Skip to main content
Have a personal or library account? Click to login
Distribution and characterization of the root-knot nematode, Meloidogyne javanica (Treub, 1885) Chitwood, 1949 (Meloidogynidae) isolates, in some regions of two main pistachio growing provinces of Iran Cover

Distribution and characterization of the root-knot nematode, Meloidogyne javanica (Treub, 1885) Chitwood, 1949 (Meloidogynidae) isolates, in some regions of two main pistachio growing provinces of Iran

Open Access
|May 2026

Figures & Tables

Table 1

Geographical distribution information of Meloidogyne spp. in infested and non-infested areas of the sampling regions in two main pistachio growing provinces of Iran (GPS coordination in DMS format)

No.Isolate codeSampling areaNEPistachio rootstockSpecies
1KS1-1Kerman province, Sirjan29°10′44″55°52′29″Baneh M. javanica
2KS1-2Kerman province, Sirjan29°10′44″55°52′22″Baneh M. javanica
3KS1-3Kerman province, Sirjan29°10′49″55°52′49″Kalleghoochi M. javanica
4KS1-4Kerman province, Sirjan29°10′52″55°52′41″BanehNon-infested
5KS1-5Kerman province, Sirjan29°10′28″55°52′03″Fandoghi M. javanica
6KS1-6Kerman province, Sirjan29°10′34″55°52′15″FandoghiNon-infested
7KS1-7Kerman province, Sirjan29°10′52″55°52′42″Baneh M. javanica
8KS1-8Kerman province, Sirjan29°10′46″55°52′22″Baneh (male)Non-infested
9KS1-9Kerman province, Sirjan29°10′52″55°52′41″Baneh M. javanica
10KS1-10Kerman province, Sirjan29°11′12″55°53′20″Ahmad Aghaei M. javanica
11KS2-1Kerman province, Sirjan29°11′17″55°51′02″Ahmad Aghaei M. javanica
12KS2-2Kerman province, Sirjan29°11′18″55°51′10″Kalleghoochi M. javanica
13KR1-1Kerman province, Rafsanjan30°25′17″55°49′41″Fandoghi M. arenaria
14KR2-1Kerman province, Rafsanjan30°25′56.3″56°00′40.9″FandoghiNon-infested
15KR3-1Kerman province, Rafsanjan30°25′51″55°51′50″Fandoghi M. javanica
16KR4-1Kerman province, Rafsanjan30°31′19.6″55°40′42.6″KalleghoochiNon-infested
17KR5-1Kerman province, Rafsanjan30°27′50.4″55°41′01.2″KalleghoochiNon-infested
18KR6-1Kerman province, Rafsanjan30°30′20.0″56°04′11.1″KalleghoochiNon-infested
19KR7-1Kerman province, Rafsanjan30°25′39″55°51′24″Fandoghi M. incognita
20KR8-1Kerman province, Rafsanjan30°22′53″55°50′51″Fandoghi M. javanica
21KR9-1Kerman province, Rafsanjan30°20′11″56°08′49″Kalleghoochi M. javanica
22KR10-1Kerman province, Rafsanjan30°32′13″55°40′29″Kalleghoochi M. javanica
23KR11-1Kerman province, Rafsanjan30°21′20″56°09′28″Kalleghoochi M. incognita
24KR12-1Kerman province, Rafsanjan30°23′49″55°56′56″Fandoghi M. incognita
25KR13-1Kerman province, RafsanjanUnknown M. javanica
26KN1-1Kerman province, Nough (Rafsanjan)30°58′24″55°35′36″Kalleghoochi M. arenaria
27KN2-1Kerman province, Nough (Rafsanjan)30°30′47.3″55°59′02.2″FandoghiNon-infested
28KN3-1Kerman province, Nough (Rafsanjan)30°35′55.5″55°55′44.6″FandoghiNon-infested
29KN4-1Kerman province, Nough (Rafsanjan)30°58′21.6″55°35′47.6″KalleghoochiNon-infested
30KN5-1Kerman province, Nough (Rafsanjan)30°46′03.4″55°50′36.7″KalleghoochiNon-infested
31KN6-1Kerman province, Nough (Rafsanjan)30°31′22.6″55°58′46.2″Ahmad AghaeiNon-infested
32KN7-1Kerman province, Nough (Rafsanjan)30°55′02″55°41′21″Fandoghi M. javanica
33KN8-1Kerman province, Nough (Rafsanjan)31°00′33″55°33′18″Ahmad Aghaei M. incognita
34KN9-1Kerman province, Nough (Rafsanjan)30°57′24″55°37′57″Ahmad Aghaei M. javanica
35KA1-1Kerman province, Anar30°42′49.8″55°28′22.3″KalleghoochiNon-infested
36KA2-1Kerman province, Anar30°46′31.2″55°24′28.1″AkbariNon-infested
37KA3-1Kerman province, Anar30°55′18.0″55°15′55.2″KalleghoochiNon-infested
38KA3-2Kerman province, Anar30°55′21.0″55°16′02.0″AkbariNon-infested
39KA3-3Kerman province, Anar30°55′20.0″55°15′60.0″KalleghoochiNon-infested
40KA4-1Kerman province, Anar30°52′48.9″55°16′33.0″KalleghoochiNon-infested
41KA4-2Kerman province, Anar30°53′02.3″55°16′38.6″AkbariNon-infested
42KSh1-1Kerman province, Shahr-e Babak30°12′52″55°03′32″Akbari M. javanica
43KSh2-1Kerman province, Shahr-e Babak30°10′52″55°03′11″Akbari M. cruciani
44K-R-1-1Kerman province, Ravar31°16′09.5″56°46′44.3″KalleghoochiNon-infested
45K-K-1-1Kerman province, KermanFandoghi M. incognita
46K-Z-1-1Kerman province, ZarandFandoghi M. incognita
47KhF1-1Khorasan Razavi province, Mahvelat34°58′08.0″58°41′03.8″Sefid BadamiNon-infested
48KhF1–2Khorasan Razavi province, Mahvelat34°58′37″58°42′10″Sefid Badami M. arenaria
49KhF1-3Khorasan Razavi province, Mahvelat34°57′14″58°39′28″Sefid Badami M. arenaria
50KhF1-4Khorasan Razavi province, Mahvelat34°57′81″58°41′19″Sefid Badami M. javanica
51KhF2-1Khorasan Razavi province, Mahvelat34°59′89″58°43′12″Sefid Badami M. javanica
52KF3-1Khorasan Razavi province, Mahvelat35°00′02.8″58°35′15.9″Sefid BadamiNon-infested
53KF3-2Khorasan Razavi province, Mahvelat35°00′11″58°35′07″Sefid Badami M. cruciani
54KhF4-1Khorasan Razavi province, Mahvelat35°02′32″58°49′31″Sefid Badami M. javanica
55KhF4-2Khorasan Razavi province, Mahvelat35°02′32″58°49′42″Sefid Badami M. javanica
56KhF4-3Khorasan Razavi province, Mahvelat35°02′30″58°49′06″Sefid Badami M. javanica
57KhF4-4Khorasan Razavi province, Mahvelat35°02′35″58°49′33″Sefid Badami M. javanica
58KhF5-1Khorasan Razavi province, Mahvelat35°01′58″58°47′58″Sefid Badami M. javanica
59KhF5-2Khorasan Razavi province, Mahvelat35°01′56″58°48′01″Sefid Badami M. javanica
60KhSs1-1Khorasan Razavi province, Sarakhs36°03′53.1″61°10′51.4″Ahmad AghaeiNon-infested
61KhSs1-2Khorasan Razavi province, Sarakhs36°03′46.7″61°10′45.4″Ahmad AghaeiNon-infested
62KhSs2-1Khorasan Razavi province, Sarakhs36°04′20.8″61°11′03.4″Ahmad AghaeiNon-infested
63KhSs2-2Khorasan Razavi province, Sarakhs36°04′19.6″61°11′12.9″Ahmad AghaeiNon-infested
64KhKh1-1Khorasan Razavi province, Khooshab36°27′44″57°57′56″Kalleghoochi M. javanica
65KhKh1-2Khorasan Razavi province, Khooshab36°27′48″57°57′50″Kalleghoochi M. javanica
66KhKh1-3Khorasan Razavi province, Khooshab36°27′51″57°57′61″Kalleghoochi M. javanica
67KhKh1-4Khorasan Razavi province, Khooshab36°27′53″57°57′53″Kalleghoochi M. javanica
68KhKh1-5Khorasan Razavi province, Khooshab36°28′18″57°59′24″Sefid Badami M. javanica
69KhS1-1Khorasan Razavi province, Sabzevar36°27′48″57°57′50″Kalleghoochi M. javanica
70KhS1-2Khorasan Razavi province, Sabzevar36°10′54″57°59′50″Ahmad Aghaei M. javanica
71Kh-S-2-1Khorasan Razavi province, SabzevarUnknownNon-infested
72KhB1-1Khorasan Razavi province, BardaskanUnknown M. javanica
73Kh-B-2-1Khorasan Razavi province, BardaskanUnknownNon-infested
74KhKh1-1Khorasan Razavi province, Khalil AbadUnknownNon-infested
75KhR1-1Khorasan Razavi province, Roshtkhar34°41′49.7″59°14′18.4″AkbariNon-infested
76KhR2-1Khorasan Razavi province, Roshtkhar34°42′00.5″59°15′03.5″FandoghiNon-infested
77KhR2-2Khorasan Razavi province, Roshtkhar34°41′55.2″59°15′10.1″KalleghoochiNon-infested
78KhR3-1Khorasan Razavi province, Roshtkhar34°42′33.7″59°15′12.8″FandoghiNon-infested
79Kh-K-1-1Khorasan Razavi province, Kashmar35°19′10.0″58°28′03.9″Baneh-KoohiNon-infested
80Kh-K-2-1Khorasan Razavi province, Kashmar35°20′38.3″58°28′02.0″Baneh-KoohiNon-infested
81KhN1-1Khorasan Razavi province, Neyshabur35°53′41″59°07′46″Ahmad Aghaei M. javanica
82KhN1-2Khorasan Razavi province, Neyshabur35°54′14″59°07′34″Akbari M. javanica
83KhTj1-1Khorasan Razavi province, Torbat-e JamKalleghoochi M. javanica
84KhTj1-2Khorasan Razavi province, Torbat-e JamKalleghoochi M. javanica
Table 2

Primers used for sequencing different loci in the present study

LocusPrimersSequence: 5′–3′Reference
SCARFjavGGTGCGCGATTGAACTGAGCZijlstra et al. (2000)
RjavCAGGCCCTTCAGTGGAACTATAC
SSU rDNA988FCTCAAAGATTAAGCCATGCHolterman et al. (2006)
1912RTTTACGGTCAGAACTAGGG
1813FCTGCGTGAGAGGTGAAAT
2646RGCTACCTTGTTACGACTTTT
COII–16S C2F3GGTCAATGTTCAGAAATTTGTGGPowers and Harris (1993)
1,108TACCTTTGACCAATCACGCT
NADH dehydrogenase subunit 5 (Nad5)NAD5FTATTTTTTGTTTGAGATATATTAGJanssen et al. (2016)
NAD5RCGTGAATCTTGATTTTCCATTTTT
Table 3

Eight isolates of Meloidogyne javanica sequenced in the present study and accession numbers of newly generated sequences

No.Isolate codeProvince/speciesSequenced locusAccession no.
1KS1-1Kerman/M. javanica COII-16S OR619478
2KS1-10Kerman/M. javanica SSU rDNAOR583695
NAD5 OR619481
3KN7-1Kerman/M. javanica NAD5 OR619482
4KR3-1Kerman/M. javanica NAD5 OR619483
5KR8-1Kerman/M. javanica NAD5 OR619484
6KSh1-1Kerman/M. javanica NAD5 OR619485
7KhF1-4Khorasan Razavi/M. javanica SSU rDNAOR583696
COII-16S OR619479
8KhF2-1Khorasan Razavi/M. javanica COII-16S OR619480
Figure 1

Geographical distribution of root-knot nematode species (RKNs) in the infested and non-infested regions in Khorasan Razavi and Kerman (A and B), two major pistachio-producing provinces of Iran. (a) Khorasan Razavi province and (b) Kerman Province. (c and d) Enlarged maps displayed with a DEM background; c: Mahvelat county, d: Cities of Shahre-e Babak, Anar, Rafsanjan. Legends and scale bars are shown.

Figure 2

Light microphotographs of the anterior region of adult females of the studied M. javanica isolates, KhF1-4 (a) and KS1-10 (b). Arrow in b shows the EP (all scale bars = 10 μm).

Figure 3

Light microphotographs of perineal patterns of adult females of studied M. javanica isolates. (a) Isolate KS1-1, (b) Isolate KS1-10, (c) Isolate KR3-1, (d) Isolate KR8-1, (e) Isolate KSh1-1, (f) Isolate KN7-1, (g) Isolate KhF1-4, (h) Isolate KhF2-1 (all scale bars = 10 μm).

Table 4

Morphometrics of females of the studied Meloidogyne javanica isolates in two main pistachio growing provinces of Iran

IsolatesChitwood (1949), Rammah and Hirschmann (1990)
CharacterKS1–1KS1–10KN7–1KR3–1KR8–1KSh1–1KhF1–4KhF2–1Total M. javanica
n 7777777756
Body length854.3 ± 70.2917.1 ± 48.9854.3 ± 147.4885.7 ± 69.2850 ± 75.3714.3 ± 78.1933.6 ± 43.1949.3 ± 49.5869.8 ± 101.4545–800a
(740–950)(830–970)(640–1,050)(800–980)(750–950)(590–820)(850–970)(870–1,020)(590–1,050)
Body width588.6 ± 48.1541.4 ± 38.9412.1 ± 81.5540 ± 49571.4 ± 39.8 (520–630)430 ± 36.6652.1 ± 37.8613.6 ± 30.9543.8 ± 91.0300–545a
(490–630)(480–610)(315–540)(480–600)(380–480)(590–700)(570–650)(315–700)
Stylet16.2 ± 1.716.9 ± 1.017.6 ± 1.316.6 ± 0.615.7 ± 0.616.7 ± 0.618.1 ± 1.218 ± 0.917.0 ± 1.316.0a
(14–18)(16–19)(16–19)(16.0–17.5)(15.0– 16.5)(16.0–17.5)(16.0–19.5)(17–19)(14.0–19.5)
DGO3.7 ± 0.64.7 ± 0.83.8 ± 0.52.9 ± 0.44.9 ± 0.64.8 ± 0.84.6 ± 0.54 ± 0.74.2 ± 0.93.0–4.0a
(3.0–4.5)(4–6)(3.0–4.5)(2.5–3.5)(4.0–5.5)(4–6)(4.0–5.5)(3–5)(2.5–6.0)
EP from anterior end34.6 ± 8.934.4 ± 14.144.6 ± 4.934.3 ± 6.826.1 ± 6.927.8 ± 4.445.6 ± 4.848.9 ± 6.237.0 ± 10.744.8a
(24–43)(23.0–57.5)(37–50)(25–43)(20–37)(23–35)(40–52)(40.5–57.0)(20.0–57.5)
Vulval slit25.7 ± 3.123.3 ± 1.825.1 ± 2.324.9 ± 1.724.6 ± 1.925.2 ± 2.526.2 ± 1.425.5 ± 2.725.1 ± 2.225.4 ± 0.5b (21.5–28.1)
(21.0–29.5)(20–25)(20.5–27)(22–27)(22–27)(22–25)(24–28)(22.0–29.5)(20.0–29.5)
Vulva–anus19.4 ± 3.615.9 ± 1.717.1 ± 2.623.6 ± 1.818.6 ± 2.317.9 ± 1.619.5 ± 1.119 ± 2.118.9 ± 3.0
(16–25)(13–18)(12–20)(20.5–26.0)(14.0 – 20.5)(16–20)(18–21)(16–22)(12–26)
Inter–phasmid distance29.9 ± 3.827.9 ± 6.123.4 ± 4.631.9 ± 5.226.7 ± 2.426.6 ± 4.127.9 ± 3.227.4 ± 3.527.7 ± 4.627.9 ± 0.5b (24.1–34.2)
(23–35)(21–39)(20.5–27.0)(25–39)(14.0–20.5)(21–32)(22–31)(20.5–31.0)(18.5–39.0)

Measurements are in µm and in the form mean value ± SD (range).

aParatypes, Java, Indonesia, Chitwood (1949).

bGeorgia, USA, Rammah and Hirschmann (1990).

Figure 4

Light microphotographs of male M. javanica (isolate KN7-1). (a) Anterior end region, (b) tail region and spicules, (c) Lateral lines in tail region (all scale bars = 10 μm).

Table 5

Morphometrics of males of the four studied Meloidogyne javanica isolates in Kerman province of Iran

CharacterKS1–1KS1–10KN7–1KSh1–1Total 13Chitwood (1949), Rammah and Hirschmann (1990)
n 5332
Body length1,276 ± 96 (1,120–1,350)1,307 ± 51 (1,250–1,350)1,238 ± 114 (1,115–1,340)1,005 ± 148 (900–1,110)1,233 ± 135 (900–1,350)940–1,440a
Body width45 ± 5.0 (40–51)35.3 ± 2.3 (34–38)36.3 ± 1.5 (35–38)35 ± 4.2 (32–38)39.2 ± 5.8 (32–51)43.8 ± 0.6 (37.0–49.4)b
Stylet21.2 ± 1.6 (19–23)22.3 ± 0.6 (22–23)21 ± 2.0 (19–23)20.5 ± 0.7 (20–21)21.3 ± 1.4 (19–23)20–21a
DGO3.8 ± 0.6 (3.0–4.5)2.7 ± 0.6 (2–3)3.7 ± 1.5 (2–5)3.3 ± 0.4 (3.0–3.5)3.4 ± 0.9 (2–5)3a
Median bulb85.6 ± 3.8 (82–92)85.7 ± 1.5 (84–87)103.3 ± 12.6 (90–115)86.5 ± 3.5 (84–89)89.8 ± 9.6 (82–115)
Spicules32.3 ± 2.8 (28.5–35.0)28.3 ± 1.5 (27–30)33.3 ± 3.5 (30–37)29.5 ± 2.1 (29–31)31.2 ± 3.1 (27–37)30.0–31.0a
Gubernaculum7.9 ± 0.4 (7.5–8.5)7.7 ± 0.3 (7.5–8.0)9.5 ± 0.5 (9–10)7.8 ± 0.4 (7.5–8.0)8.2 ± 0.8 (7.5–10.0)8.2 ± 0.2 (7.4–9.4)b

Measurements in µm and in the form mean value ± SD (range).

aParatypes, Java, Indonesia, Chitwood (1949).

bGeorgia, USA, Rammah and Hirschmann (1990).

Figure 5

Light microphotographs of J2s of M. javanica. (a and b) Anterior body region of isolates KhF1-4 and KS1-10, respectively, (c and d) Tail region of isolates KhF1-4 and KS1-10, respectively (all scale bars = 10 μm).

Table 6

Morphometrics of J2s of the studied Meloidogyne javanica isolates in two main pistachio growing provinces of Iran

CharacterIsolates
KS1–1KS1–10KN7–1KR3–1KR8–1KSh1–1KhF1–4KhF2–1Total M. javanica
n 7777777756
Body length446 ± 34443 ± 24454 ± 21427 ± 26441 ± 47427 ± 29414 ± 22446 ± 27437 ± 31340–400a
(420–510)(393–537)(420–485)(395–470)(380–500)(390–475)(385–450)(410–480)(380–537)
Body width14.4 ± 1.115.9 ± 1.213.7 ± 0.815.4 ± 1.116.1 ± 0.813.5 ± 0.914.1 ± 0.614.5 ± 0.714.6 ± 1.215.6 ± 0.1b
(13–16)(14.5–18)(12.5–15)(12.5–16)(15–17)(12.5–14.5)(13.5–15.0)(13.5–15.5)(12.5–18.0)(14.8–16.9)
Stylet11.6 ± 0.813.1 ± 0.911.9 ± 0.812.1 ± 0.811.2 ± 1.0 (10.0–12.5)11.2 ± 0.510.4 ± 0.610.7 ± 0.811.5 ± 1.110a
(10.0–12.5)(12.0–14.5)(11–13)(11–13)(10.5–12.0)(9.5–11.0)(10–12)(9.5–14.5)
DGO3.3 ± 0.63.3 ± 0.73.2 ± 0.83.9 ± 0.93.8 ± 0.63.0 ± 0.53.3 ± 0.43.1 ± 0.63.4 ± 0.74a
(2.5–4.0)(2–4)(2.5–4.5)(3–5)(3.0–4.5)(2.0–3.5)(3–4)(2.5–4.0)(2–5)
Median bulb57.9 ± 4.656.6 ± 3.455.6 ± 2.756.4 ± 3.257.4 ± 3.0 (54–62)56.6 ± 5.256.7 ± 3.758.1 ± 2.556.9 ± 3.5
(52.5–65.0)(52.5–61.5)(51.5–60.0)(53–62)(52–65)(52.5–63.0)(55–61)(51.5–65.0)
EP from anterior end79.7 ± 3.082.9 ± 3.681.6 ± 4.482.9 ± 5.686 ± 4.681.9 ± 5.877.4 ± 4.982.4 ± 6.981.8 ± 5.283.9 ± 0.4b
(75–84)(77.0–86.5)(75–88)(75–90)(79–92)(74–89)(69–85)(75–93)(69–93)(80.8–86.7)
Tail length45.4 ± 4.850.8 ± 8.051.3 ± 5.947.7 ± 6.949.9 ± 5.244.1 ± 4.849.4 ± 5.047.1 ± 4.748.2 ± 5.956.1 ± 0.5b
(38.0–52.5)(35–57)(43.5–57.0)(38–55)(43–56)(36–51)(43–55)(41–54)(35–57)(51.8–60.8)
Hyaline13.4 ± 1.214.5 ± 1.613.9 ± 1.611 ± 0.813.2 ± 1.413.0 ± 0.911.6 ± 1.312.7 ± 1.512.9 ± 1.6
(12–15)(12.5–17.0)(11.5–16.0)(10–12)(11.5–15.0)(12.0–14.5)(10.0–13.5)(11–15)(10–17)

Measurements are in µm and in the form mean value ± SD (range).

aParatypes, Java, Indonesia, Chitwood (1949).

bGeorgia, USA, Rammah and Hirschmann (1990).

Figure 6

Amplification products (∼670 bp) generated from individual females of Iranian isolates of Meloidogyne javanica from two pistachio growing provinces in Iran, using species-specific primer sets (Fjav/Rjav) for M. javanica. M: DNA Ladder, C: Negative control (No DNA template was used), Mc: M. cruciani (non-target species), Mj1-Mj8: M. javanica isolates; Mj1: KS1-1, Mj2: KS1-10, Mj3: KN7-1, Mj4: KR3-1, Mj5: KR8-1, Mj6: KSh1-1, Mj7: KhF1-4, and Mj8: KhF2-1.

Figure 7

Bayesian 50% majority rule consensus tree inferred from SSU rDNA segment of two isolates of Meloidogyne javanica recovered from pistachio orchards of Iran, using the GTR + G + I model. BPP more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Figure 8

Bayesian 50% majority rule consensus tree inferred from mitochondrial COII-16S segment of three isolates of Meloidogyne javanica recovered from pistachio orchards of Iran, using the GTR + G + I model. BPP more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Figure 9

Bayesian 50% majority rule consensus tree inferred from mitochondrial Nad5 segment of five isolates of Meloidogyne javanica recovered from pistachio orchards of Iran, using the GTR + G + I model. BPP more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

DOI: https://doi.org/10.2478/jofnem-2026-0015 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Page range: 189 - 207
Submitted on: Jun 5, 2025
Accepted on: Apr 24, 2026
Published on: May 29, 2026
Published by: Society of Nematologists, Inc.
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2026 Fatemeh Shekari Mahoonaki, Esmat Mahdikhani Moghadam, Mohammad Reza Atighi, Mohammad Zakiaghl, Fatemeh Bazeghi, Majid Pedram, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.