Skip to main content
Have a personal or library account? Click to login
Expression Level of the mip, pmp18D, and ompA Genes in Chlamydia abortus Isolated from Aborted Ewes Cover

Expression Level of the mip, pmp18D, and ompA Genes in Chlamydia abortus Isolated from Aborted Ewes

Open Access
|Mar 2022

Full Article

Introduction

Enzootic abortion of ewes (EAE) induced by Chlamydia abortus is a significant cause of reproductive failures in most sheep-producing countries (Borel et al. 2018). The disease in sheep is characterized by abortion in the later stages of pregnancy, after three months of gestation, when Chlamydiae begin to invade placentomes. The infection causes a diffuse inflammatory response, thrombotic vasculitis, and tissue necrosis.

The birth of a vital lamb may occur, but these lambs usually cannot survive for more than two days (Spičic et al. 2015). Mice have been widely used and considered helpful animal models for C. abortus infections and evaluating new vaccine candidates to reduce economic losses from chlamydial infections (Kerr et al. 2005; Caro et al. 2009). Abortion in experimentally infected mice occurs in the final stages of pregnancy (about day 20), whether C. abortus is inoculated on day seven or day 11 (Rodolakis et al. 1998).

Chlamydia species are obligate intracellular microorganisms that occur in two distinct forms during their lifecycle, switching between an extracellular infectious phase and an intracellular replicative (noninfectious) phase (McClure et al. 2017). Elementary bodies (EBs) are environmentally stable and can infect epithelial cells. Reticulate bodies (RBs) cannot infect cells but are active metabolically and can replicate (Brunham and Rey-Ladino 2005).

Chlamydiae possess a cell wall and are bordered by an outer membrane (OM) and a cytoplasmatic inner membrane (IM) (Elwell et al. 2016). The EB outer membrane contains phospholipids, lipids, lipooligosaccharides (LOS), and proteins, while the cell wall contains a small amount of peptidoglycan (Singh et al. 2020). A part of the Chlamydia cell wall is insoluble in sarkosyl, and this fraction is known as the Chlamydia outer membrane complex (COMC). This complex mainly consists of the polymorphic membrane proteins (pmps), major outer membrane protein (momp), and two cysteine-rich proteins (CRP): EnvA or OmcA and EnvB or OmcB (Stephens and Lammel 2001). Momp is a cysteine-rich protein of about 41.9 kDa (Longbottom et al. 2019) that covers more than half of the EB outer membrane and almost all RB (Hatch and McClarty 1998). Pmps are only present in Chlamydiales and were first detected at the surface of C. abortus S26/3 (Longbottom et al. 1996). Pmps are ordinarily responsible for virulence and immune response avoidance (Tan et al. 2006). Different studies have shown that the macrophage infectivity potentiator (mip) is a solid immunoreactive protein (Forsbach-Birk et al. 2013; Hagemann et al. 2016).

Diagnosis of EAE can be made with DNA- or protein-based assays (Essig and Longbottom 2015). Lately, conventional and real-time PCRs have mainly been used to detect C. abortus in clinical samples. PCR methods are based on amplifying the chlamydial OMP genes ompA, omp1, omp2, the polymorphic membrane gene pmp, genes encoding 16S rRNA and helicase, and the 16S-23S rRNA intergenic interval (Berri et al. 2009). Speedy and dependable diagnostic assays are essential to rapid disease control.

The expression and role of the mip, pmp18D, and ompA genes of C. abortus in abortion in ewes have not been adequately elucidated. Hence, this work aimed to identify and purify C. abortus from ovine abortion samples and characterize three proteins expressed as virulence factors in C. abortus isolated from aborted ewes using RT-qPCR. The studied genes were the macrophage infectivity potentiator (mip, CAB080), major outer membrane protein (momp, CAB048), and polymorphic outer membrane protein (pmp, CAB776). The genes’ expression level was also compared in experimentally infected pregnant and nonpregnant mice with C. abortus.

Experimental

Materials and Methods

Bacterial culture in Vero cell line

C. abortus, isolated from an aborted bovine fetus in Sulaimani province, north Iraq (Arif et al. 2020), was used in this study. Vero cells were also provided as a gift by the Cell Culture Unit at the College of Medicine/Babylon University, Iraq.

Monolayers of Vero cells were grown in 25 ml tissue culture flasks at 2 × 106 cells/ml. Confluent monolayers (70–80%) were achieved 24 hours after incubation at 37°C with 5% CO2 with Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (Labiran 2014). About 25 μl of a frozen stored suspension of an aborted ewe’s placental tissue was thawed in SPG (0.25 M sucrose, 10 mM sodium phosphate, and 5 mM L-glutamic acid) and added to Vero cell cultures. Tissue culture flasks were incubated for one hour at 37°C in a saturated humidity environment and 5% CO2. After incubation, DMEM, supplemented with 10% fetal bovine serum and gentamicin (20 μg/ml), was added, and the tissue culture flasks were incubated again at 37°C for 48–72 hours. After 48 hours, Chlamydia inclusions were large enough to be visualized under an inverted microscope (Campos-Hernández et al. 2014).

Vero cells were harvested two days after infection with C. abortus by high-speed centrifugation (30,000 × g) for 45 minutes. Chlamydiae were released from the intracellular vacuoles by ultra-sonication and centrifuged again at low speed (500 × g for 10 minutes) to separate the bacteria from cell debris (Labiran 2014).

C. abortus cells were stained with Giemsa solution and observed under an inverted microscope at 400 × magnification. The EBs of Chlamydia appeared as small cocci occurring singly and in clusters in the infected cells’ cytoplasm (Arif et al. 2020).

Experimental infection of mice

Thirty-six female and six male albino mice of Mus musculus species, BALB/c strain, were used in the study. The mice, 6–8 weeks old, between 25 and 30 grams, were obtained from the Research Center at the College of Veterinary Medicine/University of Sulaimani. All mice-involving procedures were executed humanely according to the Guide for the Care and Use of Laboratory Animals, and the Ethics Committee at the College of Veterinary Medicine, University of Sulaimani, approved the experimental protocol (Approval number AUP-20/9). The 36 female mice were divided into two equal groups; Group 1 of pregnant mice (clinical case) and Group 2 of nonpregnant mice (control). The mice were injected intraperitoneally with 0.2 ml of the supernatant collected from the isolation of C. abortus in Vero cells (kept at −70°C). The solution contained 1,000 inclusion-forming units (IFU) of C. abortus in 0.9% saline solution, following a previously described method (Livingstone et al. 2009). Injection of C. abortus was conducted after one week of pregnancy in Group 1.

Animal euthanasia and sample collection

The duration of pregnancy was divided into three stages. The first stage was on the 10th day of pregnancy, while stages two and three were after 15 and 20 days. In each stage, six mice were euthanized from each group by intraperitoneal injection of a mixture of xylazine (16 mg/kg) and ketamine (100 mg/kg), followed by cervical dislocation (Schoell et al. 2009).

Following the mice’s euthanasia, the external surface was cleaned and disinfected with 70% ethanol, and the abdomen was opened using aseptic procedures. Fragments were resected from the liver, spleen, lung, kidney, placenta, and fetus. The organ fragments were ground and pooled together. The samples were subjected to RNA extraction using a tissue RNA extraction kit, RT05O (Gene aid, Taiwan). The procedure was conducted following instructions provided by the manufacturer.

RNA quantification and RT-qPCR program

RNA measurement was performed using a Nanodrop, ND-8000 (8-sample spectrophotometer, USA). RNA sample absorbance was measured at 230 nm, 260 nm, and 280 nm.

The primer for the mip gene was previously designed by Forsbach-Birk et al. (2013), the primers of pmp18D and ompA genes were designed by Wheelhouse et al. (2009) (Table I), while the GAPDH primer was designed for this study. Profiling was executed using a real-time PCR-based array and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) transcript as a normalization signal. The AddRT-qPCR SYBR kit (Add Bio, Korea), a single tube real-time one-stepRT-qPCR, was used in this study. Furthermore, q-PCR was undertaken in an IQ5 Multicolor Real-time PCR system (BIO-RAD, USA).

Table I

Sequences of the forward and reverse primers of four genes used in Real-time PCR.

Target genePrimer sequence (5′ to 3′)Size (bp)
GAPDHForward: GGGGTCCCAGCTTAGGTTCA
Reverse: ACGGCCAAATCCGTTCACA
95
mipForward: AAGAAAACCTCTCCCTAGCC
Reverse: CTGAAGGTTTCCCTGATATTG
139
ompAForward: GCGGCATTCAACCTCGTT
Reverse: CCTTGAGTGATGCCTACATTGG
85
pmp18DForward: TCCACTGGGATGATCACCAATA
Reverse: GCATAGAAAGCGTATCGAGAATCAC
81

Optimization of PCR reactions, data analysis, and mRNA expression

Each reaction was run in a final volume of 20 µl containing 500 ng of the RNA, 1 µl (10 pmol) of each primer, and 10 µl SYBR Green PCR Mastermix (Add Bio/Korea). The amplification profile was 50°C for 20 minutes. Then, at 95°C for 10 minutes, denaturation was followed by 40 cycles of 95°C for 30 seconds and 60°C for 30 seconds.

Data analysis and mRNA expression

The RT-qPCR data obtained from the above reaction were analyzed using the comparative CT (2-ΔCT) method, a convenient way to analyze gene expression’s relative changes from real-time quantitative PCR experiments. The Ct values for each gene were first obtained through the RT-qPCR machine used in this study. These values were then imported into a Microsoft Excel file for further calculation and analysis.

The expression levels of mRNAs were normalized to GAPDH. mRNA expression was quantified as ΔCt values for both pregnant and nonpregnant separately, where Ct = threshold cycle and ΔCt = Ct target gene – average Ct of GAPDH. After comparing it with the pooled sample, all mRNAs’ expression levels were measured in standard tissue samples. The ΔΔCt values, which are expressed as ΔCt target gene – ΔCt of the pooled sample, were used to quantify mRNA expression of the pmp18D, ompA, and mip genes in infected pregnant mice compared to infected nonpregnant mice. The equation 2-ΔΔCt was used to calculate the fold change of the gene.

Results

Isolation in cell culture

C. abortus organisms were successfully cultivated into Vero cells monolayer. Giemsa staining showed the Chlamydial inclusions in the cytoplasm of Vero cells after 48 hours of inoculation. The DNA was detectable from the infective Vero cells.

mRNA expression

RT-qPCR data were obtained using the ΔΔ Ct method (fold change mean), normalizing to the reference GAPDH. The effect of different time intervals of pregnancy (10 days, 15 days, and 20 days) was assessed by the relative expression of the mip, pmp18D, and ompA gene transcripts in murine tissues as a fold change mean using the RT-qPCR analysis with normalizing to the reference GAPDH. Abortion occurred only after 20 days of pregnancy, and Fig. 1A–1C indicate apparent differences between the transcriptional levels of the mip, pmp18D, and ompA gene among different time intervals of pregnancy. The RT-qPCR analysis revealed that the mRNA level of mip increased in both the pregnant and nonpregnant groups by 1.9-fold change on day 10 (Fig. 1A, Table II), and there was no statistically significant difference (p = 0.593).

Fig. 1

mRNA expression levels of the ompA, pmp18D, and mip genes as fold change in pregnant and nonpregnant mice tissues at different pregnancy times by RT-qPCR. Data are presented as means of values for six mice (columns) ± SEM (error bars).

Table II

Wilcoxon signed-rank test analysis of the mip, pmp18D, and ompA genes expression between the pregnant groups in comparison to the nonpregnant groups at each time interval of pregnancy.

GroupGene typePeriod of pregnancy (days)p-values
Pregnant group – nonpregnantmip10
15
20
0.593
0.655
0.655
Pregnant group – nonpregnantpmp18D10
15
20
0.109
0.593
0.593
Pregnant group – nonpregnantompA10
15
20
0.285
1.000
0.655

Moreover, the RT-qPCR analysis also revealed an increase in pmp18D mRNA expression level by 1.2 times in the pregnant group on day 20. Compared with the nonpregnant group, which increased on the tenth day by 2.2 folds, the difference was insignificant statistically (Fig. 1B, Table II).

The ompA mRNA level increased in the pregnant group by 1.3-fold on day 15. However, compared with its expression in the nonpregnant group, the difference was insignificant (p = 0.285) (Fig. 1C, Table II).

According to the statistical analyses, there was no statistically significant difference (p-values > 0.05) in the fold change means of these three genes at each sample time point by using Wilcoxon signed-rank test, as shown in Table II. These results imply that different time intervals do not affect the expression of each mip, pmp18D, and ompA in the pregnant group compared to the nonpregnant.

Discussion

Chlamydia isolation from aborted tissues is the standard for definitive diagnosis. Nevertheless, bacterial isolation requires collecting samples in optimal conditions; the samples must be fresh, with little or no contamination, and contain a suitable amount of live and viable microorganisms (Li et al. 2015). Chlamydia cultivation in cell culture is considered the gold standard. However, this lengthy technique is only applicable to certain cultivable strains. Besides, many strains are challenging to grow, and not all labs have the required facilities to grow the microorganism. The odds for diagnosing Chlamydia have considerably increased since the introduction of DNA-based techniques. For example, PCR allows direct identification from clinical samples and species differentiation (Hailat et al. 2018; Saeed et al. 2019).

In this study, the culturing of C. abortus was followed by Giemsa staining, and the DNA of Chlamydia could be detected from the infected Vero cells. The sample was diagnosed as positive for C. abortus after the microscopic examination of Giemsa-stained smears. This outcome implies that C. abortus growth may be related to the number of bacteria in the inoculum or their developmental cycle. Like contamination, storage circumstances, and tissue homogenization, other factors may affect C. abortus elementary bodies’ viability and cause slow growth and appearance in culture (Zhang et al. 2015).

The current study investigated and quantified the expressions of mip, pmp18D, and ompA in C. abortus using RT-qPCR. C. abortus naturally infects ewes, but mice can be infected via parenteral administration, such as the intraperitoneal or intravenous routes (Kerr et al. 2005).

This method has not been adopted in the Kurdistan and Iraq so far. Combining three gene transcriptomes by RT-qPCR detects virulence factors that might show a substantial role in the pathogenesis of C. abortus. Besides, this method may increase the chances of better identifying the abortion mechanisms in sheep caused by Chlamydia and help diagnose disease in the future.

Chlamydia species express a wide range of virulence factors. Some of these factors are presumed to be involved in processes associated with the regulation of host adaptation. Our results revealed that mip mRNA expression increased in both the pregnant and non-pregnant groups at the same gestation period (1st stage, 10th day) without any significant difference between the two groups (p-values > 0.05). The results also showed no measurable increase in mRNA pmp18D expression in the pregnant group at the third stage of gestation (20th day) compared to its nonpregnant group expression. Furthermore, a significant difference between the two groups was not detected (p-values > 0.05). The results showed that the mRNA level of ompA expression increases in the pregnant group at the second stage of gestation (15th day) compared to its nonpregnant group expression. Still, the difference between the two groups was not statistically significant.

Chlamydial pathogens have evolved sophisticated mechanisms to elude lytic damage in the host cell (Fields and Hackstadt 2002). As a survival method and equivocation of elimination, chlamydial virulence-associated factors are integrated into the inclusion membrane (Rockey et al. 2002) or secreted into the host cell cytoplasm (Valdivia 2008), which can modulate the host immune reaction.

This difference in the expression of these genes at different time intervals of pregnancy in mice might be due to various causes, for example, technical reasons, sample size, and criteria for evaluating the result. In addition to the bacteria’s virulence characteristics, the host-mediated immune response’s quality and intensity could be responsible for the host specificity of individual species and strains of Chlamydia (Braukmann et al. 2012).

It cannot be concluded that the mouse model results are similar to sheep since there are substantial differences in the type of placenta and local immune response. However, it is well known that lymphoid cells in sheep endometrial tissues are morphologically and functionally analogous to pregnant mouse uterus’ granulate material gland cells (Chavan et al. 2016). Our results showed that the different time intervals of pregnancy do not affect the expression of mip, pmp18D, and ompA in pregnant mice. Inactivation of the genes is suggested to confirm the hypothesis.

Notes

[1] Contributed by Author contributions

E.A., N.S., and S.R. conceived and designed the experiments; E.A. and H.D. drafted and revised the manuscript; E.A. and P.R. performed the experiments and analyzed the data.

[2] Conflicts of interest Conflict of interest

The authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication.

DOI: https://doi.org/10.33073/pjm-2022-014 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 115 - 121
Submitted on: Nov 4, 2021
Accepted on: Feb 20, 2022
Published on: Mar 30, 2022
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2022 Eman Dhahir Arif, Nahla Mohammad Saeed, Shwan Kamal Rachid, Hiewa Othman Dyary, Peshnyar M.A. Rashid, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.