Skip to main content
Have a personal or library account? Click to login
Red and Blue Light-Emitting Diodes Significantly Improve in vitro Tuberization of Potato (Solanum tuberosum L.) Cover

Red and Blue Light-Emitting Diodes Significantly Improve in vitro Tuberization of Potato (Solanum tuberosum L.)

Open Access
|Jun 2021

Figures & Tables

Figure 1

Influence of various LED light spectra on in vitro tuberization in potato ‘Kufri Jyoti’. Nodal explants were used for the tuberization studies. Early tuber formation was observed through the subapical swelling of the nodal region maintained on MS basal medium under R30B70 combination LED light spectra. Abbreviations: R100 – 100% red; B100 – 100% blue; R30B70 – 30% red and 70% blue; R50B50 – 50% red and 50% blue; R70B30 – 70% red and 30% blue

Figure 2

Analysis of total soluble sugar, starch and the protein content in the microtuber developed under various LED spectra of light. A – total soluble sugar, B – starch content, and C – proteins in tuber tissues of potato. Values are means ± SE of three replicate experiments (n = 3). Bars marked with letters indicate significant differences according to the Tukey HSD test (p < 0.05). Abbreviations: See Figure 1

Figure 3

Expression analysis of CaM1, StCDPK and LOX genes in stolon, initial tuber, and developed tuber tissues of potato. A – expression analysis in the stolon tissues, B – expression analysis in initial tuber, and C – expression analysis in the developed tuber. Data analyzed by the comparative delta Ct method. Bars marked with letters indicate significant differences according to the Tukey HSD test (p < 0.05). Abbreviations: R100 – 100% red; B100 – 100% blue; R30B70 – 30% red and 70% blue; R50B50 – 50% red and 50% blue; R70B30 – 70% red and 30% blue; CaM1 – calmodulin-1; StCDPK – calcium-dependent protein kinase; LOX – lipoxygenase

Figure 4

Lipoxygenase enzyme activity in various tuberizing tissues of potato during in vitro tuberization under various LED light spectra. A – LOX enzyme activity in stolons; B – LOX enzyme activity in initial tubers; C – LOX enzyme activity in developed tubers. Values are mean ± SE of three replicate experiments (n = 3). Bars marked with letters indicate significant differences according to the Tukey HSD test (p < 0.05). Abbreviations: R100 – 100% red; B100 – 100% blue; R30B70 – 30% red and 70% blue; R50B50 – 50% red and 50% blue; R70B30 – 70% red and 30% blue; LOX – lipoxygenase

Figure 5

Line diagram describing possible mechanisms related to light-mediated induction of potato tuberization. LED light and its various combinations may involve alternation of hormonal and cytosolic Ca2+ ions, ultimately leading to an enhanced calcium-signaling pathway and LOX activity to increase tuberization on single nodal potato segments growing in a non-tuber inducing medium. Green and orange arrows show respectively GA and IAA levels at different stages of tuberization; the blue arrow shows the expression pattern of LOX, CaM, and StCDPK. Abbreviations: GA – gibberellic acid; IAA – indole 3 acetic acid; LOX – lipoxygenase; CaM – calmodulin; StCDPKs – calcium-dependent protein kinases; PUFAs – polyunsaturated fatty acids; JA – jasmonic acid; TA – tuberonic acid; TAG – tuberonic acid glucoside; PM – plasma membrane; LED – light-emitting diode

Effect of various spectra of LED lights on in vitro tuberization of potato ‘Kufri Jyoti’

Light treatmentsNumber of explants showing stolons formationDays to stolon induction/formationNumber of stolons converting to the tubersDays to tuber inductionTuber size (mm)Tuber weight (g)Total tuber yield (g)
R100146.55±3.99 b7–891.55±3.34 e18–211.82±0.31 e0.32±0.06 e49.6 ± 1.54 d
B100121.2 ±3.18 d11–13110.2 ±3.15 b17–185.30±0.31 a0.58±0.15 a70.52± 2.69 b
R30 : B70158.5 ±4.38 a8–9143.67±5.37 a12–144.10±0.45 b0.51±0.06 b83.48± 3.50 a
R50 : B50118.2 ±3.15 e11–12102.50±2.33 c18–203.11±0.21 cd0.40±0.12 d46.46± 2.47 d
R70 : B30133.22±3.02 c10–1197.21±3.15 d18–203.4 ±0.36 c0.44±0.07 c57.17± 1.23 c
W100118.55±4.18 e13–1592.20±2.15 e24–263.64±0.21 c0.40±0.17 d46.79± 3.87 d
Dark108.41±5.34 f10–1198.65±2.15 d19–212.87±0.28 d0.34±0.20 e42.79± 1.29 e

List of primers used in the RT-PCR analysis

GeneAccession No.Forward primer 5′-3′Reverse primer 5′-3′
LOXX79107.1AGAGGAGATGGAACTGGAAAGCTCGGTACATAGATGTCTAAGC
StCaM1J04559.1GCTGATCAGAATGGAACCATTGCAATATCTGCCTCTCGGATCAT
StCDPKAF115406.3CTGGTCCGAAAGATGCTCAATCTGCTGAGAGATTCTCAGCA
ACTINX55749.1GAATGGAAGCAGCTGGAATCCTGGTGGTGCAACAACCTTA
DOI: https://doi.org/10.2478/johr-2021-0010 | Journal eISSN: 2353-3978 | Journal ISSN: 2300-5009
Language: English
Page range: 95 - 108
Submitted on: Oct 1, 2020
Accepted on: Apr 1, 2021
Published on: Jun 26, 2021
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year

© 2021 Robin Kumar Pundir, Abhishek Pathak, Devanshi Chandel Upadhyaya, Annamalai Muthusamy, Chandrama Prakash Upadhyaya, published by National Institute of Horticultural Research
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.