Have a personal or library account? Click to login
MAP kinase and plant–pathogen interactions govern male Zizania latifolia responses to Ustilago esculenta during the early stages of infection Cover

MAP kinase and plant–pathogen interactions govern male Zizania latifolia responses to Ustilago esculenta during the early stages of infection

Open Access
|Jun 2023

Figures & Tables

Figure 1.

Clustering heat map of DEGs. (A) CK-3 hr vs. TR-3 hr; (B) CK-12 hr vs. TR-12 hr; and (C) CK-24 hr vs. TR-24 hr. Red indicates upregulation whereas green indicates downregulation, and the darker the colour, the greater the up- or downregulation. DEGs, differentially expressed genes.
Clustering heat map of DEGs. (A) CK-3 hr vs. TR-3 hr; (B) CK-12 hr vs. TR-12 hr; and (C) CK-24 hr vs. TR-24 hr. Red indicates upregulation whereas green indicates downregulation, and the darker the colour, the greater the up- or downregulation. DEGs, differentially expressed genes.

Figure 2.

qPCR verification of DEGs. (A) qPCR analysis of DEGs. Orange represents the treatment group and green represents the control group. (B) Differential gene expression heatmap of transcriptome sequencing data. Orange indicates upregulation whereas green indicates downregulation, and the darker the colour, the more obvious the greater the up or downregulation. DEGs, differentially expressed genes; qPCR, quantitative PCR.
qPCR verification of DEGs. (A) qPCR analysis of DEGs. Orange represents the treatment group and green represents the control group. (B) Differential gene expression heatmap of transcriptome sequencing data. Orange indicates upregulation whereas green indicates downregulation, and the darker the colour, the more obvious the greater the up or downregulation. DEGs, differentially expressed genes; qPCR, quantitative PCR.

Figure 3.

Correlation heatmap of the gene expression network module and different processes (A), and KEGG pathway analysis results of MEturquoise modules (B). (A) The abscissa represents samples, and the ordinate represents modules. The number of each block represents the correlation between modules and samples; the closer the value is to 1, the stronger the positive correlation between modules and samples; the closer the value is to −1, the stronger the negative correlation. The number in brackets represents the significance p-value; the lower the number, the stronger the significance. The darker the colour of the square (the redder), the stronger the correlation; the lighter the colour, the weaker the correlation. KEGG, Kyoto Encyclopedia of Genes and Genomes.
Correlation heatmap of the gene expression network module and different processes (A), and KEGG pathway analysis results of MEturquoise modules (B). (A) The abscissa represents samples, and the ordinate represents modules. The number of each block represents the correlation between modules and samples; the closer the value is to 1, the stronger the positive correlation between modules and samples; the closer the value is to −1, the stronger the negative correlation. The number in brackets represents the significance p-value; the lower the number, the stronger the significance. The darker the colour of the square (the redder), the stronger the correlation; the lighter the colour, the weaker the correlation. KEGG, Kyoto Encyclopedia of Genes and Genomes.

Figure 4.

Analysis of important pathways in CK-3 hr vs. TR-3 hr. (A) Analysis of ‘plant–pathogen interaction’ pathways. (B) Analysis of ‘MAPK signalling pathway-plant’ pathways. Red indicates the treatment group (TR-3 hr) whereas green the control group (CK-3 hr).
Analysis of important pathways in CK-3 hr vs. TR-3 hr. (A) Analysis of ‘plant–pathogen interaction’ pathways. (B) Analysis of ‘MAPK signalling pathway-plant’ pathways. Red indicates the treatment group (TR-3 hr) whereas green the control group (CK-3 hr).

Figure 5.

Analysis of differential gene expression in ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways. (A) qPCR verification of DEGs. Orange indicates the treatment group whereas green indicates the control group. (B) Differential gene expression heatmap of transcriptome sequencing data. Orange indicates upregulation whereas green indicates downregulation, and the darker the colour, the greater the up or downregulation. qPCR, quantitative PCR.
Analysis of differential gene expression in ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways. (A) qPCR verification of DEGs. Orange indicates the treatment group whereas green indicates the control group. (B) Differential gene expression heatmap of transcriptome sequencing data. Orange indicates upregulation whereas green indicates downregulation, and the darker the colour, the greater the up or downregulation. qPCR, quantitative PCR.

Figure S1.

Volcano map of DEGs at 3 hr, 12 hr and 24 hr after inoculation with U. esculenta. DEGs, differentially expressed genes.
Volcano map of DEGs at 3 hr, 12 hr and 24 hr after inoculation with U. esculenta. DEGs, differentially expressed genes.

Figure S2.

GO enrichment and KEGG pathway analyses of DEGs after inoculation. (A) GO enrichment at 3 hr after inoculation. (B) GO enrichment 12 hr after inoculation. (C) GO enrichment 24 hr after inoculation. (D) KEGG pathways at 3 hr after inoculation. (E) KEGG pathways at 12 hr after inoculation. (F) KEGG pathways at 24 hr after inoculation. DEGs, differentially expressed genes; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.
GO enrichment and KEGG pathway analyses of DEGs after inoculation. (A) GO enrichment at 3 hr after inoculation. (B) GO enrichment 12 hr after inoculation. (C) GO enrichment 24 hr after inoculation. (D) KEGG pathways at 3 hr after inoculation. (E) KEGG pathways at 12 hr after inoculation. (F) KEGG pathways at 24 hr after inoculation. DEGs, differentially expressed genes; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Figure S3.

Statistics of differentially expressed transcription factor after inoculation. Red indicates upregulation whereas blue indicates downregulation, and the numbers indicates the number of transcription factors. (A) 3 hr after inoculation. (B) 24 hr after inoculation.
Statistics of differentially expressed transcription factor after inoculation. Red indicates upregulation whereas blue indicates downregulation, and the numbers indicates the number of transcription factors. (A) 3 hr after inoculation. (B) 24 hr after inoculation.

Real-time fluorescence qPCR primers for candidate genes

Gene nameForward primer (5′ – 3′)Reverse primer (5′ – 3′)
Zlat_10042236AGTGGTGACTCTGGAATTGGG-CCCATGAGTGTGTTGTGATCT
Zlat_10016445CATGGAAGGAAGGCAGATACCAAAGCCACCCTCACCTATT
Zlat_10028687GAGTCAAGACAGGGAGTAAAGGCCTTCCACACAATAGCCATAAAG
Zlat_10030446GCAGAGAATCACAGTTGAGGAGGCTTCATCTGGTCCTCGTTTAG
Zlat_10002195TAT-CCACCTCACGCCCAGTTA-TCCTTGACGACGCCTCC
Zlat_10008237TCCTACTCAGACTTCTCGTTCCCTGCTGCTGCTGACATCTATAC
Zlat_10020312CACGACAACGAGAACTCCGATCTCAATCTCCGACCT
Zlat_10028790GGATTCCAAGAGATGGAGGAAAGTCGATGTCGCTCATGGTTTG
Zlat_10045823GC-TGACCACCAAATCTTCGACTACGCTCATGGAGTTCTCGTTGT
Zlat_10008367C-TATGTGCACGGCAGATGTTC-GCTTGTAATGACGCTCCTATC
Zlat_10029338AACGTGTTGTGGCGCTTATTGCAGCCCGTTCAAACT
Zlat_10007178GACAAGACGGTGGTATGGTATGGGGATCTCGAAGAGAAAGAACC
Zlat_10004780G-ACAAGGCGGGCTCTTATTTGGTACTAGGAGTTGCTGTGAAG
Zlat_10023424CAAGTAGGTCAGGGTGGATTTGCTTGTTTGGTGCCAGGAGT
Zlat_10024926GCAGAGAATCACAGTTGAGGAGGCTTCATCTGGTCCTCGTTTAG
Zlat_10004358TGGGTATCAATGGCGGAAGCCTTCTTCTTCACCGGACAC
Zlat_10003815ACGGAAGGCAACGTTTGAGGTCGAAAGCTGGGTAGTATG
ZlActin2C-TAACCGGCCACGTGTATTTAGAGCAGAGGCATTCCAAGT

Real-time fluorescence qPCR primers for transcriptome data validation

Gene nameForward primer (5′ – 3′)Reverse primer (5′ – 3′)
Zlat_10042605GCTTGTTCCTCCTCGTCATCTT-GACGGCGAAGGGAGGTT
Zlat_10032950CCAACACCAACCTCAACTACGA-CGGAGATCCTGATGCCTAC
Zlat_10047488CGTGGTATCGGAGACAGGGTCG-GAAGAGAGCGAAGAGGTACACG
Zlat_New_3742ACCAACACGACGACCAGACTAAGAAGAGCACCGCCAATG
Zlat_10042236AGTGGTGACTCTGGAATTGGG-CCCATGAGTGTGTTGTGATCT
Zlat_10016445CATGGAAGGAAGGCAGATACCAAAGCCACCCTCACCTATT
Zlat_10028687GAGTCAAGACAGGGAGTAAAGGCCTTCCACACAATAGCCATAAAG
Zlat_10035043CGTGGATTGGGCAACCTTCTTCTTGTTCTCCTCGCTCG
Zlat_10006234GTGACGGCGACCAACTTCTT-GAGTGCCCGTTGATGGTG
Zlat_10018519GTGGAAGGGTATGGCAGTGC-AGATTCGGGTTTGGTAGGC
Zlat_10014566ATCACCGCCACCAACCTT-CCTCCCTTCTTCACGCAC
Zlat_10002874GGAGTATCTCCACCTACCTGTCTCCGTCGTCGTATTCTTCGTCT
Zlat_10042726TT-GGCTTCTTCCCTCTCCTCCCGGTGAAGTCAGAGGCGTT
Zlat_10026152GTGGGTGGACGAGAAGAAGTCAGCCGATGAGGATGGAGT
Zlat_10045237A-TGTGGCAGTCGTGTCCGTA-CGTTGAACAGGGGCTCGT
Zlat_10002801ACGACAGAGGAACTGAAGGACTTCGTGTTGAGGATTTGGAGG
Zlat_10020429ACGGGCTCACCTACACCAACT-ACAGCCGACGTGGTCGAT
Zlat_10020427T-CCTACCCTGGTGTCTCCTTCT-CCGTGGACACCTTGATGC
Zlat_10001037T-ATTCACCTCCCACACTCAGCCCATCACCACCTATCTTCAAGC
Zlat_10009720CATCGCCTTCTCCCTCATGGTTCCAGGGTTGATTGC
ZlActin2C-TAACCGGCCACGTGTATTTAGAGCAGAGGCATTCCAAGT

Information on candidate genes related to ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways in male Z_ latifolia in response to U_ esculenta infection

Gene IDLog2(FC)Genetic traitsHomologous gene
Zlat_100293381.16LRR receptor-like serine/threonine-protein kinase FLS2AT5G46330
Zlat_100422361.30LRR receptor-like serine/threonine-protein kinase FLS2AT5G46330
Zlat_100047801.32BAK1AT4G33430
Zlat_100071781.10BAK1AT4G33430
Zlat_100164451.06BAK1AT4G33430
Zlat_100234241.48BAK1AT4G33430
Zlat_100286871.20BAK1AT4G33430
Zlat_100249261.02Mitogen-activated protein kinase 3AT3G45640
Zlat_100304461.49Mitogen-activated protein kinase 3AT3G45640
Zlat_100021951.24WRKY33AT2G38470
Zlat_100043582.72WRKY33AT2G38470
Zlat_100082372.02WRKY33AT2G38470
Zlat_100203121.60WRKY33AT2G38470
Zlat_100287901.85WRKY33AT2G38470
Zlat_100083671.52WRKY33AT2G38470
Zlat_100458231.59Senescence-induced receptor-like serine/threonine-protein kinase (FRK1)AT2G19190
DOI: https://doi.org/10.2478/fhort-2023-0011 | Journal eISSN: 2083-5965 | Journal ISSN: 0867-1761
Language: English
Page range: 149 - 162
Submitted on: Nov 1, 2022
|
Accepted on: Mar 7, 2023
|
Published on: Jun 26, 2023
In partnership with: Paradigm Publishing Services
Publication frequency: 2 issues per year

© 2023 Pengfei Guo, Huimin Zhou, Longfei Bai, Yayu Lin, Yalong Zhang, Bichen Wang, Xiaomei He, Defang Gan, published by Polish Society for Horticultural Sciences (PSHS)
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.