Diplolaimelloides woaabi sp. n. (Nematoda: Monhysteridae): A Novel Species of Free-Living Nematode from the Great Salt Lake, Utah

Sediment samples of microbialites (top 10 cm of submerged microbialite mounds) were collected using a shovel from Bridger Bay, on the northern tip of Antelope Island within Great Salt Lake, UT, USA (41°03′32.4″N 112°15′28.8″W, salinity: 115 ppt, elevation 4,200 ft) from May to October of 2024 (Fig. 1). Nematodes were extracted from sediment samples either by sucrose density centrifugation or by placing a small <2 cm “nugget” of microbialite into a 50 ml conical tube with lake water, lightly shaking the tube, pouring the supernatant onto a Petri dish, and visually scanning the sample for live nematodes with a dissecting microscope. Isolated nematodes were further identified by microscopy and SSU-sequencing.

Light microscopy/DIC observations and measurements were primarily made on live specimens, anesthetized using 100 mM sodium azide on 2% agarose slides under a differential interference contrast microscope (DIC, Leica DM2500). Mosaics and line drawings (Fig. 2) were made in Adobe Illustrator (v28.7.3) by digitally tracing the superimposition of multi-focal plane light images. All measurements were obtained using ImageJ (v2.14.0/1.54f) and all curved structures were measured along the arc or median line, presented in micrometers (µm) (Table 1). Unless explicitly mentioned, measurements provided in the text and tables are from DIC images of nematodes extracted from the wild; n = 21 females and 10 males.

Living nematodes were initially fixed in 4% cold gluteraldehyde for 24 hr and rinsed in 0.1 M sodium cacodylate buffer, before fixation in 2% Osmium tetroxide for 8–12 hr. Nematodes were again rinsed in cacodylate buffer, followed by dehydration in a progressively-increasing concentration of cold ETOH solutions until the nematodes were in 100% ETOH. Nematodes were critical point dried, coated with silver, and mounted on a SEM stub before viewing on a Hitachi S4700 field-emission scanning electron microscope at the Morrison Microscopy Core Research Facility of the Nebraska Center for Biotechnology or Brigham Young University Electron Microscopy Laboratory.

Type specimens (in both glass vials and permanent slides) were fixed and deposited in the Utah Natural History Museum in Salt Lake City, Utah, USA. For glass vials, nematodes were extracted from 100 g of sediment sample by sucrose density centrifugation, heat killed in a water bath at 75°C for 12–15 min, and preserved in equal volume of hot 10% formalin. For permanent slides, nematodes were fixed as in glass vials and select nematodes were mounted on glass slides with a drop of glycerol and cover slides lifted with slim fibers of glass and sealed with nail polish.

Individual worm lysate was prepared for two males, each submerged in 9.8 µl of single-worm lysis solution (121 mg Tris, 380 mg KCL, 51 mg MgCl₂ × 6H₂O, 460 µl NP-40, 460 µl Tween-20, fill to 100 ml ddH₂O) and 0.2 µl of 10 mg/ml Proteinase K. Samples were heated for 2 hr at 65°C and 10 min at 95°C. Next, a primer pair targeting the 18S ribosomal small subunit (SSU rDNA) was used for PCR amplification; Forward primer SSU18A/RH5401: 5′–AAAGATTAAGCCATGCATG–3′; Reverse primer SSU26R/RH5402: 5′–CATTCTTGGCAAATGCTTTCG–3′ (Blaxter et al., 1998; Floyd et al., 2002). The amplicon length was approximately 1,000 bp. 500 bp was Sanger sequenced using the RH5403 primer: 5′–AGCTGGAATTACCGCGGC–3′ (Zhou et al., 2019) at MCLAB (CA, USA). Chromatograms were trimmed for quality in SnapGene Viewer (Snapgene software [www.snapgene.com]), and aligned with MUSCLE in AliView (v1.30) (Larsson, 2014) alongside other Monhysteridae 18S sequences from 18S-NemaBase (Gattoni et al., 2023) and recently described Monhysteridae genera that are found in the gill chambers of crustaceans, which are phylogenetically close to Diplolaimelloides (Westerman et al., 2022). Linhomoeidae sp. and Ptycholaimellus sp. were included as outgroups (Genbanks IDs are indicated in branch tips). The ~500 nucleotide block including GSL nematode sequences was used for realignment and saved as a .FASTA file, which was used to make a tree in IQ-Tree (v.3.0.1) (Nguyen et al., 2015). The general time reversible (GTR) model was used for nucleotide substitutions, and nodal support for maximum-likelihood analysis was performed with 1,000 bootstrap replicates (options: -st DNA -m GTR -bb 1,000 -alrt 1,000). The consensus tree was visualized in FigTree (v1.4.4) (Rambaut, 2018), and rooted on Linhomoeidae sp. Bootstrap values are indicated at each node, except for nodes with less than 0.50 support.

The body plan is radially symmetrical and nearly cylindrical, almost uniform in diameter, but tapered toward both ends, more so posteriorly at the tail (Fig. 2). The body is slender, with a diameter at the pharyngeal end at 20.9 µm in females and 24.6 in males. The ventral side can be recognized by the position of the secretory–excretory pore (Fig. 4) and the vulva and anus in females (Fig. 5) or the cloacal opening in males (Fig. 6). The cuticle appears thin (c.0.7 µm) and smooth in light microscopy but ornamented with subtle transverse striae in SEM (c.0.2 µm). No longitudinal markings are observed. The integument features a series of dorsal, lateral, and ventral papillae. The outer parts feature setae that vary from short (min length 0.2 µm) to long (max length 0.9 µm) (Figs. 5B,C).

Figure 4:

The secretory–excretory pore. (A–D) Scanning electron microscopy of the anterior end of four different Diplolaimelloides woaabi sp. nov. individuals. The position of the secretory–excretory pore on the ventral side of the nematode is annotated with a white arrow. Other miscellaneous salient features are labeled as landmarks.

Figure 5:

Scanning electron microscopy of female Diplolaimelloides woaabi sp. nov. shows several features, including the posterior pattern of papillae on (A) the whole body, (B,C) a closeup of integument and single papilla, and (D–F) the posterior ends of nematodes, with each letter depicting a different individual and successively zoomed-in shots of the anus and/or vulva areas with visible papillae labeled with white arrows.

Figure 6:

Microscopy of male Diplolaimelloides woaabi sp. nov. shows the posterior pattern of papillae on the whole body or posterior ends (A–D). Each letter depicts a different individual and successively zoomed-in shots with papillae labeled with white arrows. (B) Image taken with DIC microscopy; all others taken with scanning electron microscopy. DIC, differential interference contrast.

The lip region is continuous with the body contour but slightly tapered rather than fully cylindrical. The oral opening is terminal and leads to a double cavity with a slight constriction in the middle portion dividing the cavity into two compartments (Figs. 7A,B). No denticles observed in the anterior buccal cavity, which is funnel shaped with cuticularized walls, relatively deep and narrow (Table 1). The basic pattern of the anterior region consists of six peri-oral plates radially arranged around the terminal oral opening: two subdorsal, two subventral, and two lateral. The lips appear completely fused such that the anterior end of the nematode shows a subtle hexagonal, compressed region (Figs. 7C,D). The head carries a concentration of anterior sense organs in two circlets of sensilla (sensory papillae) which surround the stoma opening (Figs. 7C,D). The inner ring is made of six inner labial sensilla surrounding the mouth, which are papilliform and seem to vary in how protruding they are from the head (~1 µm long) (Figs. 7C,D). The sensilla in the outer ring are made of six outer labial setae and four cephalic setiform sensilla, with the positions of the two “missing” lateral setae in the outer circle in line with a posterior pair of amphids (Figs. 7C,D). The sensilla of the outer ring tend to be longer (2–3 µm long, one-quarter to one-third of labial diameter) than those in the inner ring (Figs. 7C,D).

Figure 7:

Terminal head region of Diplolaimelloides woaabi sp. nov. (A) DIC microscopy reveals stoma with a double cavity, or two distinct compartments, the muscular pharynx and the prominent cardia. (B) Section of the anterior end, arrows pointing to the second chamber of the buccal cavity and the position of the amphidal fovea. Scanning electron microscopy shows (C–F) completely fused lip plates that carry a concentration of sense organs in a 6 (inner) + 6 + 4 (outer) pattern, and amphids and somatic papillae visible slightly posterior from the anterior end. DIC, differential interference contrast.

The pharynx is cylindrical, gradually enlarging in a posterior portion with a subtle but notable bulb (Figs. 2; 7A,B). The cardia is distinct between the pharynx and the intestine.

The amphids are positioned laterally and posterior to the stoma, in the pharyngeal region of the body (Figs. 7B–D). The anterior margin of the amphid lies at an average of 15.8 (female) and 15.7 (male) µm from the anterior body end (range 10.8–20.0 µm). In size, amphids are on average 17.0% (female) and 20.4% (male) of the corresponding body diameter (range 10.0%–31.4%). Amphidial fovea range from circular to cryptospiral (Figs. 7B–F). One or two papillae are visible just posterior (range 3.1–11.6 µm, mean 7.6 µm) from the amphid (Figs. 7D–F).

Ocelli are present in males and females, located on average 28.1 (female) and 29.1 (male) µm from the anterior end (range 17.6–38.7 µm). The pigment associated with these structures is, for the most part, concentrated laterally or partly embedded in the pharynx (Fig. 8).

Figure 8:

Photoreceptors of Diplolaimelloides woaabi sp. nov. (A) Anterior body end showing the position of one of the ocelli and detail of the pigment area. Inset shows a schematic reconstruction based on the ultrastructure of an ocellus, adapted from a TEM photograph (Van De Velde and Coomans, 1988). Anterior body end of a different specimen, showing the positions and colored pigment of (B) both, (C) one, and (D) the other ocelli.

Ventral gland not easily observed in GSL nematodes using SEM or DIC microscopy. The three cell bodies of the caudal gland were observed in some but not all specimens. Caudal glands were associated with a spinneret, the terminal pore that helps secrete a sticky substance. Adherence to substrate material from the tail by isolated nematodes was observed, demonstrating that the spinneret is functional.

Females

The vulva position in females is variable but approximately halfway along the body (mean%V = 54.7%, range 49.8%–62.1%). The tail shape appears similar in all juvenile stages but shows strong sexual dimorphism between sexes as adults (Fig. 2). Females taper gradually from the vulva and the anus to the tail region for 12.7% of their length on average. The body lengths of female adults is also variable, between 441.0 µm and 1,159.4 µm (Table 1, Fig. 9). Females exhibit at least six caudal papillae in a 2 + 1 + 2 + 1 pattern; the first post-anal pair is sub-ventral and all posterior to that pair are lateral (Figs. 2; 5E). Eggs (mean length 52.1 µm, width 37.9 µm) were observed on agar plates post isolation of nematodes (Fig. 10).

Figure 9:

Diplolaimelloides woaabi sp. nov. total length as a factor of stage and sex.

Figure 10:

Diplolaimelloides woaabi sp. nov. egg.

Males

Males are relatively uncommon (~1%) in the population. From a dissecting microscope, the most obvious distinguishing characteristic of males is a body shape that narrows abruptly in the tail region, filiform for 8.1% of their length on average. Moreover, males present as slightly larger than females (Table 1, Fig. 9). The papillae pattern differs between females (Fig. 5) and males (Fig. 6). One single genital papilla can be found on the mid-ventral pre-cloacal surface on average 5.4 µm from cloacal opening of males (Figs. 6A,C). The male tail is enveloped by a conspicuous bursa (Fig. 6). The pattern of genital papillae associated with bursa are as follows: four papillae on each side arranged in an arc with a larger gap between two pairs of two (2 + 2) and all posterior to the cloacal opening (Figs. 6A,C). Three pairs of caudal papillae present posterior to bursa (Figs. 6B–D), including one pair of small “mid-tail” lateral papillae that can be seen in the ventral or dorsal view in males (Figs. 6B–D). The mean distance from each papilla to the caudal opening is shown in Figure 11A. The spicule is long and slightly arcuate, with ventral:dorsal extensions on either side below the tip, while the gubernaculum is short and funnel-shaped without apophysis (Figs. 11B–D).

Figure 11:

Male copulatory apparatus, Diplolaimelloides woaabi sp. nov. (A) Diagram of male papillae pattern and (inset) position. Gubernaculum in (B) ventral and (C) lateral view with non-emergent spicule. (D) Lateral view with emergent spicule. Images taken with or traced over DIC microscopy. DIC, differential interference contrast.

Morphologically, nematodes from GSL are most similar to five species that exhibit four pairs of bursal papillae in a (2 + 2) pattern: D. delyi Andrássy, 1958, D. brucei Hopper, 1970, D. tehuelchus Pastor de Ward and Lo Russo, 2009, D. rushikondai Sufyan et al., 2014, and D. contortus Chen et al., 2023. D. woaabi sp. nov. are distinct from D. brucei by an abrupt transition of the tail from conical to filiform, rather than the elongated conoid anterior and short cylindrical posterior tails of D. brucei. D. woaabi sp. nov. also exhibit a shorter gubernaculum (mean length:17.853 µm) than D. brucei (23–28 µm), and longer spicules (57.1–89.5 µm in D. woaabi vs. 31–38 µm in D. brucei). D. woaabi sp. nov. are distinct from D. delyi, D. rushikondai, and D. contortus by having a relatively short male tail <5 abd, and thus relatively large de Man’s ratio c of 10.0. D. woaabi sp. nov. are distinct from D. tehuelchus by the number of pre-cloacal papillae within bursa (1 vs. 2), absence of mid-ventral post-cloacal papillae within bursa, and number and pattern of tail papillae after bursa (see updated Species Key for Genus Diplolaimelloides and Fig. 11A).

D. woaabi sp. nov. is further distinguished from D. rushikonda by the presence of ocelli (absent in D. rushikonda). D. woaabi sp. nov. is further distinguished from D. delyi by having a well cuticularized funnel-shaped gubernaculum vs. “simple thickening of posterior rectal lining” in D. delyi. They also exhibit filiform tail papillae that are absent in descriptions of D. delyi. D. woaabi are distinguished from several Diplolaimelloides species by a relatively short stoma length, long distance from anterior to amphid, and short distance from anterior to ocelli (Table 2).

Finally, we note three morphological features present in D. woaabi sp. nov. that appear to be unique. First, they exhibit “mid-tail” papillae in an offset, paired configuration (Figs. 6B–D; 11A). Second, the spicule in D. woaabi sp. nov. have extensions below the tip that are presumably used for latching to the female during copulation (i.e., the “halberd,” Figs. 6A; 11D). Third, they are the first species to be reported in the genus with fused lips, and this trait may warrant an update of the genus diagnosis in the future (Figs. 7B–F). We note that while the fused lips were readily apparent in SEM (Figs. 7C–F), they would be more difficult to observe with light microscopy alone. Moreover, the extensions on the spicule are more clearly seen when they are outside of the body; although they could be observed internally as well in a folded-up position (Fig. 11).

Type locality and habitat

D. woaabi sp. nov. type specimens were found in microbialite with a mean water salinity of 115 ppt, in a bay located 4,200 ft above sea level. The cuticular adherence of other organisms and substrates was apparent on these nematodes (Fig. 12).

Figure 12:

Scanning electron microscopy of body ornamentation or adherence of other organisms and/or substances on Diplolaimelloides woaabi sp. nov. that are (A–D) rod-like, (E,F) wart-like, or (G,H) fuzz-like.

SSU phylogenetic analyses using primers SSU18A/RH5401 and SSU26R/RH5402 are consistent with recent 18S-based phylogenetic trees of Monhysteridae (Westerman et al., 2022). D. woaabi specimens are in a well-supported clade containing Diplolaimelloides delyi, Diplolaimelloides meyli, an uncharacterized Diplolaimelloides species, Diplolaimella dievengatensis and G. scyllae (Fig. 3). This tree supports the placement of GSL nematodes in the Diplolaimelloides genus with D. delyi as its closest conger.