Have a personal or library account? Click to login
Zearalenone-Induced Toxicity and the Ameliorative Role of Silicate in Nile Tilapia (Oreochromis niloticus): Evaluation of Growth, Feed Efficiency, Oxidative Stress, and Related Gene Markers Cover

Zearalenone-Induced Toxicity and the Ameliorative Role of Silicate in Nile Tilapia (Oreochromis niloticus): Evaluation of Growth, Feed Efficiency, Oxidative Stress, and Related Gene Markers

Open Access
|Feb 2026

Figures & Tables

Figure 1.

The histomorphology Nile tilapia intestine after a 75-day feeding experiment. Stain H&E. Bar = 100 μm. D1: basal diet free of supplements; D2: basal diet + Zearalenone (1 mg /kg diet); D3: basal diet + Sodium metasilicate (0.5 g /kg diet); D4: basal diet + Zearalenone (1 mg /kg diet) + Sodium metasilicate (0.5 g /kg diet). White arrow: Normal villi and goblet cells. Red arrow: necrosis of the intestinal villi with marked sloughing of the mucosal lining
The histomorphology Nile tilapia intestine after a 75-day feeding experiment. Stain H&E. Bar = 100 μm. D1: basal diet free of supplements; D2: basal diet + Zearalenone (1 mg /kg diet); D3: basal diet + Sodium metasilicate (0.5 g /kg diet); D4: basal diet + Zearalenone (1 mg /kg diet) + Sodium metasilicate (0.5 g /kg diet). White arrow: Normal villi and goblet cells. Red arrow: necrosis of the intestinal villi with marked sloughing of the mucosal lining

Figure 2.

The histomorphology Nile tilapia liver after a 75-day feeding experiment. Stain H&E. Bar = 50 μm. D1: basal diet free of supplements; D2: basal diet + Zearalenone (1 mg /kg diet); D3: basal diet + Sodium metasilicate (0.5 g /kg diet); D4: basal diet + Zearalenone (1 mg /kg diet) + Sodium metasilicate (0.5 g /kg diet). Green arrow: Normal pancreatic tissue (HP) and hepatocytes. Red arrow: congestion of the portal vein and blood sinusoids. White arrow: cytoplasmic eosinophilia. Yellow arrow: vacuolation of the hepatocytes
The histomorphology Nile tilapia liver after a 75-day feeding experiment. Stain H&E. Bar = 50 μm. D1: basal diet free of supplements; D2: basal diet + Zearalenone (1 mg /kg diet); D3: basal diet + Sodium metasilicate (0.5 g /kg diet); D4: basal diet + Zearalenone (1 mg /kg diet) + Sodium metasilicate (0.5 g /kg diet). Green arrow: Normal pancreatic tissue (HP) and hepatocytes. Red arrow: congestion of the portal vein and blood sinusoids. White arrow: cytoplasmic eosinophilia. Yellow arrow: vacuolation of the hepatocytes

Figure 3.

Immunoglobulin M (IgM) and antioxidant biomarkers in Nile tilapia following 75 days of feeding
Immunoglobulin M (IgM) and antioxidant biomarkers in Nile tilapia following 75 days of feeding

Figure 4.

Relative mRNA expression levels of growth hormone receptor (GHR), insulin-like growth factor (IGF), glutathione peroxidase (GPx), lysozyme (LYZ), catalase (CAT), and complement component 3 (C3) in the liver of Nile tilapia (Oreochromis niloticus) after a 75-day feeding trial. Data are expressed as mean ± standard error (SE). Different letters indicate statistically significant differences among treatment groups (P < 0.05)
Relative mRNA expression levels of growth hormone receptor (GHR), insulin-like growth factor (IGF), glutathione peroxidase (GPx), lysozyme (LYZ), catalase (CAT), and complement component 3 (C3) in the liver of Nile tilapia (Oreochromis niloticus) after a 75-day feeding trial. Data are expressed as mean ± standard error (SE). Different letters indicate statistically significant differences among treatment groups (P < 0.05)

Nutrient composition of experimental diets_

Ingredients%
Fish meal (65% CP)15
Soybean meal (44% CP)35
Yellow corn20
Wheat bran7
Wheat flour6
Rice bran5
Gluten5
Fish oil3
Soybean oil2
Dicalcium phosphate1
Vitamin and mineral premix 11

Proximate profile

Crude protein (%)32.12 ± 0.14
Crude lipids (%)8.25± 0.11
Fiber (%)3.42 ± 0.16
Ash (%)6.63 ± 0.20

Biometric indices and intestinal morphology of Nile tilapia following a 75-day feeding trial

ItemsD1D2D3D4P-Value
Hepatosomatic Index (HSI, %)1.07±0.081.02±0.031.02±0.031.02±0.040.877
Intestino-Somatic Index (ISI, %)2.53±0.132.68±0.182.37±0.032.39±0.090.306
Visceral Somatic Index (VSI, %)3.82±0.163.93±0.213.57±0.053.61±0.130.344
Fulton’s Condition Factor (K factor)2.16±0.112.11±0.072.02±0.032.12±0.040.569
Villus length (µm)450.1±11.91b225.4±4.4c647.96±18.03a416.27±5.38b0.000
Villus width (µm)153.41±4.17b119.44±3.21c224.91±6.36a120.98±6.67c0.000
Goblet cells (cell/mm2)267±7b146.33±10.81c350.33±21.84a233±7.64b0.000

Blood biomarker profiles of Nile tilapia following a 75-day feeding trial

ItemsD1D2D3D4P-Value
Total Protein (g/dL)4.29±0.25a2.74±0.24b4.64±0.12a4.14±0.51a0.013
Albumin (g/dL)1.7±0.341.45±0.271.81±0.241.65±0.390.873
Globulin (g/dL)2.59±0.16a1.29±0.1b2.82±0.19a2.5±0.16a0.000
Total Cholesterol (mg/dL)157.67±6.36b211±10.02a140±10.44b158±10.12b0.004
Triglyceride (mg/dL)124.33±6.17a72±5.51c106.33±6.69b98±2.65b0.001
High-density lipoprotein (mg/dL)45.13±6.9243.65±4.3948.02±3.7841±5.590.822
Alanine Aminotransferase (IU/L)10.33±0.88c70.33±1.76a10.33±1.45c22±1.15b0.000
Aspartate Aminotransferase (IU/L)32±1.53c113±3.21a32.33±2.03c48.67±1.45b0.000

Sequences of primers used for quantitative real-time PCR (qRT-PCR) analysis

GeneSequences (5′-3′)ReferenceAccession number
Ef1F: TCAACGCTCAGGTCATCATC(Con et al., 2019)XM_003458541
R: ACGGTCGATCTTCTCAACCA
GHR1F: CAGACTTCTACGCTCAGGTC(El-Naggar et al., 2021)AY973232.1
R: CTGGATTCTGAGTTGCTGTC
IGF-1F: GTTTGTCTGTGGAGAGCGAGG Y10830.1
R: GAAGCAGCACTCGTCCACG
GPxF: CCAAGAGAACTGCAAGAACGA(El-Kassas et al., 2022)DQ355022.1
R: CAGGACACGTCATTCCTACAC
CATF: CCCAGCTCTTCATCCAGAAAC(Abdo et al., 2021)JF801726.1
R: GCCTCCGCATTGTACTTCTT
LYZF: AAGGGAAGCAGCAGCAGTTGTG(Esam et al., 2022)XM_003460550.2
R: CGTCCATGCCGTTAGCCTTGAG
C3F: GGTGTGGATGCACCTGAGAA XM_013274267.2
R: GGGAAATCGGTACTTGGCCT

Key growth performance indicators of Nile tilapia following a 75-day dietary trial

ParametersD1D2D3D4P-Value
Initial Body weight, g20±0.1420±0.0119.96±0.2119.94±0.070.985
Final Body weight, g81.29±2.75b65.27±2.53c97.04±2.01a78.56±2.75b0.000
Weight gain, g61.29±2.83b45.28±2.53c77.08±1.82a58.62±2.77b0.000
Specific growth rate (SGR, %/day)1.87±0.05b1.57±0.05c2.11±0.02a1.83±0.05b0.000
Feed intake, g (FI)122.86±1.13b112.56±3.21c138.79±1.99a123.54±2.2b0.000
Feed conversion ratio (FCR)2.01±0.08b2.5±0.15a1.8±0.05b2.12±0.13b0.012
Survival rate (SR, %)96.67±1.6798.33±1.6798.33±1.6796.67±3.330.900
DOI: https://doi.org/10.2478/aoas-2025-0110 | Journal eISSN: 2300-8733 | Journal ISSN: 1642-3402
Language: English
Submitted on: Jun 20, 2025
|
Accepted on: Oct 3, 2025
|
Published on: Feb 17, 2026
In partnership with: Paradigm Publishing Services
Publication frequency: Volume open

© 2026 Mohamed A. Gomaa, M.A. Ibrahim, M.I. Bassiouni, Mahmoud A.O. Dawood, Mona Assas, Rasha A. Alwakeel, Amr I. Zaineldin, Mahmoud S. Gewaily, Ali A. Soliman, Akram Ismael Shehata, Mohammed F. El Basuini, published by National Research Institute of Animal Production
This work is licensed under the Creative Commons Attribution 3.0 License.

AHEAD OF PRINT