Zizania latifolia is a perennial aquatic herb, the swollen stems of which are a delicious vegetable (called Jiaobai in China) when infected by Ustilago esculenta. Z. latifolia is very popular in North America and East Asia due to its nutritional and medicinal value (Yu et al., 2020; Wang et al., 2020a). U. esculenta is an endophytic smut fungus that invades Z. latifolia and induces host stems to form swollen culm galls. Three phenotypes of Z. latifolia have been identified in the field: male Jiaobai (without U. esculenta infection, with no galls but normal flowering), grey Jiaobai (inedible galls filled with dark teliospores, with an unacceptable taste) and normal Jiaobai (edible swollen galls in stem bases filled with hyphae). These three phenotypes are closely related to the growth status of U. esculenta in Z.latifolia (Wang et al., 2020b). Male Jiaobai is free from U. esculenta infection, grey Jiaobai is formed following infection with the T strain and normal Jiaobai contains the M-T (mycelial) strain of U. esculenta (Ye et al., 2017). Grey Jiaobai and male Jiaobai have no economic value in cultivation, and are removed manually (Zhang et al., 2021). Research shows that population diversity or physiological race differentiation of U. esculenta may exist among Z. latifolia plants (Tu et al., 2019). The molecular mechanism underpinning the male Z. latifolia responses to U. esculenta infection remains unknown, although the mechanism of swelling and stem enlargement in infected Z. latifolia has been a focus of attention (Li et al., 2021, 2022; Zhang et al., 2021).
Proteomic studies have explored the stem expansion process of Z. latifolia. The number and expression level of unique proteins in stems of Z. latifolia at different developmental stages vary significantly, suggesting that formation of the fleshy stem bases of Z. latifolia result from interactions between the plant and the endophytic fungus (Liu et al., 2010). Wang et al. (2017) reported transcriptome assembly and expression profiles based on RNA sequencing (RNA-Seq) data, identified genes responsible for culm gall formation in Z. latifolia induced by U. esculenta, and detected 8,089 genes (4,389 upregulated, 3,700 downregulated) and 5,251 genes (3,121 upregulated, 2,130 downregulated) differentially expressed in JB and HJ, respectively. The authors also identified 376 host and 187 fungal candidate genes displaying stage-specific expression patterns that might be responsible for gall formation at the initial and later phases, respectively (Wang et al., 2017). Jose et al. (2019) detected differentially expressed proteins in response to local smut formation during the interaction between Z. latifolia and U. esculenta, and found that the fungus participates in at least seven metabolic pathways and five major biological processes in order to subdue host defences and colonise Z. latifolia tissues. A further study found that U. esculenta produced proteases and energy acquisition proteins that enhanced its defences and survival in the host (Jose et al., 2019).
In our previous studies on the Z. latifolia–U. esculenta interaction, we established an in vitro regeneration system for Z. latifolia, and carried out inoculation experiments with U. esculenta (Yang, 2018). We also studied the physiological responses of male Z. latifolia to U. esculenta infection, and found that expression of most enzymes was significantly different at 3 hr or 12 hr post-infection, suggesting that responses of Z. latifolia to U. esculenta infection mainly occurred in the early stages of the colonisation process (Zhou, 2021). However, the mechanism underpinning the interaction between U. esculenta and Z. latifolia that leads to enlargement of swollen stem galls remains unclear. In order to explore the molecular mechanisms of the Z. latifolia responses to U. esculenta infection, male (uninfected) Z. latifolia plants at the five-leaf stage were used as experimental material. Transcriptome sequencing and identification of differentially expressed genes (DEGs) were performed on leaves at different timepoints after inoculation, and candidate genes of male Z. latifolia potentially involved in the responses to U. esculenta infection were screened. This work provides an important baseline for subsequent studies into the mechanism of culm gall formation in Z. latifolia.
Male Z. latifolia plants at the five-leaf stage were injected with the resulting U. esculenta cell suspension (TR), while male Jiaobai plants injected with potato dextrose liquid medium served as controls (CK). Inoculation and sampling were performed as described previously in the studies of Zhou (2021) and Xu et al. (2023). Male Z. latifolia leaves at 3 hr, 12 hr and 24 hr (TR-3 hr, TR-12 hr and TR-24 hr) after inoculation and controls (CK) were frozen in liquid nitrogen. Total RNA was extracted using an RNAprep Pure Plant Kit (Tiangen Biotech [Beijing] Co. Ltd., Beijing, China), and mRNA was purified by magnetic beads with Oligo dT. Transcriptome sequencing was conducted by Beijing Biomarker Technologies Co. Ltd. (Beijing, China). To ensure the accuracy of the analysis, strict quality control was exercised in relation to the original data. Reads containing joints, reads with a proportion of N >10%, reads with a mass value of Q ≤10, and alkali bases accounting for >50% of the whole read were removed. The remaining reads were aligned against the Z. latifolia genome database (http://ibi.zju.edu.cn/ricerelativesgd/download.php). The HSAT2 system was used for comparison, and StringTie software (https://ccb.jhu.edu/software/stringtie/index.shtml) was used to assemble and quantify the data. Three biological replicates were included, and r (Spearman’s correlation coefficient) was used to evaluate the correlation of biological replicates. The closer r2 is to 1, the higher the correlation between biological replicates, and the more reliable the results. DEGs among sample groups (CK-3 hr vs. TR-3 hr, CK-12 hr vs. TR-12 hr and CK-24 hr vs. TR-24 hr) were analysed using DESeq2 software (Love et al., 2014). Among the comparisons, CK-3 hr vs. TR-3 hr represents the comparison between the treatment group (TR-3 hr) and the control group (CK-3 hr) at 3 hr after inoculation. DEGs were screened using the criteria of a fold change in expression level of ≥2 and p ≤ 0.05 for up- and downregulated genes.
Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were performed to clarify the biological functions of DEGs. The Goseq R package (Young et al., 2010) was used for GO enrichment analysis of DEGs, and KOBAS software (Bu et al., 2021) was used to assess pathways enriched in DEGs. The plant TF database (PlantTFDB, http://planttfdb.gao-lab.org/index.php) was used to identify TFs among DEGs, and the number of TFs and their families were obtained.
Twenty DEGs were selected and real-time fluorescence quantitative PCR (qPCR) was used to confirm the reliability of the transcriptome data. Total RNA from male Z. latifolia leaves of the same batch was extracted with ReverTra Ace qPCR RT Master Mix (Code No. FSQ-201: Toyobo [Shanghai] Biotechnology Co., Ltd., Shanghai, China) and reverse-transcribed into cDNA. Specific primers were designed with Primer Premier 5.0 (Kakhki et al., 2019). Sequences of primers are shown in Table S1 in Supplementary Materials. A CFX96 Real-time System (BIO-RAD, CA, USA) and TB Green Premix Ex Taq II fluorescent reagent (Takara, Dalian City, China) were used for detection following the manufacturer’s instructions, and ZlActin2 served as an internal reference gene (Wang et al., 2017). The 2-ΔΔCq method (Zhou et al., 2020), where ΔCq = Cq (gene of interest) – Cq (Actin2) and ΔΔCq = ΔCq (treatment, inoculated with U. esculenta) – ΔCq (CK, inoculated with potato dextrose liquid medium), was used to estimate the relative expression levels of DEGs.
WGCNA was used to cluster differential genes with common expression and high correlations into the same module, then select target modules; KEGG enrichment analysis was then performed on the target module to identify important metabolic pathways, the complete metabolic pathway was drawn and relevant DEGs were screened. DEGs were detected by qPCR using the primers shown in Table 1. Combined with the transcriptome results, candidate genes of male Z. latifolia involved in response to infection by U. esculenta were determined.
Real-time fluorescence qPCR primers for candidate genes
| Gene name | Forward primer (5′ – 3′) | Reverse primer (5′ – 3′) |
|---|---|---|
| Zlat_10042236 | AGTGGTGACTCTGGAATTGG | G-CCCATGAGTGTGTTGTGATCT |
| Zlat_10016445 | CATGGAAGGAAGGCAGATAC | CAAAGCCACCCTCACCTATT |
| Zlat_10028687 | GAGTCAAGACAGGGAGTAAAGG | CCTTCCACACAATAGCCATAAAG |
| Zlat_10030446 | GCAGAGAATCACAGTTGAGGAG | GCTTCATCTGGTCCTCGTTTAG |
| Zlat_10002195 | TAT-CCACCTCACGCCCAGT | TA-TCCTTGACGACGCCTCC |
| Zlat_10008237 | TCCTACTCAGACTTCTCGTTCC | CTGCTGCTGCTGACATCTATAC |
| Zlat_10020312 | CACGACAACGAGAACTCC | GATCTCAATCTCCGACCT |
| Zlat_10028790 | GGATTCCAAGAGATGGAGGAAAG | TCGATGTCGCTCATGGTTTG |
| Zlat_10045823 | GC-TGACCACCAAATCTTCGACTAC | GCTCATGGAGTTCTCGTTGT |
| Zlat_10008367 | C-TATGTGCACGGCAGATGTT | C-GCTTGTAATGACGCTCCTATC |
| Zlat_10029338 | AACGTGTTGTGGCGCTTA | TTGCAGCCCGTTCAAACT |
| Zlat_10007178 | GACAAGACGGTGGTATGGTATG | GGGATCTCGAAGAGAAAGAACC |
| Zlat_10004780 | G-ACAAGGCGGGCTCTTATTT | GGTACTAGGAGTTGCTGTGAAG |
| Zlat_10023424 | CAAGTAGGTCAGGGTGGATTTG | CTTGTTTGGTGCCAGGAGT |
| Zlat_10024926 | GCAGAGAATCACAGTTGAGGAG | GCTTCATCTGGTCCTCGTTTAG |
| Zlat_10004358 | TGGGTATCAATGGCGGAAG | CCTTCTTCTTCACCGGACAC |
| Zlat_10003815 | ACGGAAGGCAACGTTTGA | GGTCGAAAGCTGGGTAGTATG |
| ZlActin2 | C-TAACCGGCCACGTGTATTT | AGAGCAGAGGCATTCCAAGT |
qPCR, quantitative PCR.
Microsoft Excel 2016 software (Microsoft Corp., Redmond, WA, USA) was used for basic processing of test data, IBM SPSS statistics 25 software (Jackson and Ukwe, 2022) was used for analysis of variance (p ≤ 0.05 indicated statistical significance), and SigmaPlot 14.0 (Khata et al., 2019) and Origin 2019b 32bit (Rusnac et al., 2021) were used for mapping.
DEGs in treatment and control groups were statistically analysed using DESeq2 software with screening criteria of fold change ≥2 and p ≤ 0.05. The results showed that there were 934 DEGs at 3 hr after inoculation, including 530 upregulated and 404 downregulated genes; there were 34 DEGs at 12 hr after inoculation, including 10 upregulated and 24 downregulated genes; and there were 258 DEGs at 24 hr after inoculation, including 127 upregulated and 131 downregulated genes (Figure S1 in Supplementary Materials).
A total of 1,226 DEGs were identified in the three comparison groups (CK-3 hr vs. TR-3 hr, CK-12 hr vs. TR-12 hr and CK-24 hr vs. TR-24 hr), and hierarchical cluster analysis was carried out according to the fragments per kilobase of exon per million mapped fragments (FPKM) values of DEGs. The results showed that the three biological repeats of treatment and control groups were clustered together at each timepoint, indicating tight correlations and reliable results that could be used for subsequent analysis (Figure 1).

Clustering heat map of DEGs. (A) CK-3 hr vs. TR-3 hr; (B) CK-12 hr vs. TR-12 hr; and (C) CK-24 hr vs. TR-24 hr. Red indicates upregulation whereas green indicates downregulation, and the darker the colour, the greater the up- or downregulation. DEGs, differentially expressed genes.
The top 20 GO nodes with the most significant enrichment p-values were selected to annotate the GO functions of DEGs. The results showed that in the CK-3 hr vs. TR-3 hr comparison, the major enriched genes were linked to membrane component, response to stimulation, ATP binding, stress response, protein kinase activity and response to abiotic stress categories, indicating that these genes might participate in the early defence response of male Z. latifolia to U. esculenta (Figure S2A in Supplementary Materials). In the CK-12 hr vs. TR-12 comparison, the major enriched genes were associated with transmembrane transporter activity, transmembrane transport, heme binding, DNA template and extracellular domain categories, which suggested that U. esculenta infection might affect the structure and the function(s) of the cell wall/external surface of male Z. latifolia (Figure S2B in Supplementary Materials). In the CK-24 hr vs. TR-24 hr comparison, the most enriched genes were related to the cell periphery, vacuole, cell wall, thermal reaction, cadmium ion, external packaging structure and host cell nucleus categories, which suggested that gene enrichment influenced plant defences and possibly other functions involved in the regulation of Z. latifolia response to U. esculenta infection (Figure S2C in Supplementary Materials).
Pathway analysis of compared DEGs revealed that the number of pathways enriched in the CK-3 hr vs. TR-3 hr comparison was the most (100), followed by CK-24 hr vs. TR-24 hr (65) and CK-12 hr vs. TR-12 hr (13). At 3 hr after inoculation, the most enriched DEGs were related to the plant–pathogen interaction pathway, indicating that these genes play a key role in the interaction between male Z. latifolia and U. esculenta. DEGs were also enriched in MAPK signal pathway-plant, diterpene biosynthesis, and flavone and flavanol biosynthesis pathways, all of which are related to plant defence responses (Figure S2D in Supplementary Materials). At 12 hr after inoculation with U. esculenta (CK-12 hr vs. TR-12 hr), there were few DEGs, and the most enriched category was sesquiterpenoid and triterpenoid biosynthesis. Additionally, there were a small number of DEGs enriched in glucosinolate biosynthesis, plant–pathogen interaction, flavonoid biosynthesis and cyano amino acid metabolism, and other pathways, which may also participate in the defence response of male Z. latifolia (Figure S2E in Supplementary Materials). At 24 hr after inoculation (CK-24 hr vs. TR-24 hr), DEGs were enriched in vitamin B6 metabolism, terpenoid main chain biosynthesis, glycine, serine and threonine metabolism, alanine, aspartic acid and glutamate metabolism, tropine, piperidine and pyridine alkaloid biosynthesis, and valine, leucine and isoleucine biosynthesis, all of which are related to primary plant metabolism, indicating that Z. latifolia reorganises primary metabolism following U. esculenta infection. Additionally, there was enrichment of some DEGs related to photosynthesis, plant circadian rhythm, carotenoid biosynthesis and other pathways that may also affect the primary metabolic pathways of male Z. latifolia. Some DEGs were enriched in fructose and mannose metabolism, galactose metabolism and other pathways, suggesting that U. esculenta infection also affects the sugar metabolism of its host plant (Figure S2F in Supplementary Materials).
In order to predict the TFs mediating the responses of male Z. latifolia to U. esculenta infection, the PlantTFDB was used to analyse DEGs in CK-3 hr vs. TR-3 hr, CK-12 hr vs. TR-12 hr and CK-24 hr vs. TR-24 hr comparisons. A total of 139 TF genes were identified in the three groups, of which the number of TF genes in the CK-3 hr vs. TR-3 hr comparison was the largest (110), followed by CK-24 hr vs. TR-24 hr (28), and there was only one DEG in the CK-12 hr vs. TR-12 hr comparison (Figure S3 in Supplementary Materials). DEGs at 3 hr after inoculation (CK-3 hr vs. TR-3 hr) were mainly enriched in WRKY (22 members; 19 upregulated, 3 downregulated), NAC (NAM, ATAF1/2, CUC2; 15 members; 11 upregulated, 4 downregulated), basic helix-loop-helix (bHLH; 8 members; 7 upregulated, 1 downregulated), basic leucine zipper (bZIP; 3 members; 1 upregulated, 2 downregulated), MYB (v-myb avian myeloblastosis viral oncogene homologue; 10 members; 6 upregulated, 4 downregulated), MYB-related (6 members; 2 upregulated, 4 downregulated) and other TF families (Figure S3 in Supplementary Materials). At 12 hr after inoculation (CK-12 hr vs. TR-12 hr), there was only one differential TF gene, belonging to the NAC family, which was downregulated. At 24 hr after inoculation (CK-24 hr vs. TR-24 hr), DEGs belonged to bHLH (7 members; 2 upregulated, 5 downregulated), MYB (5 members; 1 upregulated, 4 downregulated), NAC (2 members; downregulated), MYB-related (1 member; downregulated), B3 (1 member; downregulated) and other TF families (Figure S3 in Supplementary Materials).
Twenty DEGs were selected, specific primers were designed and the reliability of transcriptome data was assessed by qPCR. The results showed that expression of 19 differential genes was consistent with the transcriptome data, with Zlat_10020427 being the only exception (Figures 2A and 2B). This indicates that the transcriptome data were reliable and could be used for subsequent experimental analysis. Meanwhile, further study is needed to ascertain whether the Zlat_10020427 gene plays an important role in the response of Z. latifolia to U. esculenta infection.

qPCR verification of DEGs. (A) qPCR analysis of DEGs. Orange represents the treatment group and green represents the control group. (B) Differential gene expression heatmap of transcriptome sequencing data. Orange indicates upregulation whereas green indicates downregulation, and the darker the colour, the more obvious the greater the up or downregulation. DEGs, differentially expressed genes; qPCR, quantitative PCR.
WGCNA was used to construct a gene coexpression network, and seven characteristic modules were identified by correlation analysis between gene expression modules and U. esculenta infection. The MEturquoise module was the most interesting module, in which expression patterns for the CK-3 hr vs. TR-3 hr comparison were quite different, while expression patterns for CK-12 hr vs. TR-12 hr and CK-24 hr vs. TR-24 hr comparisons were quite similar (Figure 3A). Therefore, 3 hr after inoculation was identified as an important node for male Z. latifolia responses to U. esculenta infection in the early stages, and the MEturquoise module could be used as the target module for subsequent analysis (Figure 4A). In order to further explore the functions of target module genes, KEGG enrichment analysis of the MEturquoise module was performed, which showed that genes were mainly enriched in the ‘plant–pathogen interaction’ (49) and ‘MAPK signal pathway-plant’ (28) pathways (Figure 3B). These two pathways are directly related to plant defences; hence, we speculated that they may play an important role in the responses of male Z. latifolia to U. esculenta infection.

Correlation heatmap of the gene expression network module and different processes (A), and KEGG pathway analysis results of MEturquoise modules (B). (A) The abscissa represents samples, and the ordinate represents modules. The number of each block represents the correlation between modules and samples; the closer the value is to 1, the stronger the positive correlation between modules and samples; the closer the value is to −1, the stronger the negative correlation. The number in brackets represents the significance p-value; the lower the number, the stronger the significance. The darker the colour of the square (the redder), the stronger the correlation; the lighter the colour, the weaker the correlation. KEGG, Kyoto Encyclopedia of Genes and Genomes.

Analysis of important pathways in CK-3 hr vs. TR-3 hr. (A) Analysis of ‘plant–pathogen interaction’ pathways. (B) Analysis of ‘MAPK signalling pathway-plant’ pathways. Red indicates the treatment group (TR-3 hr) whereas green the control group (CK-3 hr).
DEGs in the ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways were analysed at 3 hr after inoculation. A total of 17 DEGs were identified, consisting of 2 LRR receptor kinase FLS2 (flagellin sensing 2) genes, 5 RLK receptor kinase BAK1 genes, 6 WRKY TFs (WRKY33), 2 MPK3 genes, 1 receptor kinase FRK1 gene and a single 1-aminocyclopropane-1-carboxylic acid synthase ACS6 gene, all of which were upregulated (Figure 4). Regarding ‘MAPK signalling pathway-plant’ pathways, six WRKY33 genes were differentially expressed (Figure 4). We speculated that WRKY33 might be key genes of male Z. latifolia involved in response to U. esculenta infection. Regarding the five receptor kinase BAK1 genes, BAK1 and FLS2 are known to form a dimer that activates the immune response, promotes ROS production and induces allergic reactions in plants, causing callose deposition and thus strengthening the cell wall. Additionally, the BAK1-FLS2 dimer stimulates WRKY33 and MPK3/6 gene expression and upregulates downstream related resistance genes. Additionally, MPK3/6 inhibits the ubiquitination-mediated degradation of ACS6 through phosphorylation modification, and promotes ethylene (ET) synthesis, thereby supporting the response of male Z. latifolia to U. esculenta infection (Figure 4).
In order to further explore the expression of genes related to ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways, total RNA from male Z. latifolia leaves at 3 hr after inoculation was extracted and reverse-transcribed into cDNA. Seventeen DEGs in the above pathways were selected, including two FLS2 genes (Zlat_10042236 and Zlat_10029338), five BAK1 genes (Zlat_10028687, Zlat_10016445, Zlat_10007178, Zlat_10004780 and Zlat_10023424), two MPK3 genes (Zlat_10030446 and Zlat_10024926), six WRKY33 genes (Zlat_10008237, Zlat_10002195, Zlat_10020312, Zlat_10028790, Zlat_10045823 and Zlat_10004358), one FRK1 gene (Zlat_10008367) and one ACS6 gene (Zlat_10003815). Specific primers were designed to measure expression of these genes by qPCR. The results showed that except for one gene (Zlat_10003815), expression of the other 16 genes was upregulated (Figure 5A), consistent with the results of transcriptome analysis (Figure 5B). Relevant information for these 16 candidate genes is listed in Table S2 in Supplementary Materials. These genes might be key players in the male Z. latifolia responses to U. esculenta infection, and their functions should be investigated in the future.

Analysis of differential gene expression in ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways. (A) qPCR verification of DEGs. Orange indicates the treatment group whereas green indicates the control group. (B) Differential gene expression heatmap of transcriptome sequencing data. Orange indicates upregulation whereas green indicates downregulation, and the darker the colour, the greater the up or downregulation. qPCR, quantitative PCR.
Pathogens invading plants are attacked by the plant immune system. Firstly, signal networks such as the MAPK cascade can help plants identify foreign invaders and quickly trigger immune responses to prevent infection (Cheng et al., 2012). Secondly, plant hormones also play an important role in helping plants respond to adverse environments (Verma et al., 2016). For example, gibberellin (GA), abscisic acid (ABA), indole acetic acid (IAA) and cytokinin hormones are related to plant defence signal pathways, and play an important role in regulating plant defence response to pathogen infection (Bari and Jones, 2009). In this study, DEGs were mainly associated with the metabolic pathways of auxins, cytokinins, gibberellins, abscisic acid, brassinosteroids and jasmonic acid. Among them, brassinosteroid pathways accounted for the most (12) DEGs (9 upregulated, 3 downregulated), followed by auxin (2 upregulated, 5 downregulated) and jasmonic acid pathway (6 upregulated, 1 downregulated), but further investigation is needed to ascertain whether these genes participate in the response process. Additionally, phenylpropane derivatives participate in the biosynthesis of lignin or flavonoids, and can also enhance the resistance of plants to pathogens (Dong and Lin, 2021). In the present study, 1,226 DEGs were identified at different timepoints after inoculation of Z. latifolia with U. esculenta. KEGG enrichment analysis revealed that most DEGs appeared at 3 hr after inoculation, most were largely enriched in ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways, and most were significantly upregulated. This indicates that male Z. latifolia plants might have already begun to respond to U. esculenta infection at 3 hr after inoculation, by activating the expression of related stress resistance genes.
TFs are important participants in plant responses to biological stress that can enhance the ability of plants to resist insect attack and pathogen infection (Amorim et al., 2017). As regulatory proteins, TFs play an important role in transcription reprogramming (Bordenave et al., 2013). Members of WRKY, NAC, MYB and other TF families are involved in the regulation of plant response to biological stress (Feller et al., 2011; Amorim et al., 2017; Li et al., 2017). Cui et al. (2019) found that the GmWRKY40 gene could positively regulate the response of soybean to Phytophthora infestans by regulating hydrogen peroxide accumulation and JA signalling. The AtMYB30 gene is a positive regulator of Arabidopsis defence and related cell death responses (Raffaele and Rivas, 2013). Overexpression of the NAC family ATAF1 gene can enhance the tolerance of plants to Botrytis cinerea and Pseudomonas syringae (Christianson et al., 2010). In the present study, 139 TF genes were identified, mainly enriched in 31 families including WRKY, MYB, NAC, bHLH and other TF families. Among them, TF genes enriched in the CK-3 hr vs. TR-3 hr comparison mainly belonged to the WRKY family. Studies have shown that the WRKY family is involved in the early regulation of plant resistance to pathogen infection, and members play a crucial role in plant responses to biological stress (Zheng et al., 2006; Chi et al., 2013; Fu et al., 2022).
With the rapid development of sequencing technology, the cost of genome detection has been greatly reduced, and transcriptome sequencing has become a popular choice to study differential gene expression. However, RNA-seq still faces many challenges in terms of data processing and analysis. Studies have shown that only 85% of results are typically consistent with qPCR results. Through analysis of all inconsistent genes, it was found that they were usually small in length, with fewer exons, and relatively scarce in the transcriptome (Everaert et al., 2017). In the present study, when the transcriptome was verified by qPCR, 19 of 20 DEGs were consistent with the transcriptome sequencing results. Subsequently, screening criteria can be optimised, and highly expressed DEGs can be selected for further analysis.
During evolution, plants have evolved various defence mechanisms to resist infection by pathogens. These include the nonspecific pattern-triggered immunity (PTI) mechanism induced by pathogen-related molecular patterns (PAMPs) mediated by pattern recognition receptors (PRRs), and effector-triggered immunity (ETI), a specific defence mechanism induced by effector proteins secreted by pathogens (Liu, 2018; Zhang et al., 2018). Studies have shown that the MAPK pathway transmits extracellular signals to downstream response factors through receptors on the cell membrane via MAPKKK, MAPKK and MAPK, and plays an important role in PTI and ETI defence responses (Wang et al., 2019). In plant nonspecific defences, FLS2 combines with the receptor kinase BAK1 to activate immune responses (Chinchilla et al., 2007). In the present study, at 3 hr after inoculation with U. esculenta, both FLS2 and BAK1 genes were significantly upregulated in male Z. latifolia, implying involvement in the infection process of male Z. latifolia in response to U. esculenta. Studies have shown that Arabidopsis FLG22 can upregulate MAPK3/4/6/11, thereby improving resistance to pathogens (Roux et al., 2011), consistent with the results of the present study. MPK3/MPK6 can enhance the stability of proteins and promote the production of ET by inhibiting the ubiquitination and degradation of ACS6, thereby enhancing the resistance of plants to pathogens (Joo et al., 2008; Han et al., 2010). MAPKs can also regulate transcription reprogramming by phosphorylating some WRKY TFs. When Arabidopsis is infected by pathogenic bacteria, WRKY33 forms a complex with MPK and MKS1, and phosphorylated WRKY33 promotes the synthesis of antitoxins, thereby improving the immune response of Arabidopsis (Qiu et al., 2008). In this study, 16 candidate genes were screened in ‘plant–pathogen interaction’ and ‘MAPK signalling pathway-plant’ pathways, and these candidate genes might participate in the responses of male Z. latifolia to U. esculenta infection. The functions of these candidate genes need to be studied in the future.