Distribution and characterization of the root-knot nematode, Meloidogyne javanica (Treub, 1885) Chitwood, 1949 (Meloidogynidae) isolates, in some regions of two main pistachio growing provinces of Iran

Fatemeh Shekari Mahoonaki; Esmat Mahdikhani Moghadam; Mohammad Reza Atighi; Mohammad Zakiaghl; Fatemeh Bazeghi; Majid Pedram

doi:10.2478/jofnem-2026-0015

.blurhash-client-img { display: none !important; }

Distribution and characterization of the root-knot nematode, Meloidogyne javanica (Treub, 1885) Chitwood, 1949 (Meloidogynidae) isolates, in some regions of two main pistachio growing provinces of Iran

Journal of Nematology

Volume 58 (2026): Issue 1 (February 2026)

By: Fatemeh Shekari Mahoonaki, Esmat Mahdikhani Moghadam, Mohammad Reza Atighi, Mohammad Zakiaghl, Fatemeh Bazeghi and Majid Pedram

Open Access

|May 2026

Figures & Tables

Geographical distribution of root-knot nematode species (RKNs) in the infested and non-infested regions in Khorasan Razavi and Kerman (A and B), two major pistachio-producing provinces of Iran. (a) Khorasan Razavi province and (b) Kerman Province. (c and d) Enlarged maps displayed with a DEM background; c: Mahvelat county, d: Cities of Shahre-e Babak, Anar, Rafsanjan. Legends and scale bars are shown.

Light microphotographs of the anterior region of adult females of the studied M. javanica isolates, KhF1-4 (a) and KS1-10 (b). Arrow in b shows the EP (all scale bars = 10 μm).

Light microphotographs of perineal patterns of adult females of studied M. javanica isolates. (a) Isolate KS1-1, (b) Isolate KS1-10, (c) Isolate KR3-1, (d) Isolate KR8-1, (e) Isolate KSh1-1, (f) Isolate KN7-1, (g) Isolate KhF1-4, (h) Isolate KhF2-1 (all scale bars = 10 μm).

Light microphotographs of male M. javanica (isolate KN7-1). (a) Anterior end region, (b) tail region and spicules, (c) Lateral lines in tail region (all scale bars = 10 μm).

Light microphotographs of J2s of M. javanica. (a and b) Anterior body region of isolates KhF1-4 and KS1-10, respectively, (c and d) Tail region of isolates KhF1-4 and KS1-10, respectively (all scale bars = 10 μm).

Amplification products (∼670 bp) generated from individual females of Iranian isolates of Meloidogyne javanica from two pistachio growing provinces in Iran, using species-specific primer sets (Fjav/Rjav) for M. javanica. M: DNA Ladder, C: Negative control (No DNA template was used), Mc: M. cruciani (non-target species), Mj1-Mj8: M. javanica isolates; Mj1: KS1-1, Mj2: KS1-10, Mj3: KN7-1, Mj4: KR3-1, Mj5: KR8-1, Mj6: KSh1-1, Mj7: KhF1-4, and Mj8: KhF2-1.

Bayesian 50% majority rule consensus tree inferred from SSU rDNA segment of two isolates of Meloidogyne javanica recovered from pistachio orchards of Iran, using the GTR + G + I model. BPP more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Bayesian 50% majority rule consensus tree inferred from mitochondrial COII-16S segment of three isolates of Meloidogyne javanica recovered from pistachio orchards of Iran, using the GTR + G + I model. BPP more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Bayesian 50% majority rule consensus tree inferred from mitochondrial Nad5 segment of five isolates of Meloidogyne javanica recovered from pistachio orchards of Iran, using the GTR + G + I model. BPP more than 50% are given for appropriate clades. Newly generated sequences are in bold font.

Morphometrics of females of the studied Meloidogyne javanica isolates in two main pistachio growing provinces of Iran

	Isolates									Chitwood (1949), Rammah and Hirschmann (1990)
Character	KS1–1	KS1–10	KN7–1	KR3–1	KR8–1	KSh1–1	KhF1–4	KhF2–1	Total	M. javanica
n	7	7	7	7	7	7	7	7	56	M. javanica
Body length	854.3 ± 70.2	917.1 ± 48.9	854.3 ± 147.4	885.7 ± 69.2	850 ± 75.3	714.3 ± 78.1	933.6 ± 43.1	949.3 ± 49.5	869.8 ± 101.4	545–800^a
Body length	(740–950)	(830–970)	(640–1,050)	(800–980)	(750–950)	(590–820)	(850–970)	(870–1,020)	(590–1,050)	545–800^a
Body width	588.6 ± 48.1	541.4 ± 38.9	412.1 ± 81.5	540 ± 49	571.4 ± 39.8 (520–630)	430 ± 36.6	652.1 ± 37.8	613.6 ± 30.9	543.8 ± 91.0	300–545^a
Body width	(490–630)	(480–610)	(315–540)	(480–600)	571.4 ± 39.8 (520–630)	(380–480)	(590–700)	(570–650)	(315–700)	300–545^a
Stylet	16.2 ± 1.7	16.9 ± 1.0	17.6 ± 1.3	16.6 ± 0.6	15.7 ± 0.6	16.7 ± 0.6	18.1 ± 1.2	18 ± 0.9	17.0 ± 1.3	16.0^a
Stylet	(14–18)	(16–19)	(16–19)	(16.0–17.5)	(15.0– 16.5)	(16.0–17.5)	(16.0–19.5)	(17–19)	(14.0–19.5)	16.0^a
DGO	3.7 ± 0.6	4.7 ± 0.8	3.8 ± 0.5	2.9 ± 0.4	4.9 ± 0.6	4.8 ± 0.8	4.6 ± 0.5	4 ± 0.7	4.2 ± 0.9	3.0–4.0^a
DGO	(3.0–4.5)	(4–6)	(3.0–4.5)	(2.5–3.5)	(4.0–5.5)	(4–6)	(4.0–5.5)	(3–5)	(2.5–6.0)	3.0–4.0^a
EP from anterior end	34.6 ± 8.9	34.4 ± 14.1	44.6 ± 4.9	34.3 ± 6.8	26.1 ± 6.9	27.8 ± 4.4	45.6 ± 4.8	48.9 ± 6.2	37.0 ± 10.7	44.8^a
EP from anterior end	(24–43)	(23.0–57.5)	(37–50)	(25–43)	(20–37)	(23–35)	(40–52)	(40.5–57.0)	(20.0–57.5)	44.8^a
Vulval slit	25.7 ± 3.1	23.3 ± 1.8	25.1 ± 2.3	24.9 ± 1.7	24.6 ± 1.9	25.2 ± 2.5	26.2 ± 1.4	25.5 ± 2.7	25.1 ± 2.2	25.4 ± 0.5^b (21.5–28.1)
Vulval slit	(21.0–29.5)	(20–25)	(20.5–27)	(22–27)	(22–27)	(22–25)	(24–28)	(22.0–29.5)	(20.0–29.5)	25.4 ± 0.5^b (21.5–28.1)
Vulva–anus	19.4 ± 3.6	15.9 ± 1.7	17.1 ± 2.6	23.6 ± 1.8	18.6 ± 2.3	17.9 ± 1.6	19.5 ± 1.1	19 ± 2.1	18.9 ± 3.0	—
Vulva–anus	(16–25)	(13–18)	(12–20)	(20.5–26.0)	(14.0 – 20.5)	(16–20)	(18–21)	(16–22)	(12–26)	—
Inter–phasmid distance	29.9 ± 3.8	27.9 ± 6.1	23.4 ± 4.6	31.9 ± 5.2	26.7 ± 2.4	26.6 ± 4.1	27.9 ± 3.2	27.4 ± 3.5	27.7 ± 4.6	27.9 ± 0.5^b (24.1–34.2)
Inter–phasmid distance	(23–35)	(21–39)	(20.5–27.0)	(25–39)	(14.0–20.5)	(21–32)	(22–31)	(20.5–31.0)	(18.5–39.0)	27.9 ± 0.5^b (24.1–34.2)

Morphometrics of males of the four studied Meloidogyne javanica isolates in Kerman province of Iran

Character	KS1–1	KS1–10	KN7–1	KSh1–1	Total 13	Chitwood (1949), Rammah and Hirschmann (1990)
n	5	3	3	2	Total 13	Chitwood (1949), Rammah and Hirschmann (1990)
Body length	1,276 ± 96 (1,120–1,350)	1,307 ± 51 (1,250–1,350)	1,238 ± 114 (1,115–1,340)	1,005 ± 148 (900–1,110)	1,233 ± 135 (900–1,350)	940–1,440^a
Body width	45 ± 5.0 (40–51)	35.3 ± 2.3 (34–38)	36.3 ± 1.5 (35–38)	35 ± 4.2 (32–38)	39.2 ± 5.8 (32–51)	43.8 ± 0.6 (37.0–49.4)^b
Stylet	21.2 ± 1.6 (19–23)	22.3 ± 0.6 (22–23)	21 ± 2.0 (19–23)	20.5 ± 0.7 (20–21)	21.3 ± 1.4 (19–23)	20–21^a
DGO	3.8 ± 0.6 (3.0–4.5)	2.7 ± 0.6 (2–3)	3.7 ± 1.5 (2–5)	3.3 ± 0.4 (3.0–3.5)	3.4 ± 0.9 (2–5)	3^a
Median bulb	85.6 ± 3.8 (82–92)	85.7 ± 1.5 (84–87)	103.3 ± 12.6 (90–115)	86.5 ± 3.5 (84–89)	89.8 ± 9.6 (82–115)	—
Spicules	32.3 ± 2.8 (28.5–35.0)	28.3 ± 1.5 (27–30)	33.3 ± 3.5 (30–37)	29.5 ± 2.1 (29–31)	31.2 ± 3.1 (27–37)	30.0–31.0^a
Gubernaculum	7.9 ± 0.4 (7.5–8.5)	7.7 ± 0.3 (7.5–8.0)	9.5 ± 0.5 (9–10)	7.8 ± 0.4 (7.5–8.0)	8.2 ± 0.8 (7.5–10.0)	8.2 ± 0.2 (7.4–9.4)^b

Geographical distribution information of Meloidogyne spp_ in infested and non-infested areas of the sampling regions in two main pistachio growing provinces of Iran (GPS coordination in DMS format)

No.	Isolate code	Sampling area	N	E	Pistachio rootstock	Species
1	KS1-1	Kerman province, Sirjan	29°10′44″	55°52′29″	Baneh	M. javanica
2	KS1-2	Kerman province, Sirjan	29°10′44″	55°52′22″	Baneh	M. javanica
3	KS1-3	Kerman province, Sirjan	29°10′49″	55°52′49″	Kalleghoochi	M. javanica
4	KS1-4	Kerman province, Sirjan	29°10′52″	55°52′41″	Baneh	Non-infested
5	KS1-5	Kerman province, Sirjan	29°10′28″	55°52′03″	Fandoghi	M. javanica
6	KS1-6	Kerman province, Sirjan	29°10′34″	55°52′15″	Fandoghi	Non-infested
7	KS1-7	Kerman province, Sirjan	29°10′52″	55°52′42″	Baneh	M. javanica
8	KS1-8	Kerman province, Sirjan	29°10′46″	55°52′22″	Baneh (male)	Non-infested
9	KS1-9	Kerman province, Sirjan	29°10′52″	55°52′41″	Baneh	M. javanica
10	KS1-10	Kerman province, Sirjan	29°11′12″	55°53′20″	Ahmad Aghaei	M. javanica
11	KS2-1	Kerman province, Sirjan	29°11′17″	55°51′02″	Ahmad Aghaei	M. javanica
12	KS2-2	Kerman province, Sirjan	29°11′18″	55°51′10″	Kalleghoochi	M. javanica
13	KR1-1	Kerman province, Rafsanjan	30°25′17″	55°49′41″	Fandoghi	M. arenaria
14	KR2-1	Kerman province, Rafsanjan	30°25′56.3″	56°00′40.9″	Fandoghi	Non-infested
15	KR3-1	Kerman province, Rafsanjan	30°25′51″	55°51′50″	Fandoghi	M. javanica
16	KR4-1	Kerman province, Rafsanjan	30°31′19.6″	55°40′42.6″	Kalleghoochi	Non-infested
17	KR5-1	Kerman province, Rafsanjan	30°27′50.4″	55°41′01.2″	Kalleghoochi	Non-infested
18	KR6-1	Kerman province, Rafsanjan	30°30′20.0″	56°04′11.1″	Kalleghoochi	Non-infested
19	KR7-1	Kerman province, Rafsanjan	30°25′39″	55°51′24″	Fandoghi	M. incognita
20	KR8-1	Kerman province, Rafsanjan	30°22′53″	55°50′51″	Fandoghi	M. javanica
21	KR9-1	Kerman province, Rafsanjan	30°20′11″	56°08′49″	Kalleghoochi	M. javanica
22	KR10-1	Kerman province, Rafsanjan	30°32′13″	55°40′29″	Kalleghoochi	M. javanica
23	KR11-1	Kerman province, Rafsanjan	30°21′20″	56°09′28″	Kalleghoochi	M. incognita
24	KR12-1	Kerman province, Rafsanjan	30°23′49″	55°56′56″	Fandoghi	M. incognita
25	KR13-1	Kerman province, Rafsanjan	—	—	Unknown	M. javanica
26	KN1-1	Kerman province, Nough (Rafsanjan)	30°58′24″	55°35′36″	Kalleghoochi	M. arenaria
27	KN2-1	Kerman province, Nough (Rafsanjan)	30°30′47.3″	55°59′02.2″	Fandoghi	Non-infested
28	KN3-1	Kerman province, Nough (Rafsanjan)	30°35′55.5″	55°55′44.6″	Fandoghi	Non-infested
29	KN4-1	Kerman province, Nough (Rafsanjan)	30°58′21.6″	55°35′47.6″	Kalleghoochi	Non-infested
30	KN5-1	Kerman province, Nough (Rafsanjan)	30°46′03.4″	55°50′36.7″	Kalleghoochi	Non-infested
31	KN6-1	Kerman province, Nough (Rafsanjan)	30°31′22.6″	55°58′46.2″	Ahmad Aghaei	Non-infested
32	KN7-1	Kerman province, Nough (Rafsanjan)	30°55′02″	55°41′21″	Fandoghi	M. javanica
33	KN8-1	Kerman province, Nough (Rafsanjan)	31°00′33″	55°33′18″	Ahmad Aghaei	M. incognita
34	KN9-1	Kerman province, Nough (Rafsanjan)	30°57′24″	55°37′57″	Ahmad Aghaei	M. javanica
35	KA1-1	Kerman province, Anar	30°42′49.8″	55°28′22.3″	Kalleghoochi	Non-infested
36	KA2-1	Kerman province, Anar	30°46′31.2″	55°24′28.1″	Akbari	Non-infested
37	KA3-1	Kerman province, Anar	30°55′18.0″	55°15′55.2″	Kalleghoochi	Non-infested
38	KA3-2	Kerman province, Anar	30°55′21.0″	55°16′02.0″	Akbari	Non-infested
39	KA3-3	Kerman province, Anar	30°55′20.0″	55°15′60.0″	Kalleghoochi	Non-infested
40	KA4-1	Kerman province, Anar	30°52′48.9″	55°16′33.0″	Kalleghoochi	Non-infested
41	KA4-2	Kerman province, Anar	30°53′02.3″	55°16′38.6″	Akbari	Non-infested
42	KSh1-1	Kerman province, Shahr-e Babak	30°12′52″	55°03′32″	Akbari	M. javanica
43	KSh2-1	Kerman province, Shahr-e Babak	30°10′52″	55°03′11″	Akbari	M. cruciani
44	K-R-1-1	Kerman province, Ravar	31°16′09.5″	56°46′44.3″	Kalleghoochi	Non-infested
45	K-K-1-1	Kerman province, Kerman	—	—	Fandoghi	M. incognita
46	K-Z-1-1	Kerman province, Zarand	—	—	Fandoghi	M. incognita
47	KhF1-1	Khorasan Razavi province, Mahvelat	34°58′08.0″	58°41′03.8″	Sefid Badami	Non-infested
48	KhF1–2	Khorasan Razavi province, Mahvelat	34°58′37″	58°42′10″	Sefid Badami	M. arenaria
49	KhF1-3	Khorasan Razavi province, Mahvelat	34°57′14″	58°39′28″	Sefid Badami	M. arenaria
50	KhF1-4	Khorasan Razavi province, Mahvelat	34°57′81″	58°41′19″	Sefid Badami	M. javanica
51	KhF2-1	Khorasan Razavi province, Mahvelat	34°59′89″	58°43′12″	Sefid Badami	M. javanica
52	KF3-1	Khorasan Razavi province, Mahvelat	35°00′02.8″	58°35′15.9″	Sefid Badami	Non-infested
53	KF3-2	Khorasan Razavi province, Mahvelat	35°00′11″	58°35′07″	Sefid Badami	M. cruciani
54	KhF4-1	Khorasan Razavi province, Mahvelat	35°02′32″	58°49′31″	Sefid Badami	M. javanica
55	KhF4-2	Khorasan Razavi province, Mahvelat	35°02′32″	58°49′42″	Sefid Badami	M. javanica
56	KhF4-3	Khorasan Razavi province, Mahvelat	35°02′30″	58°49′06″	Sefid Badami	M. javanica
57	KhF4-4	Khorasan Razavi province, Mahvelat	35°02′35″	58°49′33″	Sefid Badami	M. javanica
58	KhF5-1	Khorasan Razavi province, Mahvelat	35°01′58″	58°47′58″	Sefid Badami	M. javanica
59	KhF5-2	Khorasan Razavi province, Mahvelat	35°01′56″	58°48′01″	Sefid Badami	M. javanica
60	KhSs1-1	Khorasan Razavi province, Sarakhs	36°03′53.1″	61°10′51.4″	Ahmad Aghaei	Non-infested
61	KhSs1-2	Khorasan Razavi province, Sarakhs	36°03′46.7″	61°10′45.4″	Ahmad Aghaei	Non-infested
62	KhSs2-1	Khorasan Razavi province, Sarakhs	36°04′20.8″	61°11′03.4″	Ahmad Aghaei	Non-infested
63	KhSs2-2	Khorasan Razavi province, Sarakhs	36°04′19.6″	61°11′12.9″	Ahmad Aghaei	Non-infested
64	KhKh1-1	Khorasan Razavi province, Khooshab	36°27′44″	57°57′56″	Kalleghoochi	M. javanica
65	KhKh1-2	Khorasan Razavi province, Khooshab	36°27′48″	57°57′50″	Kalleghoochi	M. javanica
66	KhKh1-3	Khorasan Razavi province, Khooshab	36°27′51″	57°57′61″	Kalleghoochi	M. javanica
67	KhKh1-4	Khorasan Razavi province, Khooshab	36°27′53″	57°57′53″	Kalleghoochi	M. javanica
68	KhKh1-5	Khorasan Razavi province, Khooshab	36°28′18″	57°59′24″	Sefid Badami	M. javanica
69	KhS1-1	Khorasan Razavi province, Sabzevar	36°27′48″	57°57′50″	Kalleghoochi	M. javanica
70	KhS1-2	Khorasan Razavi province, Sabzevar	36°10′54″	57°59′50″	Ahmad Aghaei	M. javanica
71	Kh-S-2-1	Khorasan Razavi province, Sabzevar	—	—	Unknown	Non-infested
72	KhB1-1	Khorasan Razavi province, Bardaskan	—	—	Unknown	M. javanica
73	Kh-B-2-1	Khorasan Razavi province, Bardaskan	—	—	Unknown	Non-infested
74	KhKh1-1	Khorasan Razavi province, Khalil Abad	—	—	Unknown	Non-infested
75	KhR1-1	Khorasan Razavi province, Roshtkhar	34°41′49.7″	59°14′18.4″	Akbari	Non-infested
76	KhR2-1	Khorasan Razavi province, Roshtkhar	34°42′00.5″	59°15′03.5″	Fandoghi	Non-infested
77	KhR2-2	Khorasan Razavi province, Roshtkhar	34°41′55.2″	59°15′10.1″	Kalleghoochi	Non-infested
78	KhR3-1	Khorasan Razavi province, Roshtkhar	34°42′33.7″	59°15′12.8″	Fandoghi	Non-infested
79	Kh-K-1-1	Khorasan Razavi province, Kashmar	35°19′10.0″	58°28′03.9″	Baneh-Koohi	Non-infested
80	Kh-K-2-1	Khorasan Razavi province, Kashmar	35°20′38.3″	58°28′02.0″	Baneh-Koohi	Non-infested
81	KhN1-1	Khorasan Razavi province, Neyshabur	35°53′41″	59°07′46″	Ahmad Aghaei	M. javanica
82	KhN1-2	Khorasan Razavi province, Neyshabur	35°54′14″	59°07′34″	Akbari	M. javanica
83	KhTj1-1	Khorasan Razavi province, Torbat-e Jam	—	—	Kalleghoochi	M. javanica
84	KhTj1-2	Khorasan Razavi province, Torbat-e Jam	—	—	Kalleghoochi	M. javanica

Primers used for sequencing different loci in the present study

Locus	Primers	Sequence: 5′–3′	Reference
SCAR	Fjav	GGTGCGCGATTGAACTGAGC	Zijlstra et al. (2000)
SCAR	Rjav	CAGGCCCTTCAGTGGAACTATAC	Zijlstra et al. (2000)
SSU rDNA	988F	CTCAAAGATTAAGCCATGC	Holterman et al. (2006)
	1912R	TTTACGGTCAGAACTAGGG
	1813F	CTGCGTGAGAGGTGAAAT
	2646R	GCTACCTTGTTACGACTTTT
COII–16S	C2F3	GGTCAATGTTCAGAAATTTGTGG	Powers and Harris (1993)
COII–16S	1,108	TACCTTTGACCAATCACGCT	Powers and Harris (1993)
NADH dehydrogenase subunit 5 (Nad5)	NAD5F	TATTTTTTGTTTGAGATATATTAG	Janssen et al. (2016)
NADH dehydrogenase subunit 5 (Nad5)	NAD5R	CGTGAATCTTGATTTTCCATTTTT	Janssen et al. (2016)

Morphometrics of J2s of the studied Meloidogyne javanica isolates in two main pistachio growing provinces of Iran

Character	Isolates
Character	KS1–1	KS1–10	KN7–1	KR3–1	KR8–1	KSh1–1	KhF1–4	KhF2–1	Total	M. javanica
n	7	7	7	7	7	7	7	7	56	M. javanica
Body length	446 ± 34	443 ± 24	454 ± 21	427 ± 26	441 ± 47	427 ± 29	414 ± 22	446 ± 27	437 ± 31	340–400^a
Body length	(420–510)	(393–537)	(420–485)	(395–470)	(380–500)	(390–475)	(385–450)	(410–480)	(380–537)	340–400^a
Body width	14.4 ± 1.1	15.9 ± 1.2	13.7 ± 0.8	15.4 ± 1.1	16.1 ± 0.8	13.5 ± 0.9	14.1 ± 0.6	14.5 ± 0.7	14.6 ± 1.2	15.6 ± 0.1^b
Body width	(13–16)	(14.5–18)	(12.5–15)	(12.5–16)	(15–17)	(12.5–14.5)	(13.5–15.0)	(13.5–15.5)	(12.5–18.0)	(14.8–16.9)
Stylet	11.6 ± 0.8	13.1 ± 0.9	11.9 ± 0.8	12.1 ± 0.8	11.2 ± 1.0 (10.0–12.5)	11.2 ± 0.5	10.4 ± 0.6	10.7 ± 0.8	11.5 ± 1.1	10^a
Stylet	(10.0–12.5)	(12.0–14.5)	(11–13)	(11–13)	11.2 ± 1.0 (10.0–12.5)	(10.5–12.0)	(9.5–11.0)	(10–12)	(9.5–14.5)	10^a
DGO	3.3 ± 0.6	3.3 ± 0.7	3.2 ± 0.8	3.9 ± 0.9	3.8 ± 0.6	3.0 ± 0.5	3.3 ± 0.4	3.1 ± 0.6	3.4 ± 0.7	4^a
DGO	(2.5–4.0)	(2–4)	(2.5–4.5)	(3–5)	(3.0–4.5)	(2.0–3.5)	(3–4)	(2.5–4.0)	(2–5)	4^a
Median bulb	57.9 ± 4.6	56.6 ± 3.4	55.6 ± 2.7	56.4 ± 3.2	57.4 ± 3.0 (54–62)	56.6 ± 5.2	56.7 ± 3.7	58.1 ± 2.5	56.9 ± 3.5	—
Median bulb	(52.5–65.0)	(52.5–61.5)	(51.5–60.0)	(53–62)	57.4 ± 3.0 (54–62)	(52–65)	(52.5–63.0)	(55–61)	(51.5–65.0)	—
EP from anterior end	79.7 ± 3.0	82.9 ± 3.6	81.6 ± 4.4	82.9 ± 5.6	86 ± 4.6	81.9 ± 5.8	77.4 ± 4.9	82.4 ± 6.9	81.8 ± 5.2	83.9 ± 0.4^b
EP from anterior end	(75–84)	(77.0–86.5)	(75–88)	(75–90)	(79–92)	(74–89)	(69–85)	(75–93)	(69–93)	(80.8–86.7)
Tail length	45.4 ± 4.8	50.8 ± 8.0	51.3 ± 5.9	47.7 ± 6.9	49.9 ± 5.2	44.1 ± 4.8	49.4 ± 5.0	47.1 ± 4.7	48.2 ± 5.9	56.1 ± 0.5^b
Tail length	(38.0–52.5)	(35–57)	(43.5–57.0)	(38–55)	(43–56)	(36–51)	(43–55)	(41–54)	(35–57)	(51.8–60.8)
Hyaline	13.4 ± 1.2	14.5 ± 1.6	13.9 ± 1.6	11 ± 0.8	13.2 ± 1.4	13.0 ± 0.9	11.6 ± 1.3	12.7 ± 1.5	12.9 ± 1.6	—
Hyaline	(12–15)	(12.5–17.0)	(11.5–16.0)	(10–12)	(11.5–15.0)	(12.0–14.5)	(10.0–13.5)	(11–15)	(10–17)	—

Eight isolates of Meloidogyne javanica sequenced in the present study and accession numbers of newly generated sequences

No.	Isolate code	Province/species	Sequenced locus	Accession no.
1	KS1-1	Kerman/M. javanica	COII-16S	OR619478
2	KS1-10	Kerman/M. javanica	SSU rDNA	OR583695
2	KS1-10	Kerman/M. javanica	NAD5	OR619481
3	KN7-1	Kerman/M. javanica	NAD5	OR619482
4	KR3-1	Kerman/M. javanica	NAD5	OR619483
5	KR8-1	Kerman/M. javanica	NAD5	OR619484
6	KSh1-1	Kerman/M. javanica	NAD5	OR619485
7	KhF1-4	Khorasan Razavi/M. javanica	SSU rDNA	OR583696
7	KhF1-4	Khorasan Razavi/M. javanica	COII-16S	OR619479
8	KhF2-1	Khorasan Razavi/M. javanica	COII-16S	OR619480

References

Authors

Metrics

Articles in this issue

DOI: https://doi.org/10.2478/jofnem-2026-0015 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X

Journal RSS Feed

Language: English

Page range: 189 - 207

Submitted on: Jun 5, 2025

Accepted on: Apr 24, 2026

Published on: May 29, 2026

Published by: Society of Nematologists, Inc.

In partnership with: Paradigm Publishing Services

Publication frequency: 1 issue per year

Keywords:

Kerman,

RKNs,

Related subjects:

© 2026 Fatemeh Shekari Mahoonaki, Esmat Mahdikhani Moghadam, Mohammad Reza Atighi, Mohammad Zakiaghl, Fatemeh Bazeghi, Majid Pedram, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Volume 58 (2026): Issue 1 (February 2026)

Distribution and characterization of the root-knot nematode, Meloidogyne javanica (Treub, 1885) Chitwood, 1949 (Meloidogynidae) isolates, in some regions of two main pistachio growing provinces of Iran

Figures & Tables

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Morphometrics of females of the studied Meloidogyne javanica isolates in two main pistachio growing provinces of Iran

Morphometrics of males of the four studied Meloidogyne javanica isolates in Kerman province of Iran

Geographical distribution information of Meloidogyne spp_ in infested and non-infested areas of the sampling regions in two main pistachio growing provinces of Iran (GPS coordination in DMS format)

Primers used for sequencing different loci in the present study

Morphometrics of J2s of the studied Meloidogyne javanica isolates in two main pistachio growing provinces of Iran

Eight isolates of Meloidogyne javanica sequenced in the present study and accession numbers of newly generated sequences

Paradigm

My account