Have a personal or library account? Click to login
Safety assessment of the innovative functional food ingredient from Cannabis sativa L. wastes Cover

Safety assessment of the innovative functional food ingredient from Cannabis sativa L. wastes

Open Access
|Jul 2020

Figures & Tables

Figure 1

Microscopic appearence of the cells a) CoN normal colon epithelial cells, b) Caco-2 colon cancer cells.
Microscopic appearence of the cells a) CoN normal colon epithelial cells, b) Caco-2 colon cancer cells.

Figure 2

Schematic representation of a) HPLC chromatogram of HMF and furfural and b) Calibration curves of HMF and furfural standards.
Schematic representation of a) HPLC chromatogram of HMF and furfural and b) Calibration curves of HMF and furfural standards.

Figure 3

Real-time cell proliferation analysis: Effects of XOS hydrolysate supplementation on proliferation ofa) CoN cormal colon cells, b) Caco-2 colon cancer cells.
Real-time cell proliferation analysis: Effects of XOS hydrolysate supplementation on proliferation ofa) CoN cormal colon cells, b) Caco-2 colon cancer cells.

Figure 4

a) CoN and Caco-2 total RNA samples; ribosomal RNA subunits (28S, 18S) on 1% agarose gel.b) RT-PCR products for control and treated cells (NFE2L2 and β-actin genes).
a) CoN and Caco-2 total RNA samples; ribosomal RNA subunits (28S, 18S) on 1% agarose gel.b) RT-PCR products for control and treated cells (NFE2L2 and β-actin genes).

Figure 5

Schematic representation of densitometric analysis of normalized NFE2L2 gene expression levels in normal (CoN) and colon cancer cells (Caco-2).
Schematic representation of densitometric analysis of normalized NFE2L2 gene expression levels in normal (CoN) and colon cancer cells (Caco-2).

Figure 6

Graphical representations of DPPH scavenging activities of a) XOS hydrolysate and b) Ascorbic acid (L-ASA).
Graphical representations of DPPH scavenging activities of a) XOS hydrolysate and b) Ascorbic acid (L-ASA).

Duplication time (td) of cell lines after XOS hydrolysate supplementation

TreatmentDuplication time (h)
XOS hydrolysateCoN (normal colon cells)Caco-2 (colon cancer cells)
Control30.78 ± 0.5053.65 ± 4.56
1.25 mg mL-128.75± 0.6737.70 ± 1.35
2.50 mg mL-125.97± 0.3226.97 ± 0.54
5.00 mg mL-127.05± 0.2147.19 ± 0.78

Oligonucleotide sequences and PCR conditions

Primer pairsSequenceProduct sizeAnnealing T (°C)Cycle
NFE2L2 Sense5’GCGACGGAAAGAGTATGAGC3’181 bp6025
NFE2L2 Antisense5’GTTGGCAGATCCACTGGTTT3’
β-actin Sense5’TGAGCGCGGCTACAGCTT3’120 bp5635
β-actin Antisense5’TCCTTAATGTCACGCACGATTT3’
Language: English
Page range: 134 - 143
Published on: Jul 19, 2020
Published by: European Biotechnology Thematic Network Association
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 Fatmanur Gönce, Elmas Ersöz, Meryem Kara, Gökhan Kars, Saliha Dinç, Serpil Edebali, Manuel Roman, Meltem D. Kars, published by European Biotechnology Thematic Network Association
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.