limosilactobacillus fermentumMT48259599.93
18Limosilactobacillus fermentumMT48259699.93
20Lactiplantibacillus plantarumMT48258899.93
22Lactiplantibacillus plantarumMT46372699.86
25Lactiplantibacillus plantarumMT46372799.86
26Limosilactobacillus fermentumMT48259799.93
27Limosilactobacillus fermentumMT48259899.93
28Limosilactobacillus fermentumMT48259999.93
29Limosilactobacillus fermentumMT48260099.93
30Limosilactobacillus fermentumMT48260199.93
33Limosilactobacillus fermentumMT48260299.93
38Limosilactobacillus fermentumMT48260399.79
39Limosilactobacillus fermentumMT48260499.86
305Limosilactobacillus fermentumMT46372599.30

Inhibitory activities to α-amylase and α-glucosidase. The inhibitory activities to α-amylase and α-glucosidase of the 23 isolates were determined (Table IV). The α-amylase inhibitory activities of L. plantarum ranged from 17.33 ± 5.03% to 62.29 ± 0.44%; the highest value was observed for L. plantarum 22. The α-amylase inhibitory activities of L. fermentum ranged from 16.84 ± 8.34% to 58.40 ± 1.68%; the highest value was recorded for L. fermentum 11, followed by L. fermentum 305 (57.48 ± 5.04%). The α-glucosidase inhibitory activities of L. plantarum ranged from 11.45 ± 4.18% to 15.32 ± 0.89%; the highest was for L. plantarum 25, followed by L. plantarum 22 (14.89 ± 0.38%). The α-glucosidase inhibitory activities of L. fermentum ranged from 16.84 ± 8.34% to 58.40 ± 1.68%, with the highest value for L. fermentum 11, followed by L. fermentum 305 (57.48 ± 5.04%). Based on the results of the inhibitory activities of the isolates to α-glucosidase and α-amylase, four potential anti-diabetic strains (L. plantarum 22, L. plantarum 25, L. fermentum 11, and L. fermentum 305) were selected due to high inhibitory activities to α-amylase and α-glucosidase. The viable counts of the two isolates of L. plantarum and the two isolates of L. fermentum were 1.22 ± 0.47 × 109 CFU/ml, 1.84 ± 0.70 × 109 CFU/ml, 2.55 ± 0.30 × 109 CFU/ml, and 2.04 ± 0.51 × 109 CFU/ml, respectively.

Table IV

The inhibitory activities to α-amylase and α-glucosidase, and the viable count of the isolates.

IsolateViable bacteria count (109CFU/ml)α-amylase inhibitory activities (%)α-glucosidase inhibitory activities (%)
Lactiplantibacillus plantarum81.71 ± 0.47ab49.93 ± 2.06c12.39 ± 3.05a
102.61 ± 0.38a56.72 ± 8.78ab12.60 ± 3.22a
202.29 ± 0.73ab17.33 ± 5.03d11.45 ± 4.18a
221.22 ± 0.47b62.29 ± 0.44a14.89 ± 0.38a
251.84 ± 0.70ab51.81 ± 3.65bc15.32 ± 0.89a
Limosilactobacillus fermentum42.11 ± 0.64b20.96 ± 4.95f28.51 ± 5.73b
52.15 ± 0.25b16.84 ± 8.34f15.91 ± 0.91d
62.93 ± 0.28ab44.94 ± 3.72c19.33 ± 1.02cd
112.55 ± 0.30b58.40 ± 1.68a52.63 ± 3.07a
120.93 ± 0.66c44.05 ± 4.51c17.98 ± 9.09cd
132.85 ± 0.69ab51.86 ± 4.20b17.60 ± 1.84cd
142.96 ± 0.52ab37.19 ± 7.29d4.93 ± 0.94e
163.92 ± 0.38a32.29 ± 9.59de15.35 ± 8.28d
182.16 ± 0.80b27.35 ± 7.43e15.94 ± 1.38d
262.53 ± 0.98b49.95 ± 6.54bc15.60 ± 2.62d
272.49 ± 0.92b41.39 ± 2.52cd20.83 ± 4.58c
283.59 ± 0.50ab47.92 ± 3.62bc20.53 ± 0.17c
292.23 ± 0.67b46.74 ± 3.31bc4.99 ± 0.56e
302.41 ± 1.43b55.38 ± 0.48ab15.69 ± 1.93d
331.70 ± 0.90bc47.49 ± 2.27bc14.19 ± 2.13d
383.16 ± 0.77ab50.59 ± 3.12bc8.10 ± 4.18e
391.89 ± 0.59bc37.77 ± 8.18d5.24 ± 0.89e
3052.04 ± 0.51bc57.48 ± 5.04ab51.79 ± 1.13e

a–f – means with different superscripts within the same row differ (p < 0.05)

Tolerance to simulated digestion test and adhesion to Caco-2 cell

The survival rate of the four strains is shown in Table V. The survival rate of the strains after the simulated gastrointestinal digestion test were 12.42 ± 2.84%, 9.10 ± 1.12%, 5.86 ± 0.52%, and 8.82 ± 2.50%, respectively. The adhesion rates of L. plan tarum 22 and L. plantarum 25 were 6.94 ± 0.27% and 6.91 ± 0.11%, respectively, while the adhesion rates of L. fermentum 11 and L. fermentum 305 were 6.09 ± 0.39% and 6.37 ± 0.28%, respectively.

Table V

Simulated digestion test and adhesion rates.

IsolateSurvival rate (%)Adhesion rate (%)
Lactiplantibacillus plantarum 2212.42 ± 2.846.94 ± 0.27
Lactiplantibacillus plantarum 259.10 ± 1.126.91 ± 0.11
Limosilactobacillus fermentum 115.86 ± 0.526.09 ± 0.39
Limosilactobacillus fermentum 3058.82 ± 2.506.37 ± 0.28

Inhibitory activities to α-glucosidase and α-amylase of Lactobacillaceae powders

Table VI shows that the optimal condition of α-amylase inhibitory activities was A1B1C1D1 (the optimal concentration of each strain in Lactobacillaceae powders was 1010 CFU/ml). The maximal inhibitory activity to α-amylase was 93.18 ± 1.19%. The effect of the factors in descending order was A > D > B > C. A, B, and D were significant factors, while C was a non-significant factor. L. fermentum strains 11 and 305 and L. plantarum 25 were significant factors, while L. plantarum 22 was a non-significant factor.

Table VI

Orthogonal test of the inhibitory activities to α-amylase of Lactobacillaceae powders.

TrialABCDInhibitory activity (%)
1113270.00
2121182.50
3132338.00
4212171.50
522337.50
6231231.00
7311343.00
8322230.00
9333125.50
K163.5061.5052.1759.83
K236.6740.0046.3343.67
K332.8331.5034.3329.50
R30.6730.0017.8430.33
Optimum technologiesA1B1C1D193.18 ± 1.19
SS0.3340.2940.0960.279
df2222
F10.9699.6373.1569.143
Significance***

R-value is positively correlated with inhibitory activity.

* – means significant factor

As was shown in Table VII, the inhibitory activities to α-glucosidase were most affected by L. fermentum 305, followed by L. fermentum 11, L. plantarum 22, and L. plantarum 25. The optimal conditions of α-glucosidase inhibitory activities were A1B1C1D1, and the maximal inhibitory activities to α-glucosidase was 75.33 ± 2.89%. The effect of the factors in descending order was B > A > C > D. A, B, C, and D were significant factors. The optimal concentration of each strain in Lactobacillaceae powders was 1010 CFU/ml, and each strain was a significant factor.

Table VII

Orthogonal test of Lactobacillaceae powders’ inhibitory activities to α-glucosidase.

TrialABCDInhibitory activity (%)
1113273.57
2121163.28
3132354.32
4212171.93
5223335.05
6231262.74
7311364.79
8322224.18
9333154.39
K163.7270.1063.6063.20
K256.5740.8453.5053.50
K347.7957.1551.3951.39
R15.9429.2612.2211.81
Optimum technologiesA1B1C1D175.33 ± 2.89
SS0.0760.2580.0570.048
df2222
F74.785252.38755.709
Significance****

R-value is positively correlated with inhibitory activity.

* – means significant factor

Effects of the Lactobacillaceae mixture on body weight and fasting blood glucose in mice

The BW of the mice was significantly increased in the M and ML group compared with the N group in week 12, respectively (Fig. 1). Compared to the M group, the BW of the mice decreased slightly in the ML group in week 12. FBG was significantly increased in the M group compared with the N group in week 12. As compared to the M group, the FBG of the mice significantly decreased in the ML group in week 12. During the first four weeks of the treatment, the FBG of the mice in the M group increased and then remained at a higher level. Interestingly, the Lactobacillaceae mixture-treated db/db mice showed ameliorated FBG from weeks 6 to 12 (p < 0.05). In week 12, the ML group displayed an FBG of 22.4% lower than the M group.

Fig 1.

Changes of body weight (a) and fasting blood glucose (FBG) levels (b) in mice. Significant differences exist between values with different letters (p < 0.05).

N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Effects of the Lactobacillaceae mixture on the liver, kidney, pancreas, and colon in mice

In the N group, the liver, kidney, pancreas, and colon structures were well-organized and showed no pathological signs. Compared to the N group, in the M group, the following was observed: 1) many vacuoles, irregularly arranged and disordered cells in the liver (Fig. 2a); 2) degeneration of glomerular and tubular structures and fat accumulation in the kidney (Fig. 2b); 3) islet atrophy and focal necrosis in the pancreas (Fig. 2c); and 4) a thinner intestinal wall, degeneration of structures and decreasion of cells (Fig. 2d). However, the Lactobacillaceae culture revealed favorable influences on the injuries of liver, kidney, pancreas, and colon respectively.

Fig 2.

Morphological alterations in the liver (a), kidney (b), pancreas (c), and colon (d).

N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Effects of the Lactobacillaceae mixture on the expression of inflammatory factors and claudin mRNA in the colon of mice

As shown in Fig. 3, the mRNA expression levels of IL-6 and IL-1β were significantly increased. In contrast, the mRNA expression levels of IL-10 and ZO-1 were significantly decreased in the M group compared with the N group. There was a significant increase in the mRNA expression levels of IL-10 in the ML group compared to the M group, while the mRNA expression levels of IL-1β significantly decreased. Lactobacillaceae isolates slightly increased the mRNA expression levels of ZO-1 but decreased that of IL-6.

Fig 3.

Colon inflammatory factor mRNA expression. Significant differences exist between values with different letters (p < 0.05).

N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Effects of the Lactobacillaceae mixture on the expression of PI3K and AKT in mice

The protein expression levels of PI3K and AKT in the liver are shown in Fig. 4. Compared with the N group, the protein expression levels of PI3K and AKT in the M group were significantly decreased. There was a significant increase in the protein expression levels of AKT in the ML group compared with the M group. In contrast, the protein expression levels of PI3K increased, but not significantly.

Fig 4.

PI3K, AKT protein expression electropherogram, and protein relative expression. Significant differences exist between values with different letters (p < 0.05).

N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Effects of the Lactobacillaceae mixture on the level of SCFAs in mice

The contents of SCFAs in each group are shown in Fig. 5. Acetic acid, propionic acid, and butyric acid contents in the M group were significantly lower than in the N group. There was a significant increase in acetic acid and butyric acid contents in the ML group compared to the M group. however, no significant difference was detected in the contents of propionic acid between the M and ML group.

Fig 5.

SCFAs content of mice in each group. Significant differences exist between values with different letters (p < 0.05).

N – Control group, wt/wt mice; M – model group, db/db mice; ML – Lactobacillaceae-treated group, db/db mice with the Lactobacillaceae mixture intervention

Discussion

Twenty-three isolates were obtained from the adult feces and identified as L. fermentum or L. plantarum by 16S rDNA sequencing. Similarly, L. plantarum and L. fermentum were also isolated from infant feces (Jomehzadeh et al. 2020), similar to our results. Additionally, there are different strains isolated from human feces in other reports. Lacticaseibacillus rhamnosus 4B15 and Lactobacillus gasseri 4M13 were isolated from infant feces; Levilactobacillus brevis 205, Lactobacillus mocusae 226, and Lacticaseibacillus casei 375 were isolated from human feces (Oh et al. 2018; Beglari et al. 2022).

It has been shown that the inhibition of α-amylase can reduce postprandial glucose levels (Saleem et al. 2018). In this study, a similar theory was applied to in vitro antidiabetic. α-Glucosidase is a critical enzyme responsible for converting oligosaccharides and disaccharides into monosaccharides in the gut (Schloesser et al. 2017). L. plantarum isolates 22 and 25, and L. fermentum isolates 11 and 305 were selected from 23 strains of Lactobacillaceae identified by 16S rDNA sequencing in human feces. They were chosen due to their higher in vitro antidiabetic activity. Their inhibitory activities to α-amylase were 62.29 ± 0.44%, 51.81 ± 3.65% and 58.40 ± 1.68%, 57.48 ± 5.04%, respectively. Their inhibitory activities to α-glucosidase were 14.89 ± 0.38%, 15.32 ± 0.89% and 52.63 ± 3.07%, 51.79 ± 1.13%, respectively. Chen et al. (2014) found that inhibitory activity to α-glucosidase of L. rhamnosus Z7 isolated from human feces was about 29.21%. Panwar et al. (2014) reviewed that the amylase and maltase inhibitory rates of Lactobacillaceae strains isolated from infant feces were 19.4–89.4% and 15–76%, respectively. By comparison, the four strains of Lactobacillaceae in our study had excellent inhibitory activity to α-amylase and α-glucosidase. Therefore, these Lactobacillaceae strains were used as the potential strains against diabetes in this study.

Tolerance in the gastrointestinal tract is one of the probiotics’ most important features. The potential probiotics can tolerate the digestive tract environment to improve the physical condition of hosts (Salehizadeh et al. 2020). The survival rate of four of Lactobacillaceae strains after the simulated gastric digestion test ranged from 5.86% to 12.42% in this research. Zhu et al. (2015) indicated that the survival rate of some strains, including Bifidobacteria and Lactobacillaceae, was less than 10% after a sequential simulated gastric digestion test. Belguesmia et al. (2016) showed that the survival rate of some Lactobacillaceae was about 10%. These results were similar to ours. Probiotic strains need to adhere to intestinal epithelium to exert their beneficial effects. It is one of the most important criteria when selecting probiotic strains (Kim et al. 2018). Many scholars have investigated the adhesion of probiotics to Caco-2 cells. Huang et al. (2013) showed that the adhesion rate to Caco-2 cell of some Lactobacillaceae (Ligilactobacillus animalis, L. reuteri, Lactobacillus johnsonii, L. plantarum, Lactobacillus amylovorus, L. acidophilus, L. gasseri, L. casei, L. salivarius, and Latilactobacillus sakei) isolated from pig feces ranged from 2.25% to 20.16%. Ramos et al. (2013) reported that the adhesion rate to Caco-2 cells of some Lactobacillaceae strains were less than 1.8%. In this study, the strains showed a higher adhesion rate to Caco-2 cells ranging from 6.09% to 6.94%. From the results, we conclude that the four Lactobacillaceae strains have the potential to survive in the gastrointestinal environment and multiply in the intestinal tract.

Probiotics in the intestines have synergistic and complementary effects, so the benefits of mixed probiotic strains for humans are believed to be better than single strains (Al-Muzafar and Amin 2017). In this study, the orthogonal tests of the Lactobacillaceae mixture showed that the maximum inhibitory activities to α-amylase and α-glucosidase were 93.18 ± 1.19% and 75.33 ± 2.89%, respectively. Our results showed that the anti-diabetic effect in vitro was significantly improved after the combination of these four strains. It provided a good start for our further experiments.

The presence of hyperglycemia characterizes T2DM. It is crucial to control FBG levels in treating and preventing T2DM. The FBG level was significantly higher in the M group than in the N group in this research. The maximum FBG level in the M group was 33.11 ± 0.89 mmol/l. After 12 weeks of treatment, the FBG level was significantly reduced in the ML group compared with the M group. Similarly, Hsieh et al. (2020) reported that L. salivarius AP-32 and L. reuteri GL-104 improved T2DM by reducing FBG levels. Therefore, our Lactobacillaceae mixture may possess anti-hyperglycemic properties to alleviate the development of T2DM.

The liver is critical for glucose and lipid metabolism. Diabetes can cause liver damage and destroy liver function (Abo El-Nasr et al. 2020). Morphological alterations in the liver verified the severity of liver damage in mice with T2DM, and the Lactobacillaceae mixture significantly diminished liver damage. Hyperglycemia caused by disorders of glucose metabolism can damage the kidneys (Abo El-Nasr et al. 2020). According to the results of kidney morphological changes, it was found that the mice with T2DM had severely damaged kidney structures and had evidence of glomerular atrophies, and our Lactobacillaceae mixture was effective in inhibiting kidney damage. The pancreatic islets, the most important part of the pancreas, can release glucagon and insulin to balance blood glucose levels (Noguchi and Huising 2019). Mice with T2DM had severely damaged pancreatic tissue, and the number of normal islet cells was drastically reduced, adversely affecting glucose metabolism. Interestingly, the number of damaged islet cells in db/db mice treated with our Lactobacillaceae mixture was reduced, and the islet function improved. Lacticaseibacillus paracasei NL41 simultaneously alleviated liver, kidney, and pancreatic cell damage, similar to our results (Zeng et al. 2019).

Gut immunity and inflammation are crucial in metabolic diseases (Zhang et al. 2021). Vemuri et al. (2018) found that human-derived probiotics L. acidophilus DDS-1 and B. animalis ssp. lactis UABla-12 could induce human colon cancer cells to secrete IL-10. In this study, the reduction of the anti-inflammatory factor IL-10 and increase in colonic pro-inflammatory IL-1β in the M group could be significantly attenuated by the intervention of the Lactobacillaceae mixture. It has been proposed that the Lactobacillaceae mixture improved intestinal health in mice with T2DM by alleviating inflammation in the gut.

The PI3K/AKT signaling pathway disorder is associated with high glucose concentrations, which is a critical cause of diabetes (Mohseni et al. 2021). L. paracasei TD062 could relieve glucose homeostasis by elevating AKT's expression to prevent the development of T2DM (Dang et al. 2018). The level of AKT significantly increased in db/db mice after being treated with the Lactobacillaceae mixture, while the level of PI3K increased with no significant difference. Therefore, the Lactobacillaceae mixture could alleviate T2DM by improving the PI3K/AKT signaling pathway.

SCFAs are essential for supporting the structure and performance of epithelial cells (Liu et al. 2018). Meanwhile, SCFAs are beneficial for regulating glucose homeostasis and insulin secretion (Portincasa et al. 2022). Acetic acid can stimulate islet B cells, promote insulin secretion, adjust blood glucose and lipids, and maintain insulin sensitivity (Li et al. 2015). Butyric acid is metabolized by hindgut cells as a significant energy source and is transported to the liver for use in different biosynthetic pathways (Liu et al. 2018). Moreover, SCFAs can regulate the pH of the intestine to prevent harmful bacteria growth (Liu et al. 2018). Li et al. (2016) informed that L. plantarum X1 had the hypoglycemia ability associated with increasing acetic acid and butyric acid content in the feces of diabetic mice. The reduction of acetic acid and butyric acid in the M group could be significantly attenuated by the intervention of the Lactobacillaceae mixture in this work. The Lactobacillaceae mixture may improve the hyperglycemia symptoms of mice with T2DM by increasing the level of SCFAs in the gut.

Conclusions

In conclusion, the Lactobacillaceae mixture including L. plantarum 22, L. plantarum 25, L. fermentum 11, and L. fermentum 305 was isolated from human feces and identified as potential probiotics to improve T2DM. The Lactobacillaceae mixture relieved T2DM by lowering blood glucose, increasing the level of SCFAs, improving the PI3K/AKT signaling pathway, ameliorating secretion of inflammatory factors, and relieving the liver, kidney, pancreas, and colon damage in db/db mice. The Lactobacillaceae mixture could be a reference for developing non-toxic treatment options with hypoglycemic effects without side effects. Further safety assessments are warranted, and clinical trials should be performed in appropriate diabetic patients.

Acknowledgments

This work was supported by the Natural Science Foundation of Beijing Municipality under Grant No. 6173033; Academic Research Projects of Beijing Union University under Grant No. ZK20202307; Sino Canada Health Engineering Research Institute cooperation projects under Grant No. 50304JA1901; Internal Trade Food Science and Technology (Beijing) Co., Ltd. cooperation projects under Grant No. 202116.

Notes

[6] Ethical statement

Animal experiment followed the recommendations of the Animal Welfare Committee of Beijing Union University (Beijing, China). The protocol was approved by the Animal Welfare Committee of Beijing Union University (protocol code: 20200802).

[7] Conflicts of interest Conflict of interest

The authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication.

DOI: https://doi.org/10.33073/pjm-2023-028 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 285 - 297
Submitted on: Apr 4, 2023
Accepted on: Jun 9, 2023
Published on: Sep 20, 2023
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Yueyang Li, Tong Tong, Peifan Li, Yian Peng, Michael Zhang, Jia Liu, Yongxin She, Zuming Li, Yongli Li, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.