Fig. 1

Sequences of the forward and reverse primers of four genes used in Real-time PCR_
| Target gene | Primer sequence (5′ to 3′) | Size (bp) |
|---|---|---|
| GAPDH | Forward: GGGGTCCCAGCTTAGGTTCA | 95 |
| mip | Forward: AAGAAAACCTCTCCCTAGCC | 139 |
| ompA | Forward: GCGGCATTCAACCTCGTT | 85 |
| pmp18D | Forward: TCCACTGGGATGATCACCAATA | 81 |
Wilcoxon signed-rank test analysis of the mip, pmp18D, and ompA genes expression between the pregnant groups in comparison to the nonpregnant groups at each time interval of pregnancy_
| Group | Gene type | Period of pregnancy (days) | p-values |
|---|---|---|---|
| Pregnant group – nonpregnant | mip | 10 | 0.593 |
| Pregnant group – nonpregnant | pmp18D | 10 | 0.109 |
| Pregnant group – nonpregnant | ompA | 10 | 0.285 |