Have a personal or library account? Click to login
Does early antibiotic administration to turkeys receiving a coccidiostat in the diet affect the yolk sac absorption rate, the maternal antibody levels, and the immune system efficiency? Cover

Does early antibiotic administration to turkeys receiving a coccidiostat in the diet affect the yolk sac absorption rate, the maternal antibody levels, and the immune system efficiency?

Open Access
|Feb 2026

Full Article

The first days after hatching are a critical period in a poults life, marked by intensive physiological changes, including immune system maturation and the development of functions essential for protection against pathogens later in life. In this early crucial development period, chicks mainly use passive immunity, which is acquired in the form of antibodies (mainly IgY) transferred to them by the mother via the yolk sac (Noy & Sklan, 1999; Ognik et al., 2025). Therefore, effective yolk sac resorption within the first days after hatching is necessary for optimal immune system programming (Prabakar et al., 2016). Effective resorption of the yolk sac within the first 3–5 days after hatching is crucial for the proper transfer of maternal antibodies and the maturation of immune organs, ensuring optimal development of the chick’s immune system. Delays in this process lead to impaired immune stimulation and increased mortality risk during the first week of life (Wang et al., 2020).

Over the last few decades, there has been a significant intensification of poultry production. As a result of selective breeding, various parameters like body weight gain, feed consumption, and slaughter efficiency of poultry have been significantly improved. However, the unfavourable effect of these practices has been the simultaneous weakening of immunity, which may result in higher susceptibility to infections and increased bird mortality (Rubio, 2019). In Poland, prophylactic administration of antibiotics has not been used for many years, due to the ban introduced in 2006 by the European Union. It is only permissible to administer antibiotics to confirmed infections, and the pharmacological intervention must always be carried out in a strict therapeutic regime with appropriate withdrawal periods. Due to the increased susceptibility to infections in high-production poultry, it is sometimes necessary to implement therapeutic antibiotic therapy even in the first days of the poultry life. However, using coccidiostats such as monensin as a feed additive is permitted almost throughout the entire rearing period (Ognik et al., 2025). Antibiotics such as enrofloxacin or doxycycline are commonly used in clinical veterinary practice to treat poultry infections. However, our previous studies have shown that early administration of the enrofloxacin or doxycycline recommended dose to turkeys (for the first 5 days of life), similarly to feeding a diet with monensin throughout the rearing period, reduced the specific maternal IgY and IgM antibodies levels both in the yolk sac and blood, which may potentially limit passive immune protection inherited from the mother (Ognik et al., 2025). We have also shown that early administration of these antibiotics may inhibit the innate immune response in turkeys vaccinated against ND (Newcastle Disease) and TRT (Turkey Rhinotracheitis) and causes adverse changes in the morphology of immunocompensatory organs. However, the most adverse effect on the morphology of these organs is due to a constant use of monensin as a dietary additive. Moreover, this active substance was significantly less effective in inhibiting the post-vaccination inflammatory response in turkeys than enrofloxacin or doxycycline. (Smagieł et al., 2023). Schokker et al. (2017) also noted that antibiotics given to chickens in the early days of their life may adversely modulate the profile of intestinal microbial colonization, which can disrupt systemic immune responses. The gut microbiota plays a fundamental role in shaping the immune competence of birds. The intestines of newborn poultry are rapidly colonized by a diverse microbiota, which is an integral part of the development and regulation of the gut-associated lymphoid tissue (GALT) and the entire immune system of birds (Zenner et al., 2021; Rodrigues et al., 2021). Therefore, early administration of antimicrobial agents may disrupt the natural succession of the gut microbiome leading to dysbiosis and potentially reduce the stimulation necessary for the immune cells and tissues maturation, which may consequently translate into a permanent reduction in its efficiency (Broom & Kogut, 2018, Rodrigues et al., 2021). Therefore, it is worth emphasizing that early exposure to antimicrobials (antibiotics, coccidiostats) may impair both humoral and cellular immune responses, which may have long-term effects on the poultry’s health and productivity.

In breeding practices, it sometimes happens that apart from adding the commonly used coccidiostat monensin to the diet, it is necessary to simultaneously administer antibiotics (enrofloxacin or doxycycline) for therapeutic purposes. However, there is no data on the additive effect of these active substances on the yolk sac absorption, the maternal antibodies transfer, and the turkey’s immune system general functioning, especially when administered to them at a key phase of the immune system development and maturation. Therefore, the present experiment was designed to enable verification of the research hypothesis, assuming that early administration of antibiotics, especially during feeding a diet containing a coccidiostat, may limit the yolk sac absorption rate and reduce the antibody levels, and consequently worsen the functioning of the immune system of growing turkeys. The research aimed to determine whether the yolk sac resorption rate, the maternal antibody levels, as well as the efficiency of the immune system of growing turkeys may be affected by early administration of antibiotics and feeding a diet containing a coccidiostat.

Material and methods
Experimental animals and housing conditions

The experiment was conducted on young Hybrid Converter Novo turkey hens purchased as one-day-old poults (total 1152 birds) from the commercial hatchery Grelavi in Kętrzyn. The hatching day was considered zero, and the following day was the first day of life. All birds were vaccinated with live, attenuated vaccines against APV (Avian metapnumoviruses, Poulvac TRT vaccine; Zoetis) and NDV (Newcastle Disease Virus, Nobilis ND clone 30 vaccine; MSD Animal Health) on the first day of life using the macromolecular spray method, and against ORT (Ornithobacterium rhinotracheale) on the 28th day of life using the inactivated vaccine Ornithine Phibro, Poland) administered by a subcutaneous injection. The birds were reared until the 12th week of life (from 1st to 84th day). Turkey rearing was carried out in 48 pens (replicates) in the Department of Poultry Science and Apiculture in the Olsztyn experimental building. Pens with an area of 4 m2 each were lined with wood shavings. The density in the initial rearing phase was 6 pcs/m2. The environmental conditions were controlled automatically as adjusted to the age of the birds and following the recommendations of Hybrid Turkeys (2020), were identical for all turkeys. In three rearing phases (weeks 1–4, 5–8, and 9–12), the birds were fed with complete mixtures following the nutritional requirements for utility turkeys at an adequate stage of rearing (Hybrid Turkeys, 2020). The component composition and nutritional value of the feed mixtures in the individual feeding periods are presented in Table 1. The mixtures were fed in crumbles (1–28 days) and 3 mm granules. Throughout the experiment, all birds had unlimited access to water and feed, which was available ad libitum.

Table 1.

Ingredient composition and nutrient content of turkey diets (g/100 g, as-fed basis) (presented in Mikulski et al., 2022)

ItemFeeding period, weeks
1–45–89–12
Ingredients
  Wheat37.0045.1346.18
  Maize10.0010.0015.00
  Soybean meal, 46% CP42.6533.9525.75
  Rapeseed meal full fat 20,7% CP4.005.006.00
  Soybean oil1.211.363.00
  Sodium bicarbonate0.150.150.15
  Sodium chloride0.200.200.20
  Limestone1.411.401.28
  Monocalcium phosphate1.871.541.15
  L Lysine HCL0.520.450.44
  DL Methionine0.320.210.21
  L-Threonine0.140.080.11
  Ronozyme P0.010.010.01
  Ronozyme WX0.020.020.02
  Vitamin-mineral premix10.500.500.50
Calculated nutrient content
  Metabolizable energy, kcal/kg275028503050
  Crude protein26.5023.5020.50
  Lysine1.751.501.30
  Methionine0.680.540.51
  Met + Cys1.120.950.88
  Threonine1.080.900.82
  Calcium1.201.100.95
  Available phosphorus0.580.500.40
  Na0.140.140.14
Analysed chemical composition
  DM89.0989.5688.43
  Crude protein26.5924.1621.49
  Crude fat4.425.416.82
1

Provided per kg diet (feeding periods: weeks 0–4, 5–8, 9–12): mg: retinol 3,78, 3,38 and 2,88, cholecalciferol 0,13, 0,12 and 0,10, α-tocopheryl acetate 100, 90 and 80, vit, K3 5,8, 5,6 and 4,8, thiamine 5,4, 4,7 and 4,0, riboflavin 8,4, 7,5 and 6,4, pyridoxine 6,4, 5,6 and 4,8, cobalamin 0,032, 0,028 and 0,024, biotin 0,32, 0,28 and 0,24, pantothenic acid 28, 24 and 20, nicotinic acid 84, 75 and 64, folic acid 3,2, 2,8 and 2,4, Fe 64, 60, 56 and 48, Mn 120, 112 and 96, Zn 110, 103 and 88, Cu 23, 19 and 16, I 3,2, 2,8 and 2,4, Se 0,30, 0,28 and 0,24, respectively.

The 1152 one-day-old turkey hens were allocated to 6 experimental groups: CON−, ENR−, DOX−, CON+, ENR+, DOX+ (see Table 2). The experiment was conducted in a 3 × 2 factorial design, which included 3 groups of birds (CON, ENR, DOX), each fed feed with or without the monensin addition (+, −). Turkey hens from the CON groups did not receive the antibiotic supplement (control groups), while those from the ENR groups received enrofloxacin (Enrofloxacin 10%, Biowet, Drwalew, Poland) at a dose of 10 mg/kg BW for the first 5 days of life, and those from the DOX groups received doxycycline (Doxylin CT WSP 433 mg/g, Dopharma Research B.V., Raamsdonksveer, Netherlands) at a dose of 50 mg/kg BW for the first 5 days of life. The antibiotics enrofloxacin and doxycycline were added to drinking water. Turkey hens from the CON−, ENR−, DOX− groups did not receive monensin in their diet, while those from the CON+, ENR+, DOX+ groups received monensin (Coxidin 200, Huvepharma Polska, Warsaw, Poland) at a dose of 90 mg/kg of feed. The groups within the experiment were formed by 8 pens, each with 24 birds, being a replicate within the group. The replicates (pens) were assigned to the groups in a way that ensured their even (homogeneous) distribution in the building.

Table 2.

Experiment scheme

Antibiotic
CON (without antibiotic)ENR (enrofloxacin)DOX (doxycycline)
Monensin− (without)CON −ENR −DOX −
+ (present)CON +ENR +DOX +

CON − group without monensin and receiving no antibiotics; CON + group with monensin and receiving no antibiotics; ENR − group without monensin and receiving enrofloxacin; ENR + group with monensin and receiving enrofloxacin; DOX − group without monensin and receiving doxycycline; DOX + group with monensin and receiving doxycycline.

Assessment of yolk sac resorption and maternal antibody transfer

During the experiment, the body weight of turkeys, feed consumption, and mortality were assessed in groups, at times determined by the experimental factors used. On the 1st, 3rd, and 5th day of life, yolk sacs and blood were collected from 8 individuals from each group to assess yolk sac resorption and transfer of maternal antibodies. Blood from poults was collected during decapitation into tubes without anticoagulant to obtain serum. Blood samples were incubated at room temperature (approximately 22°C) for 1–2 hours in an upright position to allow for complete clotting and then centrifuged in a tabletop centrifuge for 10 minutes at 3000 × g at 4°C. The resulting serum was separated and stored at −80°C until analysis. Simultaneously, after opening the abdominal cavity, yolk sacs were aseptically collected, placed in sterile tubes, and stored at −80°C until further analysis. Yolk sac resorption in turkey poults was evaluated according to the procedure described by Chamblee et al. (1992). At predetermined time points after hatching, poults were individually weighed and then euthanized. The residual yolk sac was carefully removed and blotted to remove excess fluid, after which its weight was recorded. Yolk sac resorption was expressed as relative yolk sac weight, calculated as the ratio of yolk sac weight to body weight × 100 %. This method allows for quantitative assessment of yolk sac utilization during the early post-hatch period. To assess the transfer of maternal antibodies from yolk to poult, the general level of IgY (cat. no. MBS760369; sensitivity 0.938 ng/mL; CV<10%) and IgM antibodies (cat. no. MBS2020626; sensitivity 19.27 pg/mL; CV<12%) was determined in the yolk sac and blood serum using diagnostic MyBioSource ELISA Kits – (MyBioSource, Inc., San Diego, CA, USA), and the level of specific maternal IgY antibodies to avian metapneumovirus (anti-aMPV), Newcastle disease virus (anti-NDV), and ornithobacterium rhinotracheale (anti-ORT) were measured using Idexx kits (IDEXX ORT Ab Test; cat. no. 06-43600-06), (IDEXX APV Ab Test; cat. no. 06-44300-06), and (IDEXX NDV Ab Test; cat. No. 06-01096-16) using ELISA (IDEXX Laboratories, Inc. Westbrook, ME, USA). All phases of the assay were performed automatically using the Eppendorf EpMotion 5075LH pipetting station (Eppendorf SE, Hamburg, Germany) and the BioTek ELx405 washer (Agilent Technologies Inc., Santa Clara, CA, USA). Absorbance reading was performed using the BioTek ELx800 plate reader (Agilent Technologies Inc., Santa Clara, CA, USA), and data analysis and calculations were performed in the IDEXX xCheck software environment.

Assessment of the immune system response, including non-specific cellular immunity and specific humoral and adaptive immunity

Blood was collected from 8 individuals from each group at 7 and 56 days of life post-hatch via venipuncture of the wing vein. Blood for immunological studies was collected both for clotting and for the anticoagulant heparin or EDTA. Next, birds were euthanized, and immunocompetent organs were also collected (spleen and bursa of Fabricius to determine their weight). Biopsies taken from these organs were subjected to assessment of the immune system response, including nonspecific cellular immunity and specific humoral and adaptive immunity.

Mononuclear cells isolated from blood and spleen were counted and viability determined using a Vi-Cell XR counter (Beckman Coulter, Brea, CA, USA), and then one million of them were labeled using Mouse Anti-Chicken monoclonal antibodies (AbD Serotec) (cat. no. MCA2164F, Bio-Rad, Kidlington, UKand Goat Anti-Chicken polyclonal antibodies (AbD Serotec) (cat. no. MCA2166PE, Bio-Rad, Kidlington, UK) specific for CD4 and CD8a T cell receptors and sIgM B cell receptors to determine their percentage among lymphocytes. Immunophenotypic analysis of cells was performed using a BD FACSAria II flow cytometer (Becton Dickinson (BD), Franklin Lakes, NJ, USA).

The levels of Toll-Like receptor 4 (TLR-4; cat. no. MBS743084; sensitivity 0.1 ng/mL; CV<12%), interleukin 6 (IL-6; cat. no. MBS2021018; sensitivity 5.5 pg/mL; CV<12%), interleukin 2 (IL-2; cat. no. MBS2022032; sensitivity 6.1 pg/mL; CV<12%), interleukin 4 (IL-4; cat. no. MBS2020672; sensitivity 6.3 pg/mL; CV<12%), interleukin beta (IL-1β; cat. no. MBS778170; sensitivity 1.0 pg/mL; CV<15%), interleukin 8 (IL-8; cat. no. MBS700701; sensitivity 0.78 pg/mL; CV<10%), interleukin 12 (IL-12; cat. no. MBS2031963; sensitivity 6.1 pg/mL; CV<12%), interleukin 13 (IL-13; cat. no. MBS451617; sensitivity 5.3 pg/mL; CV<12%), tumor necrosis factor alpha (TNFα; cat. no. MBS2031870; sensitivity 3.1 pg/mL; CV<12%), C-reactive protein (CRP; cat. no. MBS2024111; sensitivity 0.134 ng/mL; CV<12%), interferon gamma (IFN-γ; cat. no. MBS2020832; sensitivity 5.5 pg/mL; CV<12%), nuclear transcription factor (NF-κB; cat. no. MBS2020695; sensitivity 0.055 ng/mL; CV<12%) and total immunoglobulin Y (IgY; cat. no. MBS760369; sensitivity 0.938 ng/mL; CV<10%), immunoglobulin M (IgM; cat. no. MBS2020626; sensitivity 19.27 pg/mL; CV<12%) and immunoglobulin A (IgA; cat. no. MBS2023753; sensitivity 32 pg/mL; CV<12%) were determined in the blood plasma of turkeys by immunoenzymatic methods, using ELISA diagnostic kits from MyBioSource (MyBioSource, Inc.,San Diego, CA, USA). These kits are adapted from chicken assays.

Assessment of Immune-Related Gene Expression

Blood was collected from 8 individuals from each group at 7 and 56 days of life post-hatch via venipuncture of the wing vein. Blood for gene expression studies was collected for the anticoagulant EDTA.

To analyze the expression of IgY, IFN-γ, and IL-6 genes, total RNA was isolated from 200 μL blood using the Syngen Blood/Cell RNA Mini Kit (cat. no. SY301012; Syngen Biotech Sp. z o.o., Wrocław, Poland) according to the manufacturer’s instructions. The RNA samples were quantified spectrophotometrically (Nabi UV-VIS spectrophotometer, MicroDigital Co. Ltd., Gyeonggi, Republic of Korea), and an equal amount of 2 μg was reverse-transcribed into cDNA using the NG dART RT Kit (cat. no. E0801-02; EURx Sp. z o.o., Gdańsk, Poland). Quantitative gene expression analysis was performed using Real-Time PCR with SG qPCR Master Mix (2x) (cat no. E0401-02; EURX Ltd., Gdańsk, Poland) and gene-specific primers (Table 2) using a QuantStudio™ 7 Pro Real-Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA). The transcript levels of the target genes (IgY, IFN-γ, IL-6) were analyzed using the relative expression method, with three reference genes: ACTB, GAPDH, and 18S rRNA. The PCR reaction was carried out with the following thermal profile: initial denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, primer-specific annealing temperature for 30 seconds, and elongation at 72°C for 45 seconds, with a final extension at 72°C for 5 minutes. For each sample, the mean threshold cycle (CT) value was determined for both target and reference genes. The ΔCT value was calculated as the difference between the average CT of the target gene and the average CT of the reference genes, enabling normalization of gene expression levels and reduction of inter-sample variability.

Table 3.

Primer sequences and their corresponding Tm values

TargetSequence (5′→3′)Tm (℃)
GAPDHCCCTGAGCTCAATGGGAAGC55.9
TCAGCAGCAGCCTTCACTAC53.8

ACTBTACCCCATTGAACACGGCAT51.8
CTCCTCAGGGGCTACTCTCA55.9

18S rRNACGAAAGCATTTGCCAAGAAT47.7
GGCATCGTTTATGGTCGG50.3

IgYGAATGGTTGGTGGACGGAGT53.8
GCATCCCTTGACGTGATCCT53.8

IFN-gammaCTGACAAGTCAAAGCCGCAC53.8
AGTCATTCATCTGAAGCTTGGC53.0

IL-6AAGGCGTGGATAGAGAAG48.0
TGACAGATCGGTAACAGAG48.9
Statistical analysis

Each pen was a replicate in the statistical analysis of the rearing results. The values of the remaining traits were determined individually in one bird from each replicate (eight birds from each group), with a body weight close to the group mean. The collected data were subjected to statistical analysis using STATISTICA software version 13 (StatSoft Inc., 2013) and two-way ANOVA, followed by Tukey’s test. The data variability was expressed as standard deviation (σ) and standard error of the mean (SEM), and a P value < 0.05 was considered statistically significant.

Results
Growth performance parameters
The monensin effect

Adding monensin to the diet for turkeys decreased the FCR (P < 0.01, Table 4). Moreover, this treatment decreased BW (P < 0.05) in 3-day-old turkeys (Table 5). It was also found that feeding a diet with monensin addition contributed to obtaining a lower BW (P < 0.05) in 7-day-old turkey hens (Table 11).

Table 4.

Growth performance parameters of turkeys (from 1 to 85 days of life)

ItemnBW 1d, gBW 85d, kgBWG, kgDBWG, gDFI, gFCR, kg/kgMortality birds/%
Antibiotic1
  CON1660.88.0457.98490.2187.72.0810 / 0.0
  ENR1660.98.1748.11391.5192.82.10911 /2.5
  DOX1660.78.2268.16692.5192.82.0852 / 0.4
Monensin2
  −2460.98.1298.06891.0192.42.115 a8/ 1.2
  +2460.88.1688.10791.8189.82.069 b5 / 0.7
Group
  CON −860.88.0157.95589.8189.52.1100 / 0.0
  CON +860.88.0748.01390.5185.92.0530 / 0.0
  ENR −861.28.2068.14591.5195.72.1416 / 2.7
  ENR +860.78.1438.08291.4189.82.0775 / 2.2
  DOX −860.78.1668.10691.6191.92.0942 / 0.9
  DOX +860.88.2878.22693.3193.62.0770 / 0.0
SEM0.1390.0400.0400.4921.0600.007
P value
  Antibiotic (A)0.8950.1830.1820.1810.0730.205NA
  Monensin (M)0.6700.6370.6360.4400.2040.001NA
  A × M interaction0.6240.6480.6490.7780.2860.309NA

NA = not analyzed.

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

BW-body weight, BWG-body weight gain, DBWG-daily body weight gain, DFI-daily feed intake, FCR-feed conversation ratio.

Table 5.

Body weight (BW) of turkeys, total yolk sac weight (TYS), and relative weight of yolk sac (RYS) at 1, 3, and 5 days of life

Itemn1day3day5day

BW, gTYS, gRYS, % of BWBW, gTYS, gRYS, % of BWBW, gTYS, gRYS, % of BW
Antibiotic1
  CON4871.022.673.7591.150.971.07117.80.260.23
  ENR4867.532.744.0591.240.890.98117.80.250.22
  DOX4869.402.794.0692.790.810.88114.40.210.18
Monensin2
  −7270.362.733.9193.56a0.860.93116.10.240.21
  +7268.282.734.0089.90b0.921.02117.30.240.21
Group
  CON −2471.652.623.6592.050.860.94116.20.250.23
  CON +2470.392.733.8690.251.081.20119.50.270.23
  ENR −2469.872.984.2794.890.961.02118.00.240.21
  ENR +2465.202.503.8387.590.820.94117.60.260.23
  DOX −2469.562.613.8193.750.760.83114.10.230.20
  DOX +2469.242.964.3291.840.860.93114.80.180.16
SEM0.5960.0100.1470.7200.0360.0391.1300.0310.028
P value
  Antibiotic (A)0.0530.8950.6770.5650.1800.1740.3790.7600.884
  Monensin (M)0.0750.9910.7910.0100.4090.2600.5870.9930.798
  A × M interaction0.2790.2240.3360.1940.0960.2760.7890.8530.844

Relative sac mass percentage values were subjected to the Bliss (arc sine) transformation for statistical comparisons. The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

Antibody titers
The antibiotic effect (enrofloxacin or doxycycline)

Early administration of enrofloxacin increased the titer of anti-ORT antibodies (P < 0.05) in the blood of 1-day-old turkey hens (Table 8).

The monensin effect

Adding monensin to the diet for turkeys decreased the anti-MPV titer (P < 0.05) in the blood of 5-day-old birds (Table 6). Adding monensin to the diet for turkeys also decreased anti-NDV titer in the yolk sac of 5-day-old turkeys (P < 0.05) and the blood of 56-day-old turkeys (P < 0.05; Table 7). In the groups of 5-day-old turkey hens receiving the addition of monensin in the diet, a lower anti-ORT titer (P < 0.05) in the blood was noted (Table 8).

Table 6.

Anti-aMPV (TRT) antibody titers in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

ItemnYolk sacBlood serum

1d3d5d1d3d5d7d56d
Antibiotic1
  CON481101.3179.8132.223446.42024.12228.81006.2239.5
  ENR481174.8169.1233.323624.51558.41954.21437.4154.5
  DOX48858.0222.654.123345.91363.51810.91956.9117.3
Monensin2
  −721119.1230.9203.223247.31689.22431.2a1615.5207.5
  +72970.3150.176.563697.21608.21564.8b1318.2133.4
Group
  CON −24997.9112.7191.823051.91977.22415.31281.4284.7
  CON +241204.6246.972.613840.92071.02042.3731.0194.3
  ENR −241381.2246.8320.544219.51531.72446.81106.6197.8
  ENR +24968.491.44146.093029.61585.11461.61768.3111.2
  DOX −24978.2333.197.292470.71558.62431.32458.5139.9
  DOX +24737.8112.010.964221.11168.41190.51455.394.63
SEM121.937.4637.02299.8159.7192.6196.239.82
P value
  Antibiotic (A)0.5460.8260.1400.9290.2290.6640.1390.409
  Monensin (M)0.5460.2820.0870.4550.8010.0250.4450.333
  A × M interaction0.5700.1220.8850.1290.7920.6370.1980.965

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

Table 7.

Anti-NDV antibody titers in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

ItemnYolk sacBlood serum

1d3d5d1d3d5d7d56d
Antibiotic1
  CON48262.4144.7561.81967.4798.81221.5462.9283.3
  ENR48537.566.6646.461267.6528.4915.4655.3303.0
  DOX48264.961.2149.381123.8526.61028.8670.9376.1
Monensin2
  −72274.2105.9284.15a1064.8666.21217.1647.9373.8a
  +72435.675.8320.95b1174.4569.6893.3544.9267,8b
Group
  CON −24152.2150.5493.17942.5776.31287.0456.6335.3
  CON +24372.6138.9730.45992.3821.21156.0469.3231.3
  ENR −24410.596.1763.631418.4705.61001.8770.4335.8
  ENR +24664.537.1529.291116.7351.2829.0540.3270.3
  DOX −24260.071.0595.65833.3516.61362.6716.8450.4
  DOX +24269.951.363.101414.3536.5695.0625.1301.7
SEM64.1717.9914.65100.869.63108.169.4427.01
P value
  Antibiotic (A)0.1340.1080.9020.4790.1880.5070.4030,335
  Monensin (M)0.2080.4040.0320.5870.4880.1370.4630.049
  A × M interaction0.7000.8470.7190.2020.4240.5320.7770.819

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

Table 8.

Anti-ORT antibody titers in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

ItemnYolk sacBlood serum

1d3d5d1d3d5d7d56d
Antibiotic1
  CON48459.2179.0119.142991.8b2120.43105.01455.717649.8
  ENR48725.5180.6329.674597.6a1640.22535.4915.618348.9
  DOX48407.2166.0181.383480.1ab1878.72664.01191.517759.8
Monensin2
  −72491.9163.1178.723488.02081.73303.3a1359.418334.7
  +72569.4187.3241.413891.61677.82233.0b1015.817504.4
Group
  CON −24500.6201.4164.60b3464.42523.73284.71465.319110.2
  CON +24417.8156.573.67b2519.21717.02925.41446.016189.4
  ENR −24726.1216.784.06b4025.91935.03263.31047.617867.9
  ENR +24724.9144.5575.28a5169.21345.41807.6783.718830.0
  DOX −24248.971.18287.49ab2973.81786.53362.11565.218025.9
  DOX +24565.4260.875.27b3986.41971.01965.9817.917493.6
SEM75.0338.9555.15262.1158.7233.0108.8540.0
P value
  Antibiotic (A)0.1820.9860.2660.0350.4690.5730.1260.853
  Monensin (M)0.6060.7590.5630.4330.2050.0220.1120.446
  A × M interaction0.5190.3300.0200.1810.4100.5530.3740.342

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

Effect of simultaneous use of monensin in the diet and early administration of antibiotics - enrofloxacin or doxycycline

Early enrofloxacin administration in the group of turkey hens fed a diet with added monensin increased the anti-ORT titer (P < 0.05) in the yolk sac on the 5th day of life, which was not observed in the case of using monensin alone or its combination with doxycycline (Table 8).

Other immune parameters
The antibiotic effect (enrofloxacin or doxycycline)

Early administration of enrofloxacin decreased IgY level (P < 0.01) in the blood of 56-day-old turkey hens (Table 9). Early doxycycline administration initially (5th day of life) decreased IgY level in the blood (P < 0.05), after which the level of this immunoglobulin increased on the 7th day of life (P < 0.05), while on the 56th day of life, IgY level was decreased again (P < 0.01) (Table 9). Early enrofloxacin or doxycycline administration decreased IgM levels in the yolk sacs of 3-day-old turkey hens (P < 0.01). In turn, early doxycycline administration initially (on the 3rd day of life of the turkey) decreased the IgM level in the blood (P < 0.01) after which, on the 7th day of life, there was an increase in this immunoglobulin level (P < 0.01; Table 10). Early doxycycline administration also increased IL-8 level (P < 0.01) in the blood of 7-day-old turkey hens (Table 14). Early enrofloxacin or doxycycline administration increased the IL-2 level (P < 0.05) in the blood of 56-day-old turkey hens (Table 15).

Table 9.

Total IgY antibody levels in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

ItemnYolk sac (mg/total yolk sac)Blood serum (mg/mL)

1d3d5d1d3d5d7d56d
Antibiotic1
  CON4821.1610.0792.9533.2825.6217.594a5.133b5.718a
  ENR4827.237.1692.8513.6065.4506.913ab4.760b3.622b
  DOX4832.028.5482.1473.8655.9586.524b6.174a2.842b
Monensin2
  −7220.67b7.156b2.5273.190b5.4997.1145.2133,794
  +7232.93a10.042a2.7753.979a5.8546.9075.4984,328
Group
  CON −2416.886.735b3.3652.839b5.7608.0755.1855.259
  CON +2425.4313.424a2.5423.7265.4827.1135.0826.178
  ENR −2423.417.046b2.0443.2655.4746.4384.1673.095
  ENR +2431.047.292b3.6593.9475.4277.3895.3534.149
  DOX −2421.737.688b2.1713.4655.2626.8286.2873.028
  DOX +2442.309.409ab2.1234.2646.6536.2196.0602.657
SEM2.3550.5560.3130.1600.1700.1750.1870.297
P value
  Antibiotic (A)0.1570.0850.5220.3220.4590.0380.0050.000
  Monensin (M)0.0090.0070.6930.0140.2940.5460.4320.345
  A × M interaction0.4410.0370.2720.9650.0950.0550.2140.524

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

Table 10.

Total IgM antibody levels in the yolk sac (at 1, 3, and 5 days of life) and blood serum (at 1, 3, 5, 7 and 56 days of life) of turkeys

ItemnYolk sac (µg/total yolk sac)Blood serum (µg/mL)

1d3d5d1d3d5d7d56d
Antibiotic1
  CON48264.1141.07a22.1848.6442.50a72.2761.32b49.45
  ENR48243.090.21b24.8433.9740.44a61.3261.57b52.89
  DOX48239.797.93b15.0948.6931.53b64.4688.28a49.40
Monensin2
  −72242.8100.3019.4635.62b44.44a70.1567.7751.98
  +72255.1119.1821.9451.91a31.87b61.8873.0049.19
Group
  CON −24225.5121.6826.7938.59ab47.4775.1459.3751.35
  CON +24302.7160.4617.5858.70ab37.5269.4163.2747.56
  ENR −24266.393.1517.9436.62b46.5160.1464.4950.97
  ENR +24219.687.2731.7331.33b34.3762.5158.6454.81
  DOX −24236.486.0613.6731.66b39.3375.1879.4653.62
  DOX +24243.1109.8016.5165.72a23.7353.7397.1045.19
SEM12.166.3222.8973.0671.5903.6653.9321.726
P value
  Antibiotic (A)0.6740.0010.3680.0620.0060.4570.0050.643
  Monensin (M)0.6120.1210.6700.0060.0000.2620.4950.422
  A × M interaction0.1170.3110.2730.0220.7310.4060.4540.348

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

The monensin effect

The use of a diet with monensin addition decreased IgY level in yolk sacs (P < 0.01) and blood (P < 0.05) of 1-day-old turkeys (Table 9). In the blood of 3-day-old turkey hens receiving a diet with monensin addition, a decrease in IgM level (P < 0.01) was noted (Table 10). It was also found that feeding a diet with monensin addition contributed to obtaining a lower bursa of Fabricius total mass (P < 0.05) in 7-day-old turkey hens (Table 11). Moreover, adding monensin to the diet for turkeys decreased CD4+ (P < 0.05) and CD8+ (P < 0.05) cell percentages in the blood of 7-day-old turkey hens (Table 12). Turkey hens fed a diet with monensin addition had lower CD4+ CD8+ cells percentage (P < 0.01) in the spleen at the 7th day of life, while they had higher IgM+ cells percentage (P < 0.01) in this organ at the 56th day of life (Table 13) compared to control group receiving a diet without monensin supplementation. In the groups of turkey hens receiving a diet with added monensin, a higher IL-8 level (P < 0.01) in the blood was found at the 56th day of life compared to those fed a diet without monensin addition (Table 15).

Table 11.

Effects of treatments on immunocompetent organ weights (spleen and Bursa Fabricii) at day 7 and 56 days of turkeys’ life

Itemn7 day56 day

Body weight, gspleenBursa FabriciiBody weight, gspleenBursa Fabricii


Total weight, gRelative weight, % of BWTotal weight, grelative weight, % of BWTotal weight, gRelative weight, % of BWTotal weight, gelative weight, % of BW
Antibiotic1
  CON16158.7ab0.1130.0710.2740.1743203.8540.0894.4580.103
  ENR16168.3a0.1240.0740.3070.1843563.7820.0874.3110.099
  DOX16154.4b0.1120.0730.2560.1642743.9520.0924.2960.101
Monensin2
  −24165.1a0.1160.0700.300a0.1843163.6340.0844.4960.104
  +24155.9b0.1170.0750.258b0.1743174.0910.0954.2150.097
Group
  CON −8162.90.1060.0650.2840.1742863.5610.0844.4100.103
  CON +8154.50.1200.0770.2650.1743544.1460.0954.5070.104
  ENR −8175.20.1280.0730.3440.2043963.5760.0814.4960.102
  ENR +8161.40.1210.0750.2700.1743163.9890.0934.1260.095
  DOX −8157.10.1140.0730.2730.1742663.7660.0884.5810.108
  DOX +8151.70.1100.0730.2390.1642814.1370.0964.0110.093
SEM2.2090.0060.0030.0100.00533.210.1210.0030.1090.002
P value
  Antibiotic (A)0.0220.9890.9890.0790.4290.6220.8520.6450.8040.696
  Monensin (M)0.0280.5550.5550.0260.1120.9900.0700.0710.2110.177
  A × M interaction0.6900.8540.8540.4520.5100.6770.9310.9650.4580.515

Relative spleen and bursa Fabricii mass percentage values were subjected to the Bliss (arc sine) transformation for statistical comparisons. The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

Table 12.

Percentages of T-cell and B-cell subpopulations in the blood of turkeys

Itemn7 day56 days

CD4+CD8+CD4+CD8+IgM+CD4+CD8+CD4+CD8+IgM+
Antibiotic1
  CON1620.081.6730.5335.23423.54a2.6750.3417.231
  ENR1619.011.4420.5735.14421.71a2.2050.3196.077
  DOX1621.421.8010.6045.58815.49b1.8070.2406.039
Monensin2
  −2423.07a1.885a0.5945.30421.132.3960.3086.789
  +2417.27b1.393b0.5465.33919.362.0620.2926.108
Group
  CON −826.512.1030.5145.04118.80b2.353ab0.2907.091
  CON +813.651.2430.5535.42628.28a2.998a0.3917.370
  ENR −821.351.4930.6605.04129.34a2.886a0.3817.198
  ENR +816.661.3910.4855.24614.08b1.524b0.2564.956
  DOX −821.352.0590.6095.83015.26b1.950ab0.2536.079
  DOX +821.491.5440.6005.34515.73b1.664b0.2285.999
SEM1.3780.1060.0200.0991.2290.1610.0290.292
P value
  Antibiotic (A)0.7560.3390.3250.1480.0010.0640.3540.155
  Monensin (M)0.0330.0180.2150.8560.3180.2600.7870.231
  A × M interaction0.1370.3090.0690.1590.0000.0270.3030.151

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

Table 13.

Percentages of T-cell and B-cell subpopulations in the spleen of turkeys

Itemn7 day56 days

CD4+CD8+CD4+CD8+IgM+CD4+CD8+CD4+CD8+IgM+
Antibiotic1
  CON1643.5613.951.5778.07436.6619.30b1.91714.27
  ENR1646.5914.201.7398.64833.6923.96a2.05315.25
  DOX1645.9314.401.7408.62634.2024.04a2.22114.60
Monensin2
  −2446.0314.971.836a8.29335.5020.75b2.02112.61b
  +2444.6813.391.534b8.60634.2024.12a2.10616.80a
Group
  CON −845.7113.761.7357.39435.0021.14ab2.064ab12.84
  CON +841.4114.141.4198.75438.3117.46b1.770b15.71
  ENR −847.1514.561.9169.00634.2920.46b2.123ab13.18
  ENR +846.0313.831.5618.29033.0927.46a1.984ab17.31
  DOX −845.2416.591.8588.47837.2020.65b1.878b11.80
  DOX +846.6112.221.6238.77531.2027.44a2.565a17.39
SEM0.9630.6740.0500.2690.8270.8060.0750.623
P value
  Antibiotic (A)0.4210.9640.2530.6260.2750.0040.2080.774
  Monensin (M)0.4930.2550.0020.5680.4190.0100.5410.001
  A × M interaction0.4990.3420.8600.3090.0680.0010.0130.621

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

Table 14.

Immunological parameters in the blood plasma of turkeys at the 7th day of life

ItemnIgA total, ng/mLTLR-4, ng/mLIL-2, ng/mLIL-4, pg/mLIL-6, ng/LIL-8, pg/mLIL-12, ng/mLIL-13, pg/mLIL-1ß, pg/mLTNFα, pg/mLIFN-γ, pg/mLNF-kB, ng/mLCRP, ng/ml
Antibiotic1
  CON16630.01.506a5.01152.78ab34.467.578b14.77b20.4166.56b382.1113.19a2.69410.680a
  ENR16593.50.847b4.96047.53b36.828.234b18.66a18.9973.64ab382.277.70b2.5904.918b
  DOX16521.60.900b5.32556.44a38.3111.192a16.60ab19.3587.36a371.7120.59a2.4389.130a
Monensin2
  −24526.41.279a4.71750.6538.148.85116.0018.6869.12365.5112.57a2.6849.221a
  +24637.10.889b5.48153.8534.919.15217.3520.4882.59391.895.08b2.4657.264b
Group
  CON −8578.52.268a4.084b52.0735.41ab7.63913.96c19.7966.38b365.4142.28a3.346a12.520a
  CON +8681.60.744b5.938ab53.4833.50ab7.51815.58bc21.0366.74b398.884.11bc2.042b8.841abc
  ENR −8568.30.807b5.679ab49.3642.61a7.25621.19a18.2570.67b383.872.01c2.726ab8.236bc
  ENR +8618.70.888b4.241b45.7031.03b9.21216.12bc19.7376.61b380.583.39bc2.455ab1.599d
  DOX −8432.50.764b4.388b50.5236.41ab11.65912.85c18.0070.30b347.2123.42a1.979b6.906c
  DOX +8610.81.036b6.263a62.3640.21ab10.72520.36ab20.69104.42a396.1117.75ab2.897ab11.353ab
SEM28.420.0990.2321.4961.2500.4360.6280.6612.9359.3005.0020.1180.632
P value
  Antibiotic (A)0.2770.0000.7350.0370.4110.0010.0060.6740.0030.8730.0000.5800.000
  Monensin (M)0.0520.0040.0700.2490.1770.6950.1520.1890.0060.1700.0180.2800.016
  A × M interaction0.6410.0000.0020.0740.0350.2890.0000.8960.0120.5180.0010.0000.000

The tables present the original mean and the pooled standard error of the mean (SEM).

a-d

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

IgA -Immunoglobulin A, TLR-4-Toll like receptor 4, IL-2-interleukin 2, IL-4-interleukin 4, IL-6-interleukin 6, IL-8-interleukin 8, IL-12-interleukin 12, IL-13-interleukin 13, IL-1ß-interleukin 1ß, TNFα-turmot necrosis factor, IFN-γ-interferon γ, NF-kB-nuclear factor kappa light chain, CRP-C reactive protein.

Table 15.

Immunological parameters in the blood plasma of turkeys at the 56th day of life

ItemnIgA total, ng/mLTLR-4, ng/mLIL-2, ng/mLIL-4, pg/mLIL-6, ng/LIL-8, pg/mLIL-12, ng/mLIl-13, pg/mLIL-1ß, pg/mLTNFα, pg/mLIFN-γ, pg/mLNF-kB, ng/mLCRP, ng/ml
Antibiotic1
  CON16654.31.1796.726y82.45a47.359.69425.93b17.14103.9223.6a46.36b2.8060.821
  ENR16673.71.1448.464x83.64a45.2010.58335.55a19.99128.5171.8b52.89ab3.3650.860
  DOX16779.81.2658.541x58.00b47.629.85930.02ab19.09123.7174.7b57.66a2.8490.850
Monensin2
  −24795.6a1.1387.40980.52a44.988.448b30.3716.84b97.1b199.242.47b2.457b0.905
  +24609.6b1.2538.41268.87b48.4611.642a30.6320.64a140.3a180.962.13a3.556a0.783
Group
  CON −8773.2abc0.766c5.86879.69a48.647.87012.64b11.85b58.3b210.4a21.64c1.725c0.615b
  CON +8535.4bc1.593a7.58385.22a46.0611.51839.22a22.44a149.5a236.9a71.07a3.886a1.028a
  ENR −8843.9a1.303ab8.34391.31a46.469.56238.88a22.05a114.1a173.4ab46.36b3.335ab1.048a
  ENR +8503.4c0.984bc8.58675.97a43.9411.60432.21a17.93ab142.9a170.3ab59.41ab3.394ab0.672ab
  DOX −8769.6abc1.346ab8.01570.56ab39.837.91339.58a16.60ab118.8a213.9a59.40ab2.309bc1.050a
  DOX +8790.0ab1.183abc9.06745.43c55.4011.80520.45b21.57a128.7a135.6b55.91ab3.388ab0.649ab
SEM31.800.0590.3263.1861.8220.4301.8410.9515.9658.2732.7260.1560.047
P value
  Antibiotic (A)0.1320.5580.0320.0000.8320.5870.0040.3590.0600.0060.0230.1140.916
  Monensin (M)0.0010.2250.1090.0250.3340.0000.9070.0250.0000.2020.0000.0000.126
  A × M interaction0.0250.0000.6200.0480.0680.5490.0000.0030.0010.0120.0000.0030.000

The tables present the original mean and the pooled standard error of the mean (SEM).

a-c

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

IgA -Immunoglobulin A, TLR-Toll like receptor, IL-2-interleukin 2, IL-4-interleukin 4, IL-6-interleukin 6, IL-8-interleukin 8, IL-12-interleukin 12, IL-13-interleukin 13, IL-1ß-interleukin 1ß, TNFα-turmot necrosis factor, IFN-γ-interferon γ, NF-kB-nuclear factor kappa light chain, CRP-C reactive protein.

Effect of simultaneous use of monensin in the diet and early administration of antibiotics - enrofloxacin or doxycycline

An increase in the IgY level in the yolk sacs of 3-day-old turkey hens (P < 0.05) was observed only in the group fed a diet with added monensin, while in the groups fed a diet with added monensin, which received enrofloxacin or doxycycline in the first five days, such an effect was not observed (Table 9). Early doxycycline administration to turkeys fed a diet supplemented with monensin resulted in increased blood IgM levels (P < 0.05) at 1 day of life, which was not observed when monensin alone or monensin with enrofloxacin were used (Table 10). Early enrofloxacin administration to turkeys fed a diet supplemented with monensin decreased the CD4+ (P < 0.01) and CD8+ (P < 0.05) cell percentage in the blood of 56-day-old birds. Such an effect was not observed when doxycycline was administered in the early stage of life of turkeys fed a diet with monensin added (Table 12). An increase in the CD4+ cells (P < 0.01) percentage was observed in the blood of 56-day-old turkeys fed a diet supplemented with monensin, (Table 12). Early enrofloxacin or doxycycline administration to turkeys fed a diet with monensin added increased the percentage of CD8+ cells (P < 0.01) in the spleen of 56-day-old birds, which was not observed in the group fed a diet supplemented with monensin. Similarly, early doxycycline administration to turkeys fed a diet with monensin added increased the percentage of CD4+CD8+ cells (P < 0.05; Table 13). In the blood of 7-day-old turkeys, a decrease in the level of TLR-4 (P < 0.01), IFN-γ (P < 0.01), and NF-kβ (P < 0.01) was observed as a result of feeding a diet with monensin added, which was not observed in the case of this feeding combined with early administration of enrofloxacin or doxycycline. Early enrofloxacin administration to turkey hens fed a diet with monensin added reduced the IL-6 (P < 0.05), IL-12 (P < 0.01), and CRP (P < 0.01) levels in the blood of 7-day-old turkeys. In the case of early doxycycline administration and simultaneous feeding with a diet with monensin, an opposite effect was noted for the IL-12 (P < 0.01) and CRP (P < 0.01) level, and this treatment additionally increased the IL-2 (P < 0.01) and IL-1ß (P < 0.05) level (Table 14). Compared to the group of turkey hens fed a diet without monensin, the addition of this coccidiostat increased the TLR-4 (P < 0.01), IL-12 (P < 0.01), IL-13 (P < 0.01), IL-1ß (P < 0.01), IFN-γ (P < 0.01), NF-kβ (P < 0.01), and CRP (P < 0.01) level in the blood of 56-day-old turkey hens. Early enrofloxacin administration to turkey hens receiving monensin in the diet reduced the IgA level (P < 0.05) in the blood at the 56th day of life. In turn, early doxycycline administration to turkey hens receiving monensin in the diet decreased the IL-4 (P < 0.05), IL-12 (P < 0.01), and TNF-α (P < 0.05) level in the blood of 56-day-old birds (Table 15).

Immune–related gene expression
The antibiotic effect (enrofloxacin or doxycycline)

Early enrofloxacin or doxycycline administration decreased IgY gene expression level in the blood of both 7 (P < 0.05) and 56 (P < 0.05) day-old birds. In turn, early enrofloxacin administration increased the IL-6 gene expression level (P < 0.01) in the blood of 7-day-old turkey hens, while early doxycycline administration increased this gene expression level (P < 0.01) in the blood of 56 day-old birds. Early enrofloxacin administration increased the IFN-γ gene expression level (P < 0.01) in the blood of 7-day-old turkeys, but decreased it (P < 0.05) in the blood of 56-day-old birds (Table 16).

Table 16.

Expression of genes in the blood of 7-day-old and 56-day-old turkeys

Itemn7 day56 day

IgYIL-6IFN-γIgYIL-6IFN-γ
Antibiotic1
  CON160.558a0.330b0.975b0.586a0.295b0.989a
  ENR160.541b0.349a0.995a0.575b0.292b0.975b
  DOX160.544b0.342ab0.985ab0.577b0.305a0.983ab
Monensin2
  −240.5480.3380.9850.5820.2990.980
  +240.5470.3420.9850.5770.2950.985
Group
  CON −80.5570.3260.9720.5900.2990.987
  CON +80.5600.3330.9780.5830.2910.991
  ENR −80.5420.3470.9970.5760.2960.973
  ENR +80.5390.3510.9940.5750.2880.977
  DOX −80.5460.3410.9880.5810.3030.980
  DOX +80.5410.3430.9820.5720.3070.986
SEM0.0030.0020.0030.0020.0020.002
P value
  Antibiotic (A)0.0100.0020.0090.0110.0030.025
  Monensin (M)0.7290.3200.8870.0750.1670.291
  A × M interaction0.7870.8970.6400.4910.1740.963

The tables present the original mean and the pooled standard error of the mean (SEM).

a-b

Means within the same column with different superscripts differ significantly (P < 0.05).

1

Treatment: CON, untreated control; MON, treated with monensin at a dose rate of 90 mg/kg feed for 56 days; ENR, treated with enrofloxacin via drinking water at a dose rate of 10 mg/kg BW for the first 5 days of life; DOX, treated with doxycycline via drinking water at a dose rate of 50 mg/kg BW for the first 5 days of life.

2

Denotes without monensin − or with monensin +.

IgY-Immunoglobulin Y, IL-6-interleukin 6, IFN-γ – interferon.

Discussion

The results of our previous studies have shown that enrofloxacin or doxycycline administration in the first five days of turkeys’ life reduces the anti-MPV and anti-NDV titers and the maternal IgY and IgM levels, which may be due to the direct antibiotic effect on maternal antibodies present in the circulatory system of poults and inhibition of the specific post-vaccination antibodies synthesis (Ognik et al., 2025). In turn, the results of the current study did not confirm the effect of erofloxacin and doxycycline on changes in the anti-MPV and anti-NDV levels. The results of this study indicate that early administration of enrofloxacin to young turkey hens (in the first 5 days of life) had a modulating effect on the immune response development, with the observed effects being both time-limited and differentiated in terms of the type of response (innate vs. adaptive). Early enrofloxacin administration for the first 5 days of turkeys’ life increased the anti-ORT titer in the blood of 1-day-old birds, while in the following days of life their level did not differ significantly between the groups. This indicates that the observed effect was short-term and did not result from an active humoral response. Under the influence of enrofloxacin, there was probably an increased absorption of maternal immunoglobulin present in the yolk sac of the poult, and not its production of this antibody. Khalifeh et al (2009) showed that enrofloxacin administered to laying hens reduced the post-vaccination humoral immune response against NDV and beneficial effect on the cellular immune response. At the same time, our present study have shown that this treatment also decreased the IgM level in the yolk sacs of 3-day-old turkey hens with no differences on days 1st and 5th, which may suggest that enrofloxacin causes a transient disturbance in the metabolism of immunoglobulins or the transport of IgM from the yolk sac to the blood or its earlier use. On the one hand, early enrofloxacin administration for the first 5 days of turkey hens’ life caused early stimulation of the immune system, which was manifested as an increase in the expression of the IL-6 and IFN-γ genes in 7-day-old birds. The fact of stimulation of a non-specific immune reaction may be the body’s response to the disruption of the intestinal microbiota caused by antibiotic therapy (Willing et al., 2011; Smagieł et al., 2023). This statement is confirmed by our previous studies, which showed that the microbiota of the cecum of turkeys is sensitive to the effects of antibiotics such as enrofloxacin or doxycycline to a greater extent than to the effects of monensin (Mikulski et al., 2022). The increased interleukin IL-2 level in the blood of 56-day-old turkeys noted in our study may indicate the Th1-type cellular immune response activation, and Jarosz et al. (2018) indicate such a mechanism. At the same time, as a result of early enrofloxacin administration, a significant reduction in the IgY gene expression was observed both immediately after the end of antibiotic therapy (7th day of life) and in the later period of rearing (56th day of life), which translated into a decrease in the IgY level in the blood of 56-day-old turkeys. This indicates a long-term impairment of B lymphocyte maturation or their secretory function, despite the current activity of cytokines stimulating the cellular response. The observed effect of immunosuppression under the influence of early enrofloxacin administration occurs with a delay, which may indicate an impact on the immune system development and affect the immunity of birds later in life, and not necessarily only a temporary activation of the immune system (Smagieł et al., 2023). Similarly, Jankowski et al. (2022) observed a decrease in IgY level in the blood serum of chickens receiving enrofloxacin in early life. According to Sureshkumar et al. (2013), enrofloxacin, although effective against various bacteria, may have an immunosuppressive effect because it causes a decrease in the lymphocyte level in the bursa of Fabricius and spleen, although these effects may be reversible.

Early doxycycline administration significantly affected the development of the immune response in turkey hens. A transient decrease in IgM levels was observed in the yolk sacs and blood of 3-day-old turkey hens, with no differences between the 1st and 5th day of life. Similar to the effect of enrofloxacin, doxycycline may also temporarily interfere with the transport or metabolism of immunoglobulins, especially since the IgM level in 7-day-old turkey hens increased after the antibiotic was discontinued. Additionally, an increase in the IgY and IL-8 levels in the blood immediately after the end of antibiotic therapy (7th day of life) suggests the activation of a non-specific immune response during this period. Despite the transient activation of the immune system shortly after the end of doxycycline administration, a long-term decrease in the IgY level in the blood was observed on the 5th and 56th day of life and in the expression of its gene on the 7th but also the 56th day of life, which may indicate that doxycycline, like enrofloxacin, may inhibit the maturation of B lymphocytes or their secretory activity (Jankowski et al., 2022). The increase in the IL-6 gene expression and the IL-2 level in the blood of 56-day-old turkeys indicates a possible secondary immune system activation, which does not necessarily mean infection, but may be only a manifestation of adaptation. Initially, antibiotics change the microflora, and in the following weeks, the microbiota may be reprogrammed, which activates the immune system newly (Simon et al., 2016). Importantly, doxycycline did not affect the level of anti-ORT, anti-NDV, or anti-aMPV antibodies at any of the time points studied, which suggests that the specific response was not significantly impaired. The results of the conducted studies imply that despite the temporary activation of the immune system, doxycycline may negatively affect the development of the humoral component of immunity.

Monensin, an ionophore antibiotic used as a coccidiostat in poultry production, affects the immune system through various mechanisms. It modulates the immune system development after hatching, affecting immune cell populations and cytokine expression (Lee et al., 2012). However, its effect on inflammatory responses may be less pronounced than other antibiotics and may cause histological changes in immunocompetent organs, especially in combination with vaccination (Smagieł et al., 2023). Our studies show that monensin added to the diet of turkey hens significantly affected their immune development, especially in the first weeks of life. A decrease in the IgY and IgM levels in yolk sacs and blood, as well as a decrease in the titers of specific antibodies against MPV, NDV, and ORT, indicates a disturbance of both passive and adaptive immunity. The reduction of the bursa of Fabricius mass and a decrease in the number of T lymphocytes (CD4+, CD8+, CD4+CD8+) on 7-day-old birds additionally confirm the potential inhibition of the maturation of the immune system, especially in the cellular response associated with the function of T lymphocytes. A decrease in the subpopulation of CD4+ cells in the intestinal endothelial lymphocytes of broiler chickens receiving monensin as a coccidiostat in the diet was noted by Lee et al. (2012). Although our studies show that in the later period of life (day 56) there was an increase in the IgM+ cells percentage in the spleen and an increase in the IL-8 level in the blood, which may indicate the activation of the non-specific response, these changes do not compensate for the earlier deficits in immunity caused by the administration of monensin in the diet of young turkeys. It appears that monensin may have an immunosuppressive effect, especially during the critical period of primary immunity development (Simon et al., 2016; Wisselink et al., 2017).

Some reports indicate that feeding birds with a feed supplemented with monensin and simultaneously using other antimicrobials modulates the immunity development, changing lymphocyte populations and cytokine expression (Lee et al., 2012). Our studies show that the enrofloxacin administration in the first days of turkeys life and simultaneous feeding with a diet with monensin added, which is also an antibiotic, despite the short-term stimulation of specific passive immunity (increased anti-ORT antibodies titer in the yolk sac of 5-day-old turkey hens) and a visible anti-inflammatory effect (reduction of IL-6, IL-12 and CRP levels immediately after antibiotic therapy). The decrease in the number of CD4⁺ and CD8⁺ T lymphocytes in peripheral blood, with a simultaneous increase in the CD4⁺CD8⁺ cells percentage in the spleen, observed in the study, may indicate the development of immunosuppression in turkeys under the influence of the simultaneous administration of enrofloxacin and monensin. Both substances are known for their antibacterial activity, but their effect on the functioning of the immune system is complex and may lead to immunomodulatory or immunosuppressive effects. Monensin, as an ionophore, disturbs the intracellular ionic balance, which may lead to disturbances in signal transduction, as well as apoptosis of activated T lymphocytes. Enrofloxacin, a fluoroquinolone, has not only antibacterial but also immunomodulatory effects, affecting, among others, the production of cytokines and the functioning of mitochondria (Lee et al., 2018). An increase in the number of CD4⁺CD8⁺ lymphocytes in the spleen may suggest an arrest of the T cell maturation process or their local accumulation as a result of altered microenvironmental conditions, e.g., by impaired expression of cytokines or chemokine receptors. CD4⁺CD8⁺ cells are typically considered a transitional population in the thymus, but their presence in peripheral organs, such as the spleen, is sometimes noted in pathological situations, immune activation, or T cell maturation disorders (Lee et al., 2018). From a functional point of view, the described changes may lead to a weakening of the immune competence of the organism. A decrease in functional effector cells (CD4⁺ and CD8⁺) in the peripheral circulation may result in a limited ability to eliminate pathogens and respond to new antigens. Therefore, the concomitant enrofloxacin and monensin use in turkeys should be considered a potential immunosuppressive factor.

Administration of doxycycline in early life to turkeys fed a diet with monensin added leads to strong activation of the early non-specific response (increased IgM level already on the 1st day of antibiotic and coccidiostat administration) and increased IL-12, IL-2, IL-1β, and CRP levels immediately after the end of antibiotic therapy with doxycycline. IL-1β is a classic mediator of the acute phase of inflammation. IL-12 is a strong activator of NK and Th1 cells. IL-2 stimulates T lymphocyte proliferation, and CRP is a marker of the acute phase and systemic inflammatory response (Smagieł et al., 2023). Increased levels of these indicators usually indicate an inflammation developing, which should not usually occur immediately after the end of antibiotic therapy. However, such an effect suggests activation of the inflammatory response, which may indicate a side effect of treatment or excessive stimulation of the immune system. Administration of antibiotics in the absence of infection can cause inflammation by inducing dysbiosis, activating the innate system by DAMPs (Damage-Associated Molecular Pattern) and other metabolites, and modifying the function of immune regulatory cells (Roh et al., 2018; Taitz et al., 2025). The immune homeostasis of the organism is largely dependent on the microbiome and activated signaling pathways regulating the immune system response. It is worth noting that this strong effect of immune system stimulation is the result of the interaction of two active substances: an antibiotic and a coccidiostat. It was particularly noticeable through the increased CD8+ and CD4+CD8+ cells percentages in the spleen of 56-day-old turkeys, which indicates the stimulation of a cytotoxic immune response. The reduction in the levels of pro- and anti-inflammatory cytokines IL-4 and IL-12 and TNF-α observed in our study in the blood of 56-day-old turkeys, i.e., after a longer time after doxycycline administration, is most likely due to the body’s natural tendency to return to a state of immunological rest (Tykałowski et al., 2025).

Madubuike et al. (2020) noticed that early treatment with doxycycline reduced body weight gain and FCR, but did not affect the immune response after vaccination against NDV. In turn, our studies show that early administration of both enrofloxacin and doxycycline did not worsen the growth performance of turkeys. Similarly, Sureshkumar et al. (2013) did not observe any deterioration in the production performance of broiler chickens given enrofloxacin. However, our studies show that feeding a diet with the addition of the coccidiostat monensin resulted in a deterioration in growth in the early rearing period (between 3 and 7 days of life). Despite a reduced feed conversion ratio throughout the rearing period, turkeys fed the feed with the addition of monensin ultimately achieved a body weight similar to the other experimental groups. Our previous studies, in which turkeys were given enrofloxacin or doxycycline or fed feed with added monensin, did not show the effect of these treatments on the growth results of the birds compared to the control group, which was not subjected to any treatments. However, it was found that birds receiving monensin in the diet gained better than those that received doxycycline for five days in the early rearing period (Mikulski et al., 2022; Smagieł et al., 2023). The combined administration of antibiotics (enrofloxacin or doxycycline) with a diet containing the coccidiostat monensin used in the presented studies did not worsen the growth performance of the birds.

Conclusions

Monensin, a coccidiostat approved for use as a feed additive, disturbs passive and specific immunity, especially in young turkeys, as it may negatively affect the maturation of T lymphocyte populations and the development of immunocompetent organs. Early enrofloxacin or doxycycline administration to young turkeys may lead to undesirable changes in the developing immune system, including impaired humoral immunity in later life. This may reduce the effectiveness of the humoral post-vaccination response in the longer term of the birds’ lives, especially in vaccination programs against pathogens such as ORT, NDV, and MPV. Enrofloxacin administration to turkeys in the first five days of life and feeding them a diet containing the coccidiostat monensin strongly stimulated the immune system, which in consequence caused changes in the immune system, indicating immunosuppression in the period distant from the enrofloxacin administration. The immunosuppressive effect was not observed in turkeys that received only monensin or a monensin and doxycycline combination. The early administration of the antibiotics enrofloxacin or doxycycline with a diet without coccidiostat or containing the coccidiostat monensin did not affect the turkeys’ growth performance.

DOI: https://doi.org/10.2478/aoas-2025-0125 | Journal eISSN: 2300-8733 | Journal ISSN: 1642-3402
Language: English
Submitted on: May 13, 2025
|
Accepted on: Oct 29, 2025
|
Published on: Feb 18, 2026
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2026 Radosław Smagieł, Katarzyna Ognik, Ewelina Cholewińska, Przemysław Sołek, Dariusz Mikulski, Bartłomiej Tykałowski, Jan Jankowski, Krzysztof Tutaj, published by National Research Institute of Animal Production
This work is licensed under the Creative Commons Attribution 3.0 License.

AHEAD OF PRINT