Identification, distribution, and hosts of Meloidogyne spp. infecting horticultural crops in Florida, USA with focus on Meloidogyne enterolobii

Riva, Gabrieli; Brito, Janete A.; de Oliveira, Clemen; Marin, Marcus; Gu, Mengyi; Bui, Hung Xuan; Desaeger, Johan

Identification, distribution, and hosts of Meloidogyne spp. infecting horticultural crops in Florida, USA with focus on Meloidogyne enterolobii

Journal of Nematology

Volume 56 (2024): Issue 1 (March 2024)

By:

Gabrieli Riva, Janete A. Brito, Clemen de Oliveira, Marcus Marin, Mengyi Gu, Hung Xuan Bui and Johan Desaeger

Open Access

|Jan 2025

Figures & Tables

Florida's map showing the 12 counties sampled, distribution, and prevalence of each Meloidogyne species identified in this study. Out of 304 samples collected, 247 were positive for root-knot nematodes. Counties sampled and number of samples positive for Meloidogyne spp. were Alachua (2), Collier (1), DeSoto (20), Hardee (1), Hendry (1), Highlands (8), Hillsborough (171), Manatee (10), Miami-Dade (5), Palm Beach (8), and Sarasota (20). No root-knot nematodes were found in the samples collected in Charlotte County. Map was made using ArcGIS Prop software (Esri, Redlands, CA).

Distribution of Meloidogyne species across different cropping systems found in this study.

PCR amplification product generated using species-specific primer sets. A) Me = Meloidogyne enterolobii genomic DNA amplified using Me-F/Me-R primer set; B) Ma = Meloidogyne arenaria genomic DNA amplified using Far/Rar primer set; C) Mi = Meloidogyne incognita genomic DNA amplified using MI-F/MI-R primer set; D) Mj = Meloidogyne javanica genomic DNA amplified using Fjav/Rjav primer set; N = Water; M = 100-bp DNA ladder (New England Biolabs, MA), with the arrow indicating the position of the 500/517 bp band.

Distribution of Meloidogyne species by crop found in this study.

Bayesian 50% majority-rule consensus tree inferred from mitochondrial DNA DNA fragment of cytochrome c oxidase subunit II to large subunit 16S rRNA genes from C2F3/1108 primer set. Populations of Meloidogyne enterolobii obtained in this study are represented in bold. GenBank accession number proceed species and origin. *Recently reclassified as Meloidogyne luci (Stare et al., 2017).

Bayesian 50% majority-rule consensus tree inferred from mitochondrial DNA fragment of partial l-rRNA gene from TRNAH/MRH106 primer set. Meloidogyne enterolobii from this study are represented in bold. Branch lengths represent means of posterior distribution. GenBank accession number precedes species and origin. *Recently reclassified as Meloidogyne luci (Stare et al., 2017).

Primers used in this study_

Code	Meloidogyne spp.	Primer Sequence 5′-3′	Gene region	Reference
Far	M. arenaria	TCGAGGGCATCTAATAAAGG	SCAR	Adams et al., 2007
Rar	M. arenaria	GGGCTGAATATTCAAAGGAA	SCAR	Adam et al., 2007
JMV-1	M. hapla	GGATGGCGTGCTTTCAAC	IGS - SCAR	Adam et al., 2007
JMV-2	M. hapla	AAAAATCCCCTCGAAAAATCCACC	IGS - SCAR	Adam et al., 2007
Me-F	M. enterolobii	AACTTTTGTGAAAGTGCCGCTG	IGS - rRNA	Long et al., 2006
Me-R	M. enterolobii	TCAGTTCAGGCAGGATCAACC	IGS - rRNA	Long et al., 2006
MI-F	M. incognita	GTGAGGATTCAGCTCCCCAG	SCAR	Meng et al., 2004
MI-R	M. incognita	ACGAGGAACATACTTCTCCGTCC	SCAR	Meng et al., 2004
Fjav	M. javanica	GGTGCGCGATTGAACTGAGC	SCAR	Zijlstra et al., 2000
Rjav	M. javanica	GGCCTTAACCGACAATTAGA	SCAR	Zijlstra et al., 2000
1108	Nonspecific	TACCTTTGACCAATCACGCT	COX2-l-rRNA	Powers and Harris, 1993
C2F3	Nonspecific	GGTCAATGTTCAGAAATTTGTGG	COX2-l-rRNA	Powers and Harris, 1993
D2A	Nonspecific	CAAGTACCGTGAGGGAAAGTTG	28S	Nunn, 1992
D3B	Nonspecific	TCGGAAGGAACCAGCTACTA	28S	Nunn, 1992
MORF	Nonspecific	ATCGGGGTTTAATAATGGG	IGS and tRNA-His	Hugall et al., 1994
MTHIS	Nonspecific	AAATTCAATTGAAATTAATAGC	IGS and tRNA-His	Hugall et al., 1994
NAD5-F2	Nonspecific	TATTTTTTGTTTGAGATATATTAG	NADH dehydrogenase subunit 5	Janssen et al., 2016
NAD5-R1	Nonspecific	CGTGAATCTTGATTTTCCATTTTT	NADH dehydrogenase subunit 5	Janssen et al., 2016
TRNAH	Nonspecific	TGAATTTTTTATTGTGATTAA	tRNA-His and l-rRNA	Stanton et al., 1997
MRH106	Nonspecific	AATTTCTAAAGACTTTTCTTAGT	tRNA-His and l-rRNA	Stanton et al., 1997

Meloidogyne spp_ present in Florida_

Meloidogyne spp.	County	Year	References
M. arenaria	Alachua	1888	Neal, 1889^a; Chitwood, 1949
M. artiellia^b	Palm Beach	1986	Lehman, 2002
M. christiei^c	Seminole	1986	Golden and Kaplan, 1986
M. cruciani	Alachua	1986	Garcia-Martinez et al., 1982
M. enterolobii (= M. mayaguensis)	Dade	2002	Brito et al., 2002^d
M. floridensis	Palm Beach Alachua	2004	Handoo et al., 2004
M. graminicola	Dade	2008	Brito et al., 2008
M. graminis (= Hysoperine graminis)	Polk	1959	Sledge and Golden, 1964^e; Whitehead, 1968
M. hapla	Orange	1955	Lehman, 2002
M. haplanaria	Collier	2016	Joseph et al., 2016
M. incognita	Jefferson	1955	Lehman, 2002
M. javanica	Orange	1955	Lehman, 2002
M. marylandi	Marion	2012	Sekora et al., 2012
M. megatyla^b	Baker	1984	Lehman, 2002
M. partityla	Madison	2005	Crow et al., 2005
M. spartinae (= Hypsoperine spartinae)	Flagler	1958	Rau and Fassuliotis, 1965^f; Whitehead, 1968
M. thamesi	Palm Beach	1952	Chitwood et al., 1952

The procedure of the PCR amplification used in this study_

Primer	Response parameter (35 cycle)
Primer	Initial degeneration	Degeneration	Annealing	Extension	Final extension
C2F3/1108	95 °C, 15 min	95 °C, 45 s	55 °C, 45 s	72 °C, 60 s	72 °C, 10 min
D2A/D3B	“	”	“	“	72 °C, 10 min
TRNAH/MRH106	“	95 °C, 30 s	50 °C, 30 s	68 °C, 60 s	68 °C, 10 min
MORF/MTHIS	“	“	“	“	68 °C, 10 min
Far/Rar	“	“	54 °C, 30 s	72 °C, 60 s	72 °C, 10 min
Fjav/Rjav	“	“	64 °C, 30 s	“	72 °C, 10 min
JMV1/JMV2	“	“	50 °C, 30 s	“	72 °C, 10 min
Me-F/Me-r	“	“	68 °C, 30 s	“	72 °C, 10 min
MI-F/MI-R	“	“	62 °C, 30 s	“	72 °C, 10 min
NAD5-F2/NAD5-R1	94 °C, 2 min	94 °C, 60 s	45 °C, 60 s	72 °C, 90 s	72 °C, 10 min

Meloidogyne species and GenBank accession numbers of the newly DNA sequences obtained in the present study_

Sample No.	Location (County)	Plant host	RKN species	Gene region	Accession number	References
FL 21	Hillsborough	Cucumis sativus	M. arenaria	NADH dehydrogenase subunit 5	OR043670	This study
FL 22	Hillsborough	Solanum lycopersicum	M. arenaria	NADH dehydrogenase subunit 5	OR043669	This study
FL 2	Manatee	Solanum lycopersicum	M. enterolobii	COX2 - l-rRNA	OQ680023	This study
FL 3	Hillsborough	Luffa cylindrica	M. enterolobii	COX2 - l-rRNA	OQ680018	This study
FL 4	Hillsborough	Ipomoea batatas	M. enterolobii	COX2 - l-rRNA	OQ680019	This study
FL 11	Manatee	Solanum lycopersicum	M. enterolobii	COX2 - l-rRNA	OQ835723	This study
FL 13	Hendry	Capsicum annuum	M. enterolobii	COX2 - l-rRNA	OQ680020	This study
FL 14	Manatee	Cucumis sativus	M. enterolobii	COX2 - l-rRNA	OQ680021	This study
Fl 15	Hillsborough	Capsicum annuum	M. enterolobii	COX2 - l-rRNA	OQ680022	This study
FL 16	Hillsborough	Capsicum annuum	M. enterolobii	COX2 - l-rRNA	OR161827	This study
FL 13	Hendry	Capsicum annuum	M. enterolobii	28S rRNA	OQ508955	This study
FL 4	Hillsborough	Ipomoea batatas	M. enterolobii	tRNA-His and l-rRNA	OQ680025	This study
FL 11	Manatee	Solanum lycopersicum	M. enterolobii	tRNA-His and l-rRNA	OQ835724	This study
FL 13	Hendry	Capsicum annuum	M. enterolobii	tRNA-His and l-rRNA	OQ680026	This study
FL 16	Hillsborough	Capsicum annuum	M. enterolobii	tRNA-His and l-rRNA	OQ680027	This study
Fl 17	Hillsborough	Nopalea cochenillifera	M. enterolobii	tRNA-His and l-rRNA	OQ835727	This study
FL 18	Palm Beach	Capsicum annuum	M. enterolobii	tRNA-His and l-rRNA	OQ835725	This study
FL 19	Palm Beach	Capsicum annuum	M. enterolobii	tRNA-His and l-rRNA	OQ835726	This study
FL 20	Hillsborough	Cucurbita pepo	M. enterolobii	tRNA-His and l-rRNA	OQ680028	This study
FL 2	Manatee	Solanum lycopersicum	M. enterolobii	tRNA-His and l-rRNA	OQ680024	This study
FL 3	Hillsborough	Luffa cylindrica	M. enterolobii	tRNA-His and l-rRNA	OR161828	This study
FL 24	Miami Dade	Lablab purpureus	M. incognita	NADH dehydrogenase subunit 5	OR043668	This study
FL 25	Manatee	Solanum lycopersicum	M. incognita	NADH dehydrogenase subunit 5	OR033166	This study
FL 26	Manatee	Solanum lycopersicum	M. incognita	NADH dehydrogenase subunit 5	OR033167	This study
FL 27	Manatee	Solanum lycopersicum	M. incognita	NADH dehydrogenase subunit 5	OR043667	This study
FL 28	Palm Beach	Cucumis sativus	M. incognita	NADH dehydrogenase subunit 5	OR033164	This study
FL 29	Palm Beach	Solanum lycopersicum	M. incognita	NADH dehydrogenase subunit 5	OR033168	This study
FL 30	Palm Beach	Abelmoschus esculentus	M. incognita	NADH dehydrogenase subunit 5	OR033163	This study
FL 31	Hillsborough	Solanum lycopersicum	M. incognita	NADH dehydrogenase subunit 5	OR033165	This study

Meloidogyne species found infecting different plant species in this study_

Crop	Scientific name	Family	Total number of samples^a	*M. arenaria*	*M. enterolobii*	*M. incognita*	*M. javanica*	*M. hapla*	**M. enterolobii/M. incognita**
Tomato	Solanum lycopersicum	Solanaceae	67 (9)	4	6	22	25	0	1
Pepper	Capsicum annuum	Solanaceae	28 (1)	0	16	10	0	1	0
Caladium	Caladium bicolor	Araceae	14	14	0	0	0	0	0
Strawberry	Fragaria × ananassa	Rosaceae	14 (1)	0	0	0	2	11	0
Sweet potato	Ipomoea batatas	Convolvulaceae	14	0	14	0	0	0	0
Cucumber	Cucumis sativus	Cucurbitaceae	13	1	1	8	3	0	0
Cowpea	Vigna unguiculata	Fabaceae	11	0	1	0	10	0	0
Okra	Abelmoschus esculentus	Liliaceae	10 (1)	0	1	6	1	0	1
Squash	Cucurbita pepo	Cucurbitaceae	10 (1)	0	1	7	1	0	0
Luffa	Luffa cylindrica	Cucurbitaceae	9 (1)	0	7	1	0	0	0
Pumpkin	Cucurbita pepo	Cucurbitaceae	8	0	6	1	0	0	1
Basil	Ocimum basilicum	Lamiaceae	7	0	7	0	0	0	0
Cantaloupe	Cucumis melo	Cucurbitaceae	7	0	0	1	2	4	0
Eggplant	Solanum melongena	Solanaceae	6 (2)	0	4	0	0	0	0
Lettuce	Lactuca sativa	Asteraceae	6 (3)	0	0	3	0	0	0
Bean	Phaseolus vulgaris L.	Fabaceae	4 (2)	0	1	1	0	0	0
Cherry tomato	Solanum lycopersicum	Solanaceae	4	0	0	4	0	0	0
Lablab bean	Lablab purpureus	Fabaceae	4 (3)	0	0	1	0	0	0
Sugar cane	Saccharum officinarum	Poaceae	4 (4)	0	0	0	0	0	0
Amaranth	Amaranthus sp.	Amaranthaceae	3	0	0	3	0	0	0
Boniato	Ipomoea batatas	Convolvulaceae	3	0	0	0	0	0	0
Corn	Zea mays	Poaceae	3 (3)	0	0	0	0	0	0
Guava	Psidium guajava	Myrtaceae	3 (3)	0	0	0	0	0	0
Malabar spinach	Basella alba	Basellaceae	3	0	2	1	0	0	0
Parsley	Petroselinum crispum	Apiaceae	3 (3)	0	0	0	0	0	0
Watermelon	Citrullus lanatus	Cucurbitaceae	3 (2)	0	0	0	1	0	0
Artichoke	Cynara cardunculus	Asteraceae	2	0	0	1	1	0	0
Bok choy	Brassica rapa	Brassicaceae	2	0	0	1	0	0	0
Ginger	Zingiber officinale	Zingiberaceae	2	2	0	0	0	0	0
Golden Egg	Solanum macrocarpon	Solanaceae	2	0	2	0	0	0	0
Hemp	Cannabis sativa	Cannabaceae	2	2	0	0	0	0	0
Indigo	Indigofera tinctoria	Fabaceae	2 (1)	0	0	0	1	0	0
Jute	Corchorus olitorius	Tiliaceae	2	0	2	0	0	0	0
Perilla	Perilla frutescens	Lamiaceae	2	0	2	0	0	0	0
Radish	Raphanus sativus	Brassicaceae	2 (1)	0	0	0	1	0	0
Sugar beet	Beta vulgaris	Amaranthaceae	2	0	2	0	0	0	0
Sunflower	Helianthus annuus	Asteraceae	2 (1)	0	0	1	0	0	0
Thai basil	Ocimum basilicum	Lamiaceae	2	0	0	1	1	0	0
Cactus	Nopalea cochenillifera	Cactaceae	1	0	0	0	0	0	1
Caesar Weed	Urena lobata	Malvaceae	1(1)	0	0	0	0	0	0
Cauliflower	Brassica oleracea	Brassicaceae	1 (1)	0	0	0	0	0	0
Chrysanthemum	Chrysanthemum indicum	Asteraceae	1 (1)	0	0	0	0	0	0
Coriander	Coriandrum sativum	Apiaceae	1	0	0	1	0	0	0
Elephant ear	Colocasia esculenta	Araceae	1	1	0	0	0	0	0
Italian Parsley	Petroselinum crispum	Apiaceae	1 (1)	0	0	0	0	0	0
Jackfruit	Artocarpus heterophyllus	Moraceae	1 (1)	0	0	0	0	0	0
Lavender	Lavandula angustifolia	Lamiaceae	1	0	0	1	0	0	0
Leek	Allium ampeloprasum	Amaryllidaceae	1 (1)	0	0	0	0	0	0
Lily	Lilium	Lamiaceae	1	0	1	0	0	0	0
Mustard	Brassica nigra	Brassicaceae	1	0	1	0	0	0	0
Napa cabbage	Brassica rapa	Brassicaceae	1	0	0	1	0	0	0
Peach	Prunus persica	Rosaceae	1 (1)	0	0	0	0	0	0
Turnip	Brassica rapa	Brassicaceae	1	0	0	1	0	0	0
Water spinach	Ipomoea aquatica	Convolvulaceae	1	0	0	1	0	0	0
Wild tomato	Solanum capsicoides	Solanaceae	1	0	1	0	0	0	0
Zucchini	Cucurbita pepo	Cucurbitaceae	1 (1)	0	0	0	0	0	0

DOI: https://doi.org/10.2478/jofnem-2024-0042 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X

Journal RSS Feed

Language: English

Submitted on: May 23, 2024

Published on: Jan 24, 2025

Published by: Society of Nematologists, Inc.

In partnership with: Paradigm Publishing Services

Publication frequency: 1 issue per year

Keywords:

molecular identification,

Related subjects:

© 2025 Gabrieli Riva, Janete A. Brito, Clemen de Oliveira, Marcus Marin, Mengyi Gu, Hung Xuan Bui, Johan Desaeger, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.

Previous article Volume 56 (2024): Issue 1 (March 2024)

Identification, distribution, and hosts of Meloidogyne spp. infecting horticultural crops in Florida, USA with focus on Meloidogyne enterolobii

Figures & Tables

Figure 1:

Figure 2:

Figure 3:

Figure 4:

Figure 5:

Figure 6:

Primers used in this study_

Meloidogyne spp_ present in Florida_

The procedure of the PCR amplification used in this study_

Meloidogyne species and GenBank accession numbers of the newly DNA sequences obtained in the present study_

Meloidogyne species found infecting different plant species in this study_

Paradigm

My account