Skip to main content
Have a personal or library account? Click to login
Identification, distribution, and hosts of Meloidogyne spp. infecting horticultural crops in Florida, USA with focus on Meloidogyne enterolobii Cover

Identification, distribution, and hosts of Meloidogyne spp. infecting horticultural crops in Florida, USA with focus on Meloidogyne enterolobii

Open Access
|Jan 2025

Figures & Tables

Table 1:

Meloidogyne spp. present in Florida.

Meloidogyne spp.CountyYearReferences
M. arenariaAlachua1888Neal, 1889, a; Chitwood, 1949
M. artielliabPalm Beach1986Lehman, 2002
M. christieicSeminole1986Golden and Kaplan, 1986
M. crucianiAlachua1986Garcia-Martinez et al., 1982
M. enterolobii (= M. mayaguensis)Dade2002Brito et al., 2002, d
M. floridensisPalm Beach Alachua2004Handoo et al., 2004
M. graminicolaDade2008Brito et al., 2008
M. graminis (= Hysoperine graminis)Polk1959Sledge and Golden, 1964, e; Whitehead, 1968
M. haplaOrange1955Lehman, 2002
M. haplanariaCollier2016Joseph et al., 2016
M. incognitaJefferson1955Lehman, 2002
M. javanicaOrange1955Lehman, 2002
M. marylandiMarion2012Sekora et al., 2012
M. megatylabBaker1984Lehman, 2002
M. partitylaMadison2005Crow et al., 2005
M. spartinae (= Hypsoperine spartinae)Flagler1958Rau and Fassuliotis, 1965, f; Whitehead, 1968
M. thamesiPalm Beach1952Chitwood et al., 1952

a First found in 1888, with species description published in 1889.

b These records do not provide morphological descriptions, morphometrics or illustrations of the identified samples; therefore, their identity remain uncertain.

c Currently only reported in Florida, USA.

d Reported in the Continental USA, Palm Beach, and Dade Counties.

e First found in 1959. Nematode genus and species description were first published in 1964.

f First found in 1958, with species description published in 1965.

Table 2:

Primers used in this study.

CodeMeloidogyne spp.Primer Sequence 5′-3′Gene regionReference
FarM. arenariaTCGAGGGCATCTAATAAAGGSCARAdams et al., 2007
RarM. arenariaGGGCTGAATATTCAAAGGAASCARAdam et al., 2007
JMV-1M. haplaGGATGGCGTGCTTTCAACIGS - SCARAdam et al., 2007
JMV-2M. haplaAAAAATCCCCTCGAAAAATCCACCIGS - SCARAdam et al., 2007
Me-FM. enterolobiiAACTTTTGTGAAAGTGCCGCTGIGS - rRNALong et al., 2006
Me-RM. enterolobiiTCAGTTCAGGCAGGATCAACCIGS - rRNALong et al., 2006
MI-FM. incognitaGTGAGGATTCAGCTCCCCAGSCARMeng et al., 2004
MI-RM. incognitaACGAGGAACATACTTCTCCGTCCSCARMeng et al., 2004
FjavM. javanicaGGTGCGCGATTGAACTGAGCSCARZijlstra et al., 2000
RjavM. javanicaGGCCTTAACCGACAATTAGASCARZijlstra et al., 2000
1108NonspecificTACCTTTGACCAATCACGCTCOX2-l-rRNAPowers and Harris, 1993
C2F3NonspecificGGTCAATGTTCAGAAATTTGTGGCOX2-l-rRNAPowers and Harris, 1993
D2ANonspecificCAAGTACCGTGAGGGAAAGTTG28SNunn, 1992
D3BNonspecificTCGGAAGGAACCAGCTACTA28SNunn, 1992
MORFNonspecificATCGGGGTTTAATAATGGGIGS and tRNA-HisHugall et al., 1994
MTHISNonspecificAAATTCAATTGAAATTAATAGCIGS and tRNA-HisHugall et al., 1994
NAD5-F2NonspecificTATTTTTTGTTTGAGATATATTAGNADH dehydrogenase subunit 5Janssen et al., 2016
NAD5-R1NonspecificCGTGAATCTTGATTTTCCATTTTTNADH dehydrogenase subunit 5Janssen et al., 2016
TRNAHNonspecificTGAATTTTTTATTGTGATTAAtRNA-His and l-rRNAStanton et al., 1997
MRH106NonspecificAATTTCTAAAGACTTTTCTTAGTtRNA-His and l-rRNAStanton et al., 1997
Table 3:

The procedure of the PCR amplification used in this study.

Initial degenerationDegenerationAnnealingExtensionFinal extension
C2F3/110895 °C, 15 min95 °C, 45 s55 °C, 45 s72 °C, 60 s72 °C, 10 min
D2A/D3B72 °C, 10 min
TRNAH/MRH10695 °C, 30 s50 °C, 30 s68 °C, 60 s68 °C, 10 min
MORF/MTHIS68 °C, 10 min
Far/Rar54 °C, 30 s72 °C, 60 s72 °C, 10 min
Fjav/Rjav64 °C, 30 s72 °C, 10 min
JMV1/JMV250 °C, 30 s72 °C, 10 min
Me-F/Me-r68 °C, 30 s72 °C, 10 min
MI-F/MI-R62 °C, 30 s72 °C, 10 min
NAD5-F2/NAD5-R194 °C, 2 min94 °C, 60 s45 °C, 60 s72 °C, 90 s72 °C, 10 min
Table 4:

Meloidogyne species and GenBank accession numbers of the newly DNA sequences obtained in the present study.

Sample No.Location (County)Plant hostRKN speciesGene regionAccession numberReferences
FL 21HillsboroughCucumis sativusM. arenariaNADH dehydrogenase subunit 5OR043670This study
FL 22HillsboroughSolanum lycopersicumM. arenariaNADH dehydrogenase subunit 5OR043669This study
FL 2ManateeSolanum lycopersicumM. enterolobiiCOX2 - l-rRNAOQ680023This study
FL 3HillsboroughLuffa cylindricaM. enterolobiiCOX2 - l-rRNAOQ680018This study
FL 4HillsboroughIpomoea batatasM. enterolobiiCOX2 - l-rRNAOQ680019This study
FL 11ManateeSolanum lycopersicumM. enterolobiiCOX2 - l-rRNAOQ835723This study
FL 13HendryCapsicum annuumM. enterolobiiCOX2 - l-rRNAOQ680020This study
FL 14ManateeCucumis sativusM. enterolobiiCOX2 - l-rRNAOQ680021This study
Fl 15HillsboroughCapsicum annuumM. enterolobiiCOX2 - l-rRNAOQ680022This study
FL 16HillsboroughCapsicum annuumM. enterolobiiCOX2 - l-rRNAOR161827This study
FL 13HendryCapsicum annuumM. enterolobii28S rRNAOQ508955This study
FL 4HillsboroughIpomoea batatasM. enterolobiitRNA-His and l-rRNAOQ680025This study
FL 11ManateeSolanum lycopersicumM. enterolobiitRNA-His and l-rRNAOQ835724This study
FL 13HendryCapsicum annuumM. enterolobiitRNA-His and l-rRNAOQ680026This study
FL 16HillsboroughCapsicum annuumM. enterolobiitRNA-His and l-rRNAOQ680027This study
Fl 17HillsboroughNopalea cochenilliferaM. enterolobiitRNA-His and l-rRNAOQ835727This study
FL 18Palm BeachCapsicum annuumM. enterolobiitRNA-His and l-rRNAOQ835725This study
FL 19Palm BeachCapsicum annuumM. enterolobiitRNA-His and l-rRNAOQ835726This study
FL 20HillsboroughCucurbita pepoM. enterolobiitRNA-His and l-rRNAOQ680028This study
FL 2ManateeSolanum lycopersicumM. enterolobiitRNA-His and l-rRNAOQ680024This study
FL 3HillsboroughLuffa cylindricaM. enterolobiitRNA-His and l-rRNAOR161828This study
FL 24Miami DadeLablab purpureusM. incognitaNADH dehydrogenase subunit 5OR043668This study
FL 25ManateeSolanum lycopersicumM. incognitaNADH dehydrogenase subunit 5OR033166This study
FL 26ManateeSolanum lycopersicumM. incognitaNADH dehydrogenase subunit 5OR033167This study
FL 27ManateeSolanum lycopersicumM. incognitaNADH dehydrogenase subunit 5OR043667This study
FL 28Palm BeachCucumis sativusM. incognitaNADH dehydrogenase subunit 5OR033164This study
FL 29Palm BeachSolanum lycopersicumM. incognitaNADH dehydrogenase subunit 5OR033168This study
FL 30Palm BeachAbelmoschus esculentusM. incognitaNADH dehydrogenase subunit 5OR033163This study
FL 31HillsboroughSolanum lycopersicumM. incognitaNADH dehydrogenase subunit 5OR033165This study
Figure 1:

Florida's map showing the 12 counties sampled, distribution, and prevalence of each Meloidogyne species identified in this study. Out of 304 samples collected, 247 were positive for root-knot nematodes. Counties sampled and number of samples positive for Meloidogyne spp. were Alachua (2), Collier (1), DeSoto (20), Hardee (1), Hendry (1), Highlands (8), Hillsborough (171), Manatee (10), Miami-Dade (5), Palm Beach (8), and Sarasota (20). No root-knot nematodes were found in the samples collected in Charlotte County. Map was made using ArcGIS Prop software (Esri, Redlands, CA).

Figure 2:

Distribution of Meloidogyne species across different cropping systems found in this study.

Figure 3:

PCR amplification product generated using species-specific primer sets. A) Me = Meloidogyne enterolobii genomic DNA amplified using Me-F/Me-R primer set; B) Ma = Meloidogyne arenaria genomic DNA amplified using Far/Rar primer set; C) Mi = Meloidogyne incognita genomic DNA amplified using MI-F/MI-R primer set; D) Mj = Meloidogyne javanica genomic DNA amplified using Fjav/Rjav primer set; N = Water; M = 100-bp DNA ladder (New England Biolabs, MA), with the arrow indicating the position of the 500/517 bp band.

Table 5:

Meloidogyne species found infecting different plant species in this study.

CropScientific nameFamilyTotal number of samplesaM. arenariaM. enterolobiiM. incognitaM. javanicaM. haplaM. enterolobii/M. incognita
TomatoSolanum lycopersicumSolanaceae67 (9)46222501
PepperCapsicum annuumSolanaceae28 (1)01610010
CaladiumCaladium bicolorAraceae141400000
StrawberryFragaria × ananassaRosaceae14 (1)0002110
Sweet potatoIpomoea batatasConvolvulaceae140140000
CucumberCucumis sativusCucurbitaceae13118300
CowpeaVigna unguiculataFabaceae110101000
OkraAbelmoschus esculentusLiliaceae10 (1)016101
SquashCucurbita pepoCucurbitaceae10 (1)017100
LuffaLuffa cylindricaCucurbitaceae9 (1)071000
PumpkinCucurbita pepoCucurbitaceae8061001
BasilOcimum basilicumLamiaceae7070000
CantaloupeCucumis meloCucurbitaceae7001240
EggplantSolanum melongenaSolanaceae6 (2)040000
LettuceLactuca sativaAsteraceae6 (3)003000
BeanPhaseolus vulgaris L.Fabaceae4 (2)011000
Cherry tomatoSolanum lycopersicumSolanaceae4004000
Lablab beanLablab purpureusFabaceae4 (3)001000
Sugar caneSaccharum officinarumPoaceae4 (4)000000
AmaranthAmaranthus sp.Amaranthaceae3003000
BoniatoIpomoea batatasConvolvulaceae3000000
CornZea maysPoaceae3 (3)000000
GuavaPsidium guajavaMyrtaceae3 (3)000000
Malabar spinachBasella albaBasellaceae3021000
ParsleyPetroselinum crispumApiaceae3 (3)000000
WatermelonCitrullus lanatusCucurbitaceae3 (2)000100
ArtichokeCynara cardunculusAsteraceae2001100
Bok choyBrassica rapaBrassicaceae2001000
GingerZingiber officinaleZingiberaceae2200000
Golden EggSolanum macrocarponSolanaceae2020000
HempCannabis sativaCannabaceae2200000
IndigoIndigofera tinctoriaFabaceae2 (1)000100
JuteCorchorus olitoriusTiliaceae2020000
PerillaPerilla frutescensLamiaceae2020000
RadishRaphanus sativusBrassicaceae2 (1)000100
Sugar beetBeta vulgarisAmaranthaceae2020000
SunflowerHelianthus annuusAsteraceae2 (1)001000
Thai basilOcimum basilicumLamiaceae2001100
CactusNopalea cochenilliferaCactaceae1000001
Caesar WeedUrena lobataMalvaceae1(1)000000
CauliflowerBrassica oleraceaBrassicaceae1 (1)000000
ChrysanthemumChrysanthemum indicumAsteraceae1 (1)000000
CorianderCoriandrum sativumApiaceae1001000
Elephant earColocasia esculentaAraceae1100000
Italian ParsleyPetroselinum crispumApiaceae1 (1)000000
JackfruitArtocarpus heterophyllusMoraceae1 (1)000000
LavenderLavandula angustifoliaLamiaceae1001000
LeekAllium ampeloprasumAmaryllidaceae1 (1)000000
LilyLiliumLamiaceae1010000
MustardBrassica nigraBrassicaceae1010000
Napa cabbageBrassica rapaBrassicaceae1001000
PeachPrunus persicaRosaceae1 (1)000000
TurnipBrassica rapaBrassicaceae1001000
Water spinachIpomoea aquaticaConvolvulaceae1001000
Wild tomatoSolanum capsicoidesSolanaceae1010000
ZucchiniCucurbita pepoCucurbitaceae1 (1)000000

a Number of samples that were collected from each of the crops, with the number between parentheses representing the number of sample negative for Meloidogyne species infection.

Figure 4:

Distribution of Meloidogyne species by crop found in this study.

Figure 5:

Bayesian 50% majority-rule consensus tree inferred from mitochondrial DNA DNA fragment of cytochrome c oxidase subunit II to large subunit 16S rRNA genes from C2F3/1108 primer set. Populations of Meloidogyne enterolobii obtained in this study are represented in bold. GenBank accession number proceed species and origin. *Recently reclassified as Meloidogyne luci (Stare et al., 2017).

Figure 6:

Bayesian 50% majority-rule consensus tree inferred from mitochondrial DNA fragment of partial l-rRNA gene from TRNAH/MRH106 primer set. Meloidogyne enterolobii from this study are represented in bold. Branch lengths represent means of posterior distribution. GenBank accession number precedes species and origin. *Recently reclassified as Meloidogyne luci (Stare et al., 2017).

DOI: https://doi.org/10.2478/jofnem-2024-0042 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Submitted on: May 23, 2024
Published on: Jan 24, 2025
Published by: Society of Nematologists, Inc.
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2025 Gabrieli Riva, Janete A. Brito, Clemen de Oliveira, Marcus Marin, Mengyi Gu, Hung Xuan Bui, Johan Desaeger, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.