Have a personal or library account? Click to login
Multiplication, morphological responses and related gene expression to salt stress in protocorm-like bodies of Dendrobium orchids in vitro Cover

Multiplication, morphological responses and related gene expression to salt stress in protocorm-like bodies of Dendrobium orchids in vitro

Open Access
|Sep 2025

Figures & Tables

Figure 1.

Total number (A), total fresh weight (B) and photographs (C) of PLBs of Dendrobium Sonia 'Earsakul' and 'Jindasweet' cultured in liquid medium (control) or medium supplemented with 150 mM NaCl for 0, 2, 4 and 6 weeks. PLB numbers were categorised by size of diameter: S (<0.5 cm), M (0.5–1.0 cm) and L (>1.0 cm). All data are presented as the means of independent samples (n = 5). The error bars indicated ± standard error. A single asterisk (*) indicates significant difference at p < 0.05, and double asterisks (**) indicate p < 0.01, and triple asterisks (***) indicate p < 0.001 according to a t-test for each cultivar. PLBs, protocorm-like bodies.
Total number (A), total fresh weight (B) and photographs (C) of PLBs of Dendrobium Sonia 'Earsakul' and 'Jindasweet' cultured in liquid medium (control) or medium supplemented with 150 mM NaCl for 0, 2, 4 and 6 weeks. PLB numbers were categorised by size of diameter: S (<0.5 cm), M (0.5–1.0 cm) and L (>1.0 cm). All data are presented as the means of independent samples (n = 5). The error bars indicated ± standard error. A single asterisk (*) indicates significant difference at p < 0.05, and double asterisks (**) indicate p < 0.01, and triple asterisks (***) indicate p < 0.001 according to a t-test for each cultivar. PLBs, protocorm-like bodies.

Figure 2.

EL of PLBs of Dendrobium Sonia 'Earsakul' and 'Jindasweet' cultured in liquid medium (control) or medium supplemented with 150 mM NaCl for 2, 4 and 6 weeks. All data are presented as the means of independent samples (n = 5). The error bars indicate ± standard error. A single asterisk (*) indicates a significant difference at p < 0.05, double asterisks (**) indicate p < 0.01 and triple asterisks (***) indicate p < 0.001 according to a t-test for each cultivar. PLBs, protocorm-like bodies. EL, electrolyte leakage.
EL of PLBs of Dendrobium Sonia 'Earsakul' and 'Jindasweet' cultured in liquid medium (control) or medium supplemented with 150 mM NaCl for 2, 4 and 6 weeks. All data are presented as the means of independent samples (n = 5). The error bars indicate ± standard error. A single asterisk (*) indicates a significant difference at p < 0.05, double asterisks (**) indicate p < 0.01 and triple asterisks (***) indicate p < 0.001 according to a t-test for each cultivar. PLBs, protocorm-like bodies. EL, electrolyte leakage.

Figure 3.

Representative PLBs and their histology by a longitudinal section of PLBs of Dendrobium Sonia 'Earsakul' (A–D) and 'Jindasweet' (E–H), cultured in liquid medium (control, A, C, E, G) or medium supplemented with 150 mM NaCl (B, D, F, H) for 6 weeks. White and black scale bars represent 1 cm and 500 μm, respectively. PLBs, protocormlike bodies; SAM, shoot apical meristem.
Representative PLBs and their histology by a longitudinal section of PLBs of Dendrobium Sonia 'Earsakul' (A–D) and 'Jindasweet' (E–H), cultured in liquid medium (control, A, C, E, G) or medium supplemented with 150 mM NaCl (B, D, F, H) for 6 weeks. White and black scale bars represent 1 cm and 500 μm, respectively. PLBs, protocormlike bodies; SAM, shoot apical meristem.

Figure 4.

Pigment contents including chlorophyll a (A), b (B), total chlorophyll (C) and carotenoid (D) in PLBs of Dendrobium Sonia 'Earsakul' and 'Jindasweet' cultured in liquid medium (control) or medium supplemented with 150 mM NaCl for 2, 4 and 6 weeks. The contents are fresh weight. All data are presented as the means of independent samples (n = 5). The error bars indicate ± standard error. A single asterisk (*) indicates a significant difference at p < 0.05, double asterisks (**) indicate p < 0.01 and triple asterisks (***) indicate p < 0.001 according to a t-test for each cultivar. PLBs, protocorm-like bodies.
Pigment contents including chlorophyll a (A), b (B), total chlorophyll (C) and carotenoid (D) in PLBs of Dendrobium Sonia 'Earsakul' and 'Jindasweet' cultured in liquid medium (control) or medium supplemented with 150 mM NaCl for 2, 4 and 6 weeks. The contents are fresh weight. All data are presented as the means of independent samples (n = 5). The error bars indicate ± standard error. A single asterisk (*) indicates a significant difference at p < 0.05, double asterisks (**) indicate p < 0.01 and triple asterisks (***) indicate p < 0.001 according to a t-test for each cultivar. PLBs, protocorm-like bodies.

Figure 5.

Relative expressions of CDKA1, TUBB3, EXP, CKX1, rbcL and LEA2 in PLBs of Dendrobium Sonia 'Earsakul' and 'Jindasweet' cultured in liquid medium (control) or medium supplemented with 150 mM NaCl for 24 h. EF1-a was used as a reference gene. All data are presented as the means of independent samples (n = 3). The error bars indicate ± standard error. A single asterisk (*) indicates a significant difference at p < 0.05, double asterisks (**) indicate p < 0.01 and triple asterisks (***) indicate p < 0.001 according to a t-test for each cultivar. PLBs, protocorm-like bodies.
Relative expressions of CDKA1, TUBB3, EXP, CKX1, rbcL and LEA2 in PLBs of Dendrobium Sonia 'Earsakul' and 'Jindasweet' cultured in liquid medium (control) or medium supplemented with 150 mM NaCl for 24 h. EF1-a was used as a reference gene. All data are presented as the means of independent samples (n = 3). The error bars indicate ± standard error. A single asterisk (*) indicates a significant difference at p < 0.05, double asterisks (**) indicate p < 0.01 and triple asterisks (***) indicate p < 0.001 according to a t-test for each cultivar. PLBs, protocorm-like bodies.

Primers for gene expression analysis by qRT-PCR_

GeneForward primer (5′-3′)Reverse primer (5′-3′)Accession No.Reference
CDKA1TTCTCCGTGGCATTGCTTACTGTCCAAGGAGGATTTCTGGTGCTHQ904083.1Zhang et al. (2012)
TUBB3CCGTTGTGGAACCATACAATGCGTAGCCGAGATGAGGTGATTGAKX524085.1An et al. (2016)
EXPAAAGGAGGGATTCGGTTCACACGAGTTGCTTTGCCAATTCKM408748.1-
CK1TCTCCCCTCACTCATTCACCGCCCCAGCATCTACAAACATAJ294542-
rbcLTGTCTACGGGGTGGACTTGAAGCCAGGCTAGTATTTGCGGAB519791.1-
LEA2ATGAGGAGAAGGGTGGCTTCACACAAGCTTCCTCCCATCAKY626329.1-
EF1-aTCAGGCTGACTGTGCTGTCCTGTGGTGGCGTCCATCTTGTT Zhang et al. (2012)
DOI: https://doi.org/10.2478/fhort-2025-0015 | Journal eISSN: 2083-5965 | Journal ISSN: 0867-1761
Language: English
Page range: 197 - 208
Submitted on: Apr 11, 2025
|
Accepted on: Jul 10, 2025
|
Published on: Sep 24, 2025
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year

© 2025 Wannida Sae-Tang, Anongpat Suttangkakul, Hathairath Jindamol, Duangporn Boonchai, Patchareeya Boonkorkaew, published by Polish Society for Horticultural Sciences (PSHS)
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.