Philaenus spumarius specimens parasitized by Mermithidae in Central Italy_ The number of dissected spittlebugs, examined instars, and detected nematode specimens is listed according to the sampling site_
| Philaenus spumarius | Mermithidae | ||||||
|---|---|---|---|---|---|---|---|
| Site | Coordinates | No. of dissected specimens | Examined instar | No. of observed nematodes | No. of nematodes per spittlebug | Parasitization rate (%) | Species |
| Aa | 43.938753N | 411 | n1, n2, n3, n4, n5, adult | 94 | 1–4 | 22.87 | 1 |
| 11.141433E | |||||||
| B | 43.811145N | 516 | n2, n3, n4, n5, adult | 17 | 1 | 3.29 | 1 |
| 11.031118E | |||||||
| Ca | 43.732465N | 322 | n1, n2, n3, n4, n5, adult | 16 | 1–2 | 4.97 | 2 |
| 11.254696E | |||||||
| Da | 43.66854N | 436 | n1, n2, n3, n4, n5, adult | 81 | 1–9 | 18.58 | 2 |
| 11.152888E | |||||||
| Ea | 43.799643N | 322 | n1, n2, n3, n4, n5, adult | 17 | 1–5 | 5.28 | 2 |
| 11.403262E | |||||||
| F | 43.761272N | 402 | n1, n2, n3, n4, n5, adult | 0 | - | - | |
| 10.452208E | |||||||
| G | 42.737900N | 400 | n2, n3, n4, n5, adult | 0 | - | - | |
| 11.05498E | |||||||
| H | 43.508942N | 341 | n1, n2, n3, n4, adult | 0 | - | - | |
| 11.874063E | |||||||
Primer sequences and their annealing temperatures_
| Primer name | Primer sequence | Ta | Reference |
|---|---|---|---|
| 988F | CTCAAAGATTAAGCCATGC | 45.0 °C | Holterman et al., 2006 |
| 26R | CATTCTTGGCAAATGCTTTCG | Nguyen and Hunt, 2007 | |
| MermF | CAAGGACGAAAGTTAGAGGTTC | 47.0 °C | Kobylinski et al., 2012 |
| MermR | GGAAACCTTGTTACGACTTTTA | ||
| Nem1 | GCAAGTCTGGTGCCAGCAGC | 45.0 °C | Foucher and Wilson, 2002 |
| Nem2 | CCGTGTTGAGTCAAATTAAG | ||
| 18S | TTGATTACGTCCCTGCCCTTT | 50.0 °C | Vrain et al., 1992 |
| 26S | TTTCACTCGCCGTTACTAAGG | ||
| D2A | ACAAGTACCGTGAGGGAAAGTTG | 52.0 °C | Douda et al., 2010 |
| D3B | TCGGAAGGAACCAGCTACTA |