Does early antibiotic administration to turkeys receiving a coccidiostat in the diet affect the yolk sac absorption rate, the maternal antibody levels, and the immune system efficiency?

Radosław Smagieł; Katarzyna Ognik; Ewelina Cholewińska; Przemysław Sołek; Dariusz Mikulski; Bartłomiej Tykałowski; Jan Jankowski; Krzysztof Tutaj

doi:10.2478/aoas-2025-0125

Table 1.

Ingredient composition and nutrient content of turkey diets (g/100 g, as-fed basis) (presented in Mikulski et al., 2022)

1–4	5–8	9–12
Ingredients
Wheat	37.00	45.13	46.18
Maize	10.00	10.00	15.00
Soybean meal, 46% CP	42.65	33.95	25.75
Rapeseed meal full fat 20,7% CP	4.00	5.00	6.00
Soybean oil	1.21	1.36	3.00
Sodium bicarbonate	0.15	0.15	0.15
Sodium chloride	0.20	0.20	0.20
Limestone	1.41	1.40	1.28
Monocalcium phosphate	1.87	1.54	1.15
L Lysine HCL	0.52	0.45	0.44
DL Methionine	0.32	0.21	0.21
L-Threonine	0.14	0.08	0.11
Ronozyme P	0.01	0.01	0.01
Ronozyme WX	0.02	0.02	0.02
Vitamin-mineral premix¹	0.50	0.50	0.50
Calculated nutrient content
Metabolizable energy, kcal/kg	2750	2850	3050
Crude protein	26.50	23.50	20.50
Lysine	1.75	1.50	1.30
Methionine	0.68	0.54	0.51
Met + Cys	1.12	0.95	0.88
Threonine	1.08	0.90	0.82
Calcium	1.20	1.10	0.95
Available phosphorus	0.58	0.50	0.40
Na	0.14	0.14	0.14
Analysed chemical composition
DM	89.09	89.56	88.43
Crude protein	26.59	24.16	21.49
Crude fat	4.42	5.41	6.82

1 Provided per kg diet (feeding periods: weeks 0–4, 5–8, 9–12): mg: retinol 3,78, 3,38 and 2,88, cholecalciferol 0,13, 0,12 and 0,10, α-tocopheryl acetate 100, 90 and 80, vit, K₃ 5,8, 5,6 and 4,8, thiamine 5,4, 4,7 and 4,0, riboflavin 8,4, 7,5 and 6,4, pyridoxine 6,4, 5,6 and 4,8, cobalamin 0,032, 0,028 and 0,024, biotin 0,32, 0,28 and 0,24, pantothenic acid 28, 24 and 20, nicotinic acid 84, 75 and 64, folic acid 3,2, 2,8 and 2,4, Fe 64, 60, 56 and 48, Mn 120, 112 and 96, Zn 110, 103 and 88, Cu 23, 19 and 16, I 3,2, 2,8 and 2,4, Se 0,30, 0,28 and 0,24, respectively.

Table 2.

Experiment scheme

		Antibiotic
		CON (without antibiotic)	ENR (enrofloxacin)	DOX (doxycycline)
Monensin	− (without)	CON −	ENR −	DOX −
Monensin	+ (present)	CON +	ENR +	DOX +

[i] CON − group without monensin and receiving no antibiotics; CON + group with monensin and receiving no antibiotics; ENR − group without monensin and receiving enrofloxacin; ENR + group with monensin and receiving enrofloxacin; DOX − group without monensin and receiving doxycycline; DOX + group with monensin and receiving doxycycline.

Table 3.

Primer sequences and their corresponding Tm values

Target	Sequence (5′→3′)	Tm (℃)
GAPDH	CCCTGAGCTCAATGGGAAGC	55.9
TCAGCAGCAGCCTTCACTAC	53.8
ACTB	TACCCCATTGAACACGGCAT	51.8
CTCCTCAGGGGCTACTCTCA	55.9
18S rRNA	CGAAAGCATTTGCCAAGAAT	47.7
GGCATCGTTTATGGTCGG	50.3
IgY	GAATGGTTGGTGGACGGAGT	53.8
GCATCCCTTGACGTGATCCT	53.8
IFN-gamma	CTGACAAGTCAAAGCCGCAC	53.8
AGTCATTCATCTGAAGCTTGGC	53.0
IL-6	AAGGCGTGGATAGAGAAG	48.0
TGACAGATCGGTAACAGAG	48.9

Table 4.

Growth performance parameters of turkeys (from 1 to 85 days of life)

Item	n	BW 1d, g	BW 85d, kg	BWG, kg	DBWG, g	DFI, g	FCR, kg/kg	Mortality birds/%
Antibiotic¹
CON	16	60.8	8.045	7.984	90.2	187.7	2.081	0 / 0.0
ENR	16	60.9	8.174	8.113	91.5	192.8	2.109	11 /2.5
DOX	16	60.7	8.226	8.166	92.5	192.8	2.085	2 / 0.4
Monensin²
−	24	60.9	8.129	8.068	91.0	192.4	2.115 ^a	8/ 1.2
+	24	60.8	8.168	8.107	91.8	189.8	2.069 ^b	5 / 0.7
Group
CON −	8	60.8	8.015	7.955	89.8	189.5	2.110	0 / 0.0
CON +	8	60.8	8.074	8.013	90.5	185.9	2.053	0 / 0.0
ENR −	8	61.2	8.206	8.145	91.5	195.7	2.141	6 / 2.7
ENR +	8	60.7	8.143	8.082	91.4	189.8	2.077	5 / 2.2
DOX −	8	60.7	8.166	8.106	91.6	191.9	2.094	2 / 0.9
DOX +	8	60.8	8.287	8.226	93.3	193.6	2.077	0 / 0.0
SEM		0.139	0.040	0.040	0.492	1.060	0.007
P value
Antibiotic (A)		0.895	0.183	0.182	0.181	0.073	0.205	NA
Monensin (M)		0.670	0.637	0.636	0.440	0.204	0.001	NA
A × M interaction		0.624	0.648	0.649	0.778	0.286	0.309	NA

NA = not analyzed.

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

BW-body weight, BWG-body weight gain, DBWG-daily body weight gain, DFI-daily feed intake, FCR-feed conversation ratio.

Table 5.

Body weight (BW) of turkeys, total yolk sac weight (TYS), and relative weight of yolk sac (RYS) at 1, 3, and 5 days of life

Item	n	1day			3day			5day
Item	n	BW, g	TYS, g	RYS, % of BW	BW, g	TYS, g	RYS, % of BW	BW, g	TYS, g	RYS, % of BW
Antibiotic¹
CON	48	71.02	2.67	3.75	91.15	0.97	1.07	117.8	0.26	0.23
ENR	48	67.53	2.74	4.05	91.24	0.89	0.98	117.8	0.25	0.22
DOX	48	69.40	2.79	4.06	92.79	0.81	0.88	114.4	0.21	0.18
Monensin²
−	72	70.36	2.73	3.91	93.56^a	0.86	0.93	116.1	0.24	0.21
+	72	68.28	2.73	4.00	89.90^b	0.92	1.02	117.3	0.24	0.21
Group
CON −	24	71.65	2.62	3.65	92.05	0.86	0.94	116.2	0.25	0.23
CON +	24	70.39	2.73	3.86	90.25	1.08	1.20	119.5	0.27	0.23
ENR −	24	69.87	2.98	4.27	94.89	0.96	1.02	118.0	0.24	0.21
ENR +	24	65.20	2.50	3.83	87.59	0.82	0.94	117.6	0.26	0.23
DOX −	24	69.56	2.61	3.81	93.75	0.76	0.83	114.1	0.23	0.20
DOX +	24	69.24	2.96	4.32	91.84	0.86	0.93	114.8	0.18	0.16
SEM		0.596	0.010	0.147	0.720	0.036	0.039	1.130	0.031	0.028
P value
Antibiotic (A)		0.053	0.895	0.677	0.565	0.180	0.174	0.379	0.760	0.884
Monensin (M)		0.075	0.991	0.791	0.010	0.409	0.260	0.587	0.993	0.798
A × M interaction		0.279	0.224	0.336	0.194	0.096	0.276	0.789	0.853	0.844

Relative sac mass percentage values were subjected to the Bliss (arc sine) transformation for statistical comparisons. The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 6.

Anti-aMPV (TRT) antibody titers in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

Item	n	Yolk sac			Blood serum
Item	n	1d	3d	5d	1d	3d	5d	7d	56d
Antibiotic¹
CON	48	1101.3	179.8	132.22	3446.4	2024.1	2228.8	1006.2	239.5
ENR	48	1174.8	169.1	233.32	3624.5	1558.4	1954.2	1437.4	154.5
DOX	48	858.0	222.6	54.12	3345.9	1363.5	1810.9	1956.9	117.3
Monensin²
−	72	1119.1	230.9	203.22	3247.3	1689.2	2431.2^a	1615.5	207.5
+	72	970.3	150.1	76.56	3697.2	1608.2	1564.8^b	1318.2	133.4
Group
CON −	24	997.9	112.7	191.82	3051.9	1977.2	2415.3	1281.4	284.7
CON +	24	1204.6	246.9	72.61	3840.9	2071.0	2042.3	731.0	194.3
ENR −	24	1381.2	246.8	320.54	4219.5	1531.7	2446.8	1106.6	197.8
ENR +	24	968.4	91.44	146.09	3029.6	1585.1	1461.6	1768.3	111.2
DOX −	24	978.2	333.1	97.29	2470.7	1558.6	2431.3	2458.5	139.9
DOX +	24	737.8	112.0	10.96	4221.1	1168.4	1190.5	1455.3	94.63
SEM		121.9	37.46	37.02	299.8	159.7	192.6	196.2	39.82
P value
Antibiotic (A)		0.546	0.826	0.140	0.929	0.229	0.664	0.139	0.409
Monensin (M)		0.546	0.282	0.087	0.455	0.801	0.025	0.445	0.333
A × M interaction		0.570	0.122	0.885	0.129	0.792	0.637	0.198	0.965

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 7.

Anti-NDV antibody titers in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

Item	n	Yolk sac			Blood serum
Item	n	1d	3d	5d	1d	3d	5d	7d	56d
Antibiotic¹
CON	48	262.4	144.75	61.81	967.4	798.8	1221.5	462.9	283.3
ENR	48	537.5	66.66	46.46	1267.6	528.4	915.4	655.3	303.0
DOX	48	264.9	61.21	49.38	1123.8	526.6	1028.8	670.9	376.1
Monensin²
−	72	274.2	105.92	84.15^a	1064.8	666.2	1217.1	647.9	373.8^a
+	72	435.6	75.83	20.95^b	1174.4	569.6	893.3	544.9	267,8^b
Group
CON −	24	152.2	150.54	93.17	942.5	776.3	1287.0	456.6	335.3
CON +	24	372.6	138.97	30.45	992.3	821.2	1156.0	469.3	231.3
ENR −	24	410.5	96.17	63.63	1418.4	705.6	1001.8	770.4	335.8
ENR +	24	664.5	37.15	29.29	1116.7	351.2	829.0	540.3	270.3
DOX −	24	260.0	71.05	95.65	833.3	516.6	1362.6	716.8	450.4
DOX +	24	269.9	51.36	3.10	1414.3	536.5	695.0	625.1	301.7
SEM		64.17	17.99	14.65	100.8	69.63	108.1	69.44	27.01
P value
Antibiotic (A)		0.134	0.108	0.902	0.479	0.188	0.507	0.403	0,335
Monensin (M)		0.208	0.404	0.032	0.587	0.488	0.137	0.463	0.049
A × M interaction		0.700	0.847	0.719	0.202	0.424	0.532	0.777	0.819

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 8.

Anti-ORT antibody titers in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

Item	n	Yolk sac			Blood serum
Item	n	1d	3d	5d	1d	3d	5d	7d	56d
Antibiotic¹
CON	48	459.2	179.0	119.14	2991.8^b	2120.4	3105.0	1455.7	17649.8
ENR	48	725.5	180.6	329.67	4597.6^a	1640.2	2535.4	915.6	18348.9
DOX	48	407.2	166.0	181.38	3480.1^ab	1878.7	2664.0	1191.5	17759.8
Monensin²
−	72	491.9	163.1	178.72	3488.0	2081.7	3303.3^a	1359.4	18334.7
+	72	569.4	187.3	241.41	3891.6	1677.8	2233.0^b	1015.8	17504.4
Group
CON −	24	500.6	201.4	164.60^b	3464.4	2523.7	3284.7	1465.3	19110.2
CON +	24	417.8	156.5	73.67^b	2519.2	1717.0	2925.4	1446.0	16189.4
ENR −	24	726.1	216.7	84.06^b	4025.9	1935.0	3263.3	1047.6	17867.9
ENR +	24	724.9	144.5	575.28^a	5169.2	1345.4	1807.6	783.7	18830.0
DOX −	24	248.9	71.18	287.49^ab	2973.8	1786.5	3362.1	1565.2	18025.9
DOX +	24	565.4	260.8	75.27^b	3986.4	1971.0	1965.9	817.9	17493.6
SEM		75.03	38.95	55.15	262.1	158.7	233.0	108.8	540.0
P value
Antibiotic (A)		0.182	0.986	0.266	0.035	0.469	0.573	0.126	0.853
Monensin (M)		0.606	0.759	0.563	0.433	0.205	0.022	0.112	0.446
A × M interaction		0.519	0.330	0.020	0.181	0.410	0.553	0.374	0.342

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 9.

Total IgY antibody levels in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

Item	n	Yolk sac (mg/total yolk sac)			Blood serum (mg/mL)
Item	n	1d	3d	5d	1d	3d	5d	7d	56d
Antibiotic¹
CON	48	21.16	10.079	2.953	3.282	5.621	7.594^a	5.133^b	5.718^a
ENR	48	27.23	7.169	2.851	3.606	5.450	6.913^ab	4.760^b	3.622^b
DOX	48	32.02	8.548	2.147	3.865	5.958	6.524^b	6.174^a	2.842^b
Monensin²
−	72	20.67^b	7.156^b	2.527	3.190^b	5.499	7.114	5.213	3,794
+	72	32.93^a	10.042^a	2.775	3.979^a	5.854	6.907	5.498	4,328
Group
CON −	24	16.88	6.735^b	3.365	2.839^b	5.760	8.075	5.185	5.259
CON +	24	25.43	13.424^a	2.542	3.726	5.482	7.113	5.082	6.178
ENR −	24	23.41	7.046^b	2.044	3.265	5.474	6.438	4.167	3.095
ENR +	24	31.04	7.292^b	3.659	3.947	5.427	7.389	5.353	4.149
DOX −	24	21.73	7.688^b	2.171	3.465	5.262	6.828	6.287	3.028
DOX +	24	42.30	9.409^ab	2.123	4.264	6.653	6.219	6.060	2.657
SEM		2.355	0.556	0.313	0.160	0.170	0.175	0.187	0.297
P value
Antibiotic (A)		0.157	0.085	0.522	0.322	0.459	0.038	0.005	0.000
Monensin (M)		0.009	0.007	0.693	0.014	0.294	0.546	0.432	0.345
A × M interaction		0.441	0.037	0.272	0.965	0.095	0.055	0.214	0.524

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 10.

Total IgM antibody levels in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

Item	n	Yolk sac (µg/total yolk sac)			Blood serum (µg/mL)
Item	n	1d	3d	5d	1d	3d	5d	7d	56d
Antibiotic¹
CON	48	264.1	141.07^a	22.18	48.64	42.50^a	72.27	61.32^b	49.45
ENR	48	243.0	90.21^b	24.84	33.97	40.44^a	61.32	61.57^b	52.89
DOX	48	239.7	97.93^b	15.09	48.69	31.53^b	64.46	88.28^a	49.40
Monensin²
−	72	242.8	100.30	19.46	35.62^b	44.44^a	70.15	67.77	51.98
+	72	255.1	119.18	21.94	51.91^a	31.87^b	61.88	73.00	49.19
Group
CON −	24	225.5	121.68	26.79	38.59^ab	47.47	75.14	59.37	51.35
CON +	24	302.7	160.46	17.58	58.70^ab	37.52	69.41	63.27	47.56
ENR −	24	266.3	93.15	17.94	36.62^b	46.51	60.14	64.49	50.97
ENR +	24	219.6	87.27	31.73	31.33^b	34.37	62.51	58.64	54.81
DOX −	24	236.4	86.06	13.67	31.66^b	39.33	75.18	79.46	53.62
DOX +	24	243.1	109.80	16.51	65.72^a	23.73	53.73	97.10	45.19
SEM		12.16	6.322	2.897	3.067	1.590	3.665	3.932	1.726
P value
Antibiotic (A)		0.674	0.001	0.368	0.062	0.006	0.457	0.005	0.643
Monensin (M)		0.612	0.121	0.670	0.006	0.000	0.262	0.495	0.422
A × M interaction		0.117	0.311	0.273	0.022	0.731	0.406	0.454	0.348

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 11.

Effects of treatments on immunocompetent organ weights (spleen and Bursa Fabricii) at day 7 and 56 days of turkeys’ life

Item	n	7 day					56 day
		Body weight, g	spleen		Bursa Fabricii		Body weight, g	spleen		Bursa Fabricii
		Body weight, g	Total weight, g	Relative weight, % of BW	Total weight, g	relative weight, % of BW	Body weight, g	Total weight, g	Relative weight, % of BW	Total weight, g	elative weight, % of BW
Antibiotic¹
CON	16	158.7^ab	0.113	0.071	0.274	0.17	4320	3.854	0.089	4.458	0.103
ENR	16	168.3^a	0.124	0.074	0.307	0.18	4356	3.782	0.087	4.311	0.099
DOX	16	154.4^b	0.112	0.073	0.256	0.16	4274	3.952	0.092	4.296	0.101
Monensin²
−	24	165.1^a	0.116	0.070	0.300^a	0.18	4316	3.634	0.084	4.496	0.104
+	24	155.9^b	0.117	0.075	0.258^b	0.17	4317	4.091	0.095	4.215	0.097
Group
CON −	8	162.9	0.106	0.065	0.284	0.17	4286	3.561	0.084	4.410	0.103
CON +	8	154.5	0.120	0.077	0.265	0.17	4354	4.146	0.095	4.507	0.104
ENR −	8	175.2	0.128	0.073	0.344	0.20	4396	3.576	0.081	4.496	0.102
ENR +	8	161.4	0.121	0.075	0.270	0.17	4316	3.989	0.093	4.126	0.095
DOX −	8	157.1	0.114	0.073	0.273	0.17	4266	3.766	0.088	4.581	0.108
DOX +	8	151.7	0.110	0.073	0.239	0.16	4281	4.137	0.096	4.011	0.093
SEM		2.209	0.006	0.003	0.010	0.005	33.21	0.121	0.003	0.109	0.002
P value
Antibiotic (A)		0.022	0.989	0.989	0.079	0.429	0.622	0.852	0.645	0.804	0.696
Monensin (M)		0.028	0.555	0.555	0.026	0.112	0.990	0.070	0.071	0.211	0.177
A × M interaction		0.690	0.854	0.854	0.452	0.510	0.677	0.931	0.965	0.458	0.515

Relative spleen and bursa Fabricii mass percentage values were subjected to the Bliss (arc sine) transformation for statistical comparisons. The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 12.

Percentages of T-cell and B-cell subpopulations in the blood of turkeys

Item	n	7 day				56 days
Item	n	CD4⁺	CD8⁺	CD4⁺CD8⁺	IgM⁺	CD4⁺	CD8⁺	CD4⁺CD8⁺	IgM⁺
Antibiotic¹
CON	16	20.08	1.673	0.533	5.234	23.54^a	2.675	0.341	7.231
ENR	16	19.01	1.442	0.573	5.144	21.71^a	2.205	0.319	6.077
DOX	16	21.42	1.801	0.604	5.588	15.49^b	1.807	0.240	6.039
Monensin²
−	24	23.07^a	1.885^a	0.594	5.304	21.13	2.396	0.308	6.789
+	24	17.27^b	1.393^b	0.546	5.339	19.36	2.062	0.292	6.108
Group
CON −	8	26.51	2.103	0.514	5.041	18.80^b	2.353^ab	0.290	7.091
CON +	8	13.65	1.243	0.553	5.426	28.28^a	2.998^a	0.391	7.370
ENR −	8	21.35	1.493	0.660	5.041	29.34^a	2.886^a	0.381	7.198
ENR +	8	16.66	1.391	0.485	5.246	14.08^b	1.524^b	0.256	4.956
DOX −	8	21.35	2.059	0.609	5.830	15.26^b	1.950^ab	0.253	6.079
DOX +	8	21.49	1.544	0.600	5.345	15.73^b	1.664^b	0.228	5.999
SEM		1.378	0.106	0.020	0.099	1.229	0.161	0.029	0.292
P value
Antibiotic (A)		0.756	0.339	0.325	0.148	0.001	0.064	0.354	0.155
Monensin (M)		0.033	0.018	0.215	0.856	0.318	0.260	0.787	0.231
A × M interaction		0.137	0.309	0.069	0.159	0.000	0.027	0.303	0.151

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 13.

Percentages of T-cell and B-cell subpopulations in the spleen of turkeys

Item	n	7 day				56 days
Item	n	CD4⁺	CD8⁺	CD4⁺CD8⁺	IgM⁺	CD4⁺	CD8⁺	CD4⁺CD8⁺	IgM⁺
Antibiotic¹
CON	16	43.56	13.95	1.577	8.074	36.66	19.30^b	1.917	14.27
ENR	16	46.59	14.20	1.739	8.648	33.69	23.96^a	2.053	15.25
DOX	16	45.93	14.40	1.740	8.626	34.20	24.04^a	2.221	14.60
Monensin²
−	24	46.03	14.97	1.836^a	8.293	35.50	20.75^b	2.021	12.61^b
+	24	44.68	13.39	1.534^b	8.606	34.20	24.12^a	2.106	16.80^a
Group
CON −	8	45.71	13.76	1.735	7.394	35.00	21.14^ab	2.064^ab	12.84
CON +	8	41.41	14.14	1.419	8.754	38.31	17.46^b	1.770^b	15.71
ENR −	8	47.15	14.56	1.916	9.006	34.29	20.46^b	2.123^ab	13.18
ENR +	8	46.03	13.83	1.561	8.290	33.09	27.46^a	1.984^ab	17.31
DOX −	8	45.24	16.59	1.858	8.478	37.20	20.65^b	1.878^b	11.80
DOX +	8	46.61	12.22	1.623	8.775	31.20	27.44^a	2.565^a	17.39
SEM		0.963	0.674	0.050	0.269	0.827	0.806	0.075	0.623
P value
Antibiotic (A)		0.421	0.964	0.253	0.626	0.275	0.004	0.208	0.774
Monensin (M)		0.493	0.255	0.002	0.568	0.419	0.010	0.541	0.001
A × M interaction		0.499	0.342	0.860	0.309	0.068	0.001	0.013	0.621

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

Table 14.

Immunological parameters in the blood plasma of turkeys at the 7^th day of life

Item	n	IgA total, ng/mL	TLR-4, ng/mL	IL-2, ng/mL	IL-4, pg/mL	IL-6, ng/L	IL-8, pg/mL	IL-12, ng/mL	IL-13, pg/mL	IL-1ß, pg/mL	TNFα, pg/mL	IFN-γ, pg/mL	NF-kB, ng/mL	CRP, ng/ml
Antibiotic¹
CON	16	630.0	1.506^a	5.011	52.78^ab	34.46	7.578^b	14.77^b	20.41	66.56^b	382.1	113.19^a	2.694	10.680^a
ENR	16	593.5	0.847^b	4.960	47.53^b	36.82	8.234^b	18.66^a	18.99	73.64^ab	382.2	77.70^b	2.590	4.918^b
DOX	16	521.6	0.900^b	5.325	56.44^a	38.31	11.192^a	16.60^ab	19.35	87.36^a	371.7	120.59^a	2.438	9.130^a
Monensin²
−	24	526.4	1.279^a	4.717	50.65	38.14	8.851	16.00	18.68	69.12	365.5	112.57^a	2.684	9.221^a
+	24	637.1	0.889^b	5.481	53.85	34.91	9.152	17.35	20.48	82.59	391.8	95.08^b	2.465	7.264^b
Group
CON −	8	578.5	2.268^a	4.084^b	52.07	35.41^ab	7.639	13.96^c	19.79	66.38^b	365.4	142.28^a	3.346^a	12.520^a
CON +	8	681.6	0.744^b	5.938^ab	53.48	33.50^ab	7.518	15.58^bc	21.03	66.74^b	398.8	84.11^bc	2.042^b	8.841^abc
ENR −	8	568.3	0.807^b	5.679^ab	49.36	42.61^a	7.256	21.19^a	18.25	70.67^b	383.8	72.01^c	2.726^ab	8.236^bc
ENR +	8	618.7	0.888^b	4.241^b	45.70	31.03^b	9.212	16.12^bc	19.73	76.61^b	380.5	83.39^bc	2.455^ab	1.599^d
DOX −	8	432.5	0.764^b	4.388^b	50.52	36.41^ab	11.659	12.85^c	18.00	70.30^b	347.2	123.42^a	1.979^b	6.906^c
DOX +	8	610.8	1.036^b	6.263^a	62.36	40.21^ab	10.725	20.36^ab	20.69	104.42^a	396.1	117.75^ab	2.897^ab	11.353^ab
SEM		28.42	0.099	0.232	1.496	1.250	0.436	0.628	0.661	2.935	9.300	5.002	0.118	0.632
P value
Antibiotic (A)		0.277	0.000	0.735	0.037	0.411	0.001	0.006	0.674	0.003	0.873	0.000	0.580	0.000
Monensin (M)		0.052	0.004	0.070	0.249	0.177	0.695	0.152	0.189	0.006	0.170	0.018	0.280	0.016
A × M interaction		0.641	0.000	0.002	0.074	0.035	0.289	0.000	0.896	0.012	0.518	0.001	0.000	0.000

The tables present the original mean and the pooled standard error of the mean (SEM).

a-d Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

IgA -Immunoglobulin A, TLR-4-Toll like receptor 4, IL-2-interleukin 2, IL-4-interleukin 4, IL-6-interleukin 6, IL-8-interleukin 8, IL-12-interleukin 12, IL-13-interleukin 13, IL-1ß-interleukin 1ß, TNFα-turmot necrosis factor, IFN-γ-interferon γ, NF-kB-nuclear factor kappa light chain, CRP-C reactive protein.

Table 15.

Immunological parameters in the blood plasma of turkeys at the 56^th day of life

Item	n	IgA total, ng/mL	TLR-4, ng/mL	IL-2, ng/mL	IL-4, pg/mL	IL-6, ng/L	IL-8, pg/mL	IL-12, ng/mL	Il-13, pg/mL	IL-1ß, pg/mL	TNFα, pg/mL	IFN-γ, pg/mL	NF-kB, ng/mL	CRP, ng/ml
Antibiotic¹
CON	16	654.3	1.179	6.726^y	82.45^a	47.35	9.694	25.93^b	17.14	103.9	223.6^a	46.36^b	2.806	0.821
ENR	16	673.7	1.144	8.464^x	83.64^a	45.20	10.583	35.55^a	19.99	128.5	171.8^b	52.89^ab	3.365	0.860
DOX	16	779.8	1.265	8.541^x	58.00^b	47.62	9.859	30.02^ab	19.09	123.7	174.7^b	57.66^a	2.849	0.850
Monensin²
−	24	795.6^a	1.138	7.409	80.52^a	44.98	8.448^b	30.37	16.84^b	97.1^b	199.2	42.47^b	2.457^b	0.905
+	24	609.6^b	1.253	8.412	68.87^b	48.46	11.642^a	30.63	20.64^a	140.3^a	180.9	62.13^a	3.556^a	0.783
Group
CON −	8	773.2^abc	0.766^c	5.868	79.69^a	48.64	7.870	12.64^b	11.85^b	58.3^b	210.4^a	21.64^c	1.725^c	0.615^b
CON +	8	535.4^bc	1.593^a	7.583	85.22^a	46.06	11.518	39.22^a	22.44^a	149.5^a	236.9^a	71.07^a	3.886^a	1.028^a
ENR −	8	843.9^a	1.303^ab	8.343	91.31^a	46.46	9.562	38.88^a	22.05^a	114.1^a	173.4^ab	46.36^b	3.335^ab	1.048^a
ENR +	8	503.4^c	0.984^bc	8.586	75.97^a	43.94	11.604	32.21^a	17.93^ab	142.9^a	170.3^ab	59.41^ab	3.394^ab	0.672^ab
DOX −	8	769.6^abc	1.346^ab	8.015	70.56^ab	39.83	7.913	39.58^a	16.60^ab	118.8^a	213.9^a	59.40^ab	2.309^bc	1.050^a
DOX +	8	790.0^ab	1.183^abc	9.067	45.43^c	55.40	11.805	20.45^b	21.57^a	128.7^a	135.6^b	55.91^ab	3.388^ab	0.649^ab
SEM		31.80	0.059	0.326	3.186	1.822	0.430	1.841	0.951	5.965	8.273	2.726	0.156	0.047
P value
Antibiotic (A)		0.132	0.558	0.032	0.000	0.832	0.587	0.004	0.359	0.060	0.006	0.023	0.114	0.916
Monensin (M)		0.001	0.225	0.109	0.025	0.334	0.000	0.907	0.025	0.000	0.202	0.000	0.000	0.126
A × M interaction		0.025	0.000	0.620	0.048	0.068	0.549	0.000	0.003	0.001	0.012	0.000	0.003	0.000

The tables present the original mean and the pooled standard error of the mean (SEM).

a-c Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

IgA -Immunoglobulin A, TLR-Toll like receptor, IL-2-interleukin 2, IL-4-interleukin 4, IL-6-interleukin 6, IL-8-interleukin 8, IL-12-interleukin 12, IL-13-interleukin 13, IL-1ß-interleukin 1ß, TNFα-turmot necrosis factor, IFN-γ-interferon γ, NF-kB-nuclear factor kappa light chain, CRP-C reactive protein.

Table 16.

Expression of genes in the blood of 7-day-old and 56-day-old turkeys

Item	n	7 day			56 day
Item	n	IgY	IL-6	IFN-γ	IgY	IL-6	IFN-γ
Antibiotic¹
CON	16	0.558^a	0.330^b	0.975^b	0.586^a	0.295^b	0.989^a
ENR	16	0.541^b	0.349^a	0.995^a	0.575^b	0.292^b	0.975^b
DOX	16	0.544^b	0.342^ab	0.985^ab	0.577^b	0.305^a	0.983^ab
Monensin²
−	24	0.548	0.338	0.985	0.582	0.299	0.980
+	24	0.547	0.342	0.985	0.577	0.295	0.985
Group
CON −	8	0.557	0.326	0.972	0.590	0.299	0.987
CON +	8	0.560	0.333	0.978	0.583	0.291	0.991
ENR −	8	0.542	0.347	0.997	0.576	0.296	0.973
ENR +	8	0.539	0.351	0.994	0.575	0.288	0.977
DOX −	8	0.546	0.341	0.988	0.581	0.303	0.980
DOX +	8	0.541	0.343	0.982	0.572	0.307	0.986
SEM		0.003	0.002	0.003	0.002	0.002	0.002
P value
Antibiotic (A)		0.010	0.002	0.009	0.011	0.003	0.025
Monensin (M)		0.729	0.320	0.887	0.075	0.167	0.291
A × M interaction		0.787	0.897	0.640	0.491	0.174	0.963

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b Means within the same column with different superscripts differ significantly (P < 0.05).

1 Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2 Denotes without monensin − or with monensin +.

IgY-Immunoglobulin Y, IL-6-interleukin 6, IFN-γ – interferon.

Does early antibiotic administration to turkeys receiving a coccidiostat in the diet affect the yolk sac absorption rate, the maternal antibody levels, and the immune system efficiency?

Figures & Tables

Table 1.

Table 2.

Table 3.

Table 4.

Table 5.

Table 6.

Table 7.

Table 8.

Table 9.

Table 10.

Table 11.

Table 12.

Table 13.

Table 14.

Table 15.

Table 16.

Paradigm

My account