Skip to main content
Have a personal or library account? Click to login
Detection of Virulence Genes and ABC Genotypes in Candida Albicans Isolates from Candidemia Patients Cover

Detection of Virulence Genes and ABC Genotypes in Candida Albicans Isolates from Candidemia Patients

Open Access
|Jul 2026

Full Article

1. Introduction

Invasive fungal infections pose a significant global health threat due to their high mortality rates and the recent increase in antifungal resistance. Candidemia is the most common form of invasive fungal infection, particularly affecting immunocompromised individuals and patients in intensive care units, where it is associated with high mortality rates (Shrivastava and Whiteway 2025). The high incidence in these patient groups is associated with risk factors such as the use of broad-spectrum antibiotics, chemotherapy, neutropenia, and invasive procedures (Dawoud et al. 2024). The epidemiology of candidemia varies considerably across geographic regions, even among healthcare facilities within the same country. In recent years, there has been a notable rise in cases caused by non-albicans species, including Nakaseomyces glabratus (formerly Candida glabrata), Candida tropicalis, Candida parapsilosis, and Pichia kudriavzevii (formerly Candida krusei). Furthermore, Candidozyma (formerly Candida) auris has emerged as an important cause of candidemia, gaining attention due to outbreaks in healthcare settings (Chavez et al. 2025). Nevertheless, Candida albicans remains the most prevalent species, both as a member of the microbiota and as an infectious agent (Shrivastava and Whiteway 2025).

In the development of candidemia, both host immune factors and the virulence attributes of the causative species play a crucial role (Dawoud et al. 2024). C. albicans possesses several major virulence factors, including adhesion, phenotypic switching, hyphal formation, biofilm production, and the secretion of extra-cellular hydrolytic enzymes such as hemolysins, proteases, and phospholipases. These factors contribute to the pathogenicity of C. albicans by enabling adhesion and proliferation on host cell surfaces and abiotic materials such as catheters, promoting biofilm formation, facilitating the yeast-to-hypha transition, producing tissue-damaging enzymes, and allowing evasion from immune defenses. Through these mechanisms, C. albicans can multiply, colonize, invade tissues, and cause extensive damage (Shrivastava and Whiteway 2025; Saiprom et al. 2023).

The first step in the infection process is the attachment of C. albicans cells to host cell surfaces, a process in which specific surface proteins called adhesins play a crucial role. Among these adhesins are glycosylphosphatidylinositol (GPI)-anchored cell surface proteins encoded by the eight-member agglutinin-like sequence (ALS) gene family (ALS1ALS7 and ALS9). Another major adhesin of C. albicans is hyphal wall protein 1 (HWP1), a hypha-associated GPI-anchored mannoprotein located on the outer surface and expressed during germ tube and hyphal growth. The HWP1 and ALS gene families are essential for C. albicans adhesion to host tissues, invasion, and biofilm formation. Another important virulence factor is secreted aspartyl proteinases (SAP), encoded by ten different genes (SAP1SAP10). Among these, SAP1–SAP3 are primarily associated with mucosal infections, while SAP4–SAP6 are linked to systemic infections (Talapko et al. 2021). Seven genes, PLA, PLB1, PLB2, PLC1, PLC2, PLC3, and PLD1, are involved in the synthesis of phospholipase enzymes, with phospholipase B1 (PLB1), PLB2, PLC1, and PLD1 being particularly associated with virulence. PLB1 is a glycoprotein that exhibits both hydrolase and lysophospholipase transacylase activities, disrupting the structural integrity of cell membranes by hydrolyzing the ester bonds of phospholipids. Enzyme activity is especially concentrated at the tips of hyphae, where it contributes to tissue invasion (Shrivastava and Whiteway 2025).

C. albicans is divided into genotypes based on the presence or absence of a transposable group I intron in the ITS1 region of the 25S rDNA. This method, also referred to as 25S intron analysis or ABC genotyping, relies on ribosomal sequencing and classifies C. albicans isolates as genotype A (450 bp), genotype B (840 bp), or genotype C (450 and 840 bp) according to the size of the PCR amplification products. Genotyping is a very useful tool for epidemiologic analysis. Studies have shown that genotype A is the most prevalent genotype worldwide in all clinical forms of candidiasis, while the frequencies of genotypes B and C vary according to geographical region and the type of infection involved. Genotypes B and C are predominantly isolated from oral samples (Moron and Cabrera 2019; Kumar and Tejashree 2022; Ali et al. 2024).

The aim of this study was to determine the genotypes of C. albicans strains, isolated from blood samples of patients with candidemia, by 25S intron analysis and to investigate the presence of virulence genes by PCR, including ALS1 and HWP1, which are involved in biofilm formation and adhesion; PLB1, which is associated with phospholipase activity; SAP1, SAP2, and SAP4, which are related to secreted aspartyl proteinase activity.

2. Material and methods

2.1. Isolates

This study included a total of 50 strains isolated from the blood cultures of patients with candidemia and identified as C. albicans using either the API ID 32 C (bioMérieux, France) or the VITEK 2 YST (bioMérieux, France) systems in the Mycology Laboratory of the Department of Medical Microbiology, Istanbul University, Istanbul Faculty of Medicine, between 2021 and 2025. These strains were stored at −80 °C in brain heart infusion broth (BD Difco, USA) supplemented with 3% glycerol. C. albicans ATCC 10231 was used as the control strain.

The isolates were inoculated onto Sabouraud dextrose agar (BD Difco, USA) and incubated at 37 °C for 24–48 hours.

DNA isolation was performed with the DNA Extraction Kit (MicroLine, Türkiye) following the manufacturer's instructions.

2.2. ABC genotyping

ABC genotyping was based on the presence or absence of a transposable group I intron in the ITS1 region of rDNA. Amplification of the 25S rDNA region was performed using the primers CABC Forward (5′-ATAAGGGAAGTCGGCAAAATAGATCCGTAA-3′) and CABC Reverse (5′-CCTTGGCTGTGGTTTCGCTAGATAGTAGAT-3′). The PCR reaction mixture was prepared according to the manufacturer's instructions and consisted of 12.5 μl 2x qPCRBIO Taq Mix (PCR Biosystems, USA), 1 μl forward primer, 1 μl reverse primer, 5.5 μl sterile ultrapure water, and 5 μl DNA, for a total volume of 25 μl. PCR amplification was carried out using the Labcycler Basic (SensQuest, Germany), with an initial denaturation at 95 °C for one minute, followed by 40 cycles of denaturation at 95 °C for 15 seconds, annealing at 60 °C for 15 seconds, extension at 72 °C for 2 minutes, and a final extension at 72 °C for 5 minutes (Mashaly and Zeid 2022; Fornari et al. 2016).

The amplified products were separated by size using agarose gel electrophoresis. The genotypes of C. albicans isolates were determined based on their band sizes by comparison with a DNA ladder as genotype A (450 bp), genotype B (840 bp), and genotype C (two bands of 450 and 840 bp) (Mashaly and Zeid 2022).

2.3. Detection of the virulence genes

The presence of SAP1, SAP2, SAP4, ALS1, HWP1, and PLB1 genes in C. albicans isolates was investigated by PCR. The primers used are listed in Table 1. The PCR reaction mixture was prepared according to the manufacturer's instructions and had a total volume of 25 μl, consisting of 12.5 μl 2x qPCRBIO Taq Mix (PCR Biosystems, USA), 1 μl forward primer, 1 μl reverse primer, 5.5 μl sterile ultrapure water, and 5 μl DNA. The same PCR conditions were applied for all genes and amplification was carried out using the Labcycler Basic (SensQuest, Germany), with an initial denaturation at 95 °C for one minute, followed by 40 cycles of denaturation at 95 °C for 15 seconds, annealing at 60 °C for 15 seconds, extension at 72 °C for 2 minutes, and a final extension at 72 °C for 5 minutes. The amplified products were visualized by agarose gel electrophoresis with a UV trans-illuminator using a DNA ladder (Costa et al. 2010; Dikmen et al. 2021).

Table 1.

Primers used for the detection of virulence genes

GenePrimer sequence (5′–3′)Amplicon size (bp)Reference
SAP1-FTCAATCAATTTACTCTTCCATTTCTAACA161Costa 2010
SAP1-RCCAGTAGCATTAACAGGAGTTTAATGACA
SAP2-FAACAACAACCCACTAGACATCACC178
SAP2-RTGACCATTAGTAACTGGGAATGCTTTAGGA
SAP4-FCATTCATTCCTTTAATACCGACTATC156
SAP4-RGGTAACAAACCCTGTAGATCTTTTAA
ALS1-FGACTAGTGAACCAACAAATAC318Dikmen 2021
ALS1-RCCAGAAGAAACAGCAGGTGA
HWP1-FATGACTCCAGCTGGTTC572
HWP1-RTAGATCAAGAATGCAGC
PLB1-FATGATTTTGCATCATTTG751
PLB1-RAGTATCTGGAGCTCTAC

2.4. Statistical analysis

Statistical analyses were performed using SPSS version 30.0 (IBM Corp., Armonk, NY, USA). The presence of virulence genes was compared among different C. albicans genotypes using the Freeman-Halton extension of Fisher's exact test. This test was applied because the number of cells with expected values below 3 exceeded 20% of the total number of cells in the n×r contingency tables. A p-value of <0.05 was considered statistically significant.

3. Results

A total of 50 C. albicans isolates included in the study were obtained from eight pediatric (0–18 years, 16%) and 42 adult (>18 years, 84%) patients. Of these patients, 28 (56%) were female and 22 (44%) were male. The mean age of the patients was 54.08 years. Among the adult patients, six (12%) were aged 18–44 years, 14 (28%) were aged 45–65 years, and 22 (44%) were over 65 years. Overall, 31 patients (62%) were hospitalized in surgical units, 10 (20%) in intensive care units, and nine (18%) in internal medicine units.

Based on the amplicon sizes observed after gel electrophoresis, 28 (56%) of the 50 C. albicans isolates were identified as genotype A, 14 (28%) as genotype B, and eight (16%) as genotype C.

The SAP1 gene was positive in 48 (96%) and negative in two (4%) isolates; SAP2 and SAP4 were positive in 49 (98%) and negative in one (2%) isolate; ALS1 and HWP1 were positive in 46 (92%) and negative in four (8%) isolates; and PLB1 was positive in 47 (94%) and negative in three (6%) isolates (Table 2).

Table 2.

Distribution and relationship between genotypes and the presence of virulence genes (n, %).

GeneTotalGenotype A (n=28)Genotype B (n=14)Genotype C (n=8)p value
SAP148 (96.0)26 (92.8)14 (100)8 (100)0.680
SAP249 (98.0)28 (100)13 (92.8)8 (100)0.439
SAP449 (98.0)28 (100)13 (92.8)8 (100)0.439
ALS146 (92.0)26 (92.8)13 (92.8)7 (87.5)0.801
HWP146 (92.0)25 (89.3)13 (92.8)8 (100)0.999
PLB147 (94.0)26 (92.8)13 (92.8)8 (100)0.999

No significant differences were observed in the distribution of virulence genes among the different genotypes of C. albicans. As all p-values were greater than 0.05, each gene showed a similar distribution across the groups (Table 2).

4. Discussion

Candida species cause a variety of clinical conditions, usually of endogenous origin, ranging from mild skin and mucosal infections to severe invasive infections, particularly in individuals with weakened immune systems. In addition to host-related risk factors, strain-specific virulence factors also play an important role in the development of infection. C. albicans is the most common Candida species, both as a member of the normal microbiota and as a pathogenic agent. It possesses several major virulence factors, including adhesion, phenotypic switching, hyphal formation, biofilm production, and the secretion of hydrolytic enzymes such as hemolysins, proteases, and phospholipases. Through these virulence mechanisms, C. albicans multiplies, colonizes, invades host tissues, and causes cellular damage (Shrivastava and Whiteway 2025). Among Candida species, C. albicans has been reported to exhibit the highest virulence due to its strong biofilm-forming capacity and high levels of proteinase and melanin production. Moreover, virulence genes have been found to be more prevalent in C. albicans than in other Candida species (Makled et al. 2024). Makled et al. (2024) also reported that the antifungal resistance profiles of Candida isolates were associated with the presence of virulence genes, particularly noting a correlation between flucytosine resistance and the presence of HLP and HWP genes.

Some researchers have reported a correlation between the body sites from which Candida spp. are isolated and the expression of virulence factors. Candida species isolated from blood have been found to be more virulent and to possess a greater number of virulence factors, likely due to their ability to adhere to catheters and secrete extracellular enzymes that facilitate tissue invasion (Talapko et al. 2021; Makled et al. 2024). Samaranayeke et al. (2013) demonstrated that, in vitro, the presence of serum enhanced C. albicans virulence gene expression and promoted the formation of a thicker biofilm layer. However, other researchers reported no significant differences in virulence factor profiles among strains isolated from different clinical samples (Chen et al. 2021; Jabeen et al. 2023).

SAPs, which are hydrolytic enzymes of C. albicans, comprise ten members encoded by the SAP gene family and are expressed at different stages of infection. These enzymes play crucial roles in host tissue invasion, immune evasion, adhesion, hyphal growth, and biofilm formation, thereby contributing to tissue damage and dissemination (Gerges et al. 2023; Pawar et al. 2022). In vitro studies have shown that SAP1, SAP2, and SAP3 are expressed exclusively by yeast cells, whereas SAP4, SAP5, and SAP6 are expressed during the hyphal phase. SAP1-SAP3 are primarily associated with mucosal infections, while SAP4-SAP6 are linked to systemic infections (Mohammed et al. 2017). Among these, SAP1 plays a particularly important role in promoting tissue damage and facilitating host invasion (Dikmen et al. 2021).

Makled et al. (2024) reported the presence of the SAP1 gene in 26 (54.2%) of 48 C. albicans strains isolated from various clinical specimens, including 28 from blood. They also found that all isolates showing phenotypic proteinase activity were SAP1-positive (100%). Shrief et al. (2019) detected the SAP1 gene in 65 (65%) of 100 C. albicans isolates, 56 of which were isolated from blood samples. Dawoud et al. (2024) identified the SAP2 gene in nine (52.9%) of 17 C. albicans isolates obtained from pediatric and adult patients with candidemia. Bilgin et al. (2020) investigated the presence of the SAP4 gene, known to play a key role in systemic infections, in 50 C. albicans strains isolated as causative agents of candidemia and found it to be positive in 49 isolates (98%). Similarly, Ardehali et al. (2019) detected the SAP4 gene in 57 (88%) of 65 C. albicans strains isolated from various clinical specimens, including 21 blood samples, obtained from patients in intensive care units. In the present study, among the 50 C. albicans isolates examined, the SAP1 gene was detected in 48 (96%) isolates, while SAP2 and SAP4 were detected in 49 (98%) isolates each.

ALS, a family of glycoproteins, constitutes the largest group of adhesins in C. albicans. ALS1, one of the members of this family, is a cell surface protein that enhances adhesion to endothelial and epithelial cells and plays a crucial role in adhesion and hyphal development (Dikmen et al. 2021; Obais et al. 2023). Together with HWP1, ALS1 is also important for mature biofilm formation, and the expression of these genes has been shown to increase during biofilm development (Makled et al. 2024; Gerges et al. 2023). Obais et al. (2023) reported that ALS1 and ALS3 play a significant role in the development of systemic candidiasis.

Makled et al. (2024) detected the ALS1 gene in 28 of 48 C. albicans strains (58.3%) isolated from various clinical specimens, including 28 from blood. Dawoud et al. (2024) reported that 13 of 17 C. albicans isolates (76.5%) from blood cultures were ALS1-positive. Shrief et al. (2019) found the ALS1 gene in 65 of 100 isolates (65%), 56 of which were from blood samples. Ardehali et al. (2019) reported the presence of ALS1 in 60 of 65 isolates (92%), including 21 from blood. Similarly, İnci et al. (2013) detected this gene in 11 of 13 blood isolates (84.6%). In the present study, 46 of the 50 isolates examined (92%) were ALS1-positive.

The β-glucan-bound mannoprotein encoded by the HWP1 gene, located in the hyphal cell wall, is an important protein that enables C. albicans to adhere to various surfaces and host cells, including epithelial cells (Makled et al. 2024; Gerges et al. 2023; Obais et al. 2023). Expression of HWP1 has been shown to be particularly high during the early stages of biofilm formation (Mohammadi et al. 2023). HWP1 plays a critical role in hyphal development and the induction of tissue damage in the host. In addition, HWP1, together with ALS1 and ALS3, has been reported to contribute significantly to the development of systemic candidiasis (Obais et al. 2023).

Makled et al. (2024) reported that 44 of 48 C. albicans isolates (91.7%), including 28 from blood, were HWP1-positive. Dawoud et al. (2024) detected HWP1 in 14 of 17 blood isolates (82.4%), and found that all 12 biofilm-forming isolates were positive (100%). Shrief et al. (2019) examined 100 C. albicans isolates, 56 from blood, and found HWP1 in 77 isolates (77%). Ardehali et al. (2019) reported HWP1 positivity in 62 of 65 strains (95%), including 21 blood isolates. İnci et al. (2013) detected this gene in only one of 13 blood isolates (7.7%). In the present study, HWP1 was detected in 46 of 50 isolates (92%) and absent in four (8%).

Phospholipases are enzymes that hydrolyze phospholipids, leading to disruption of host cell membranes. Among them, PLB1 and PLD1 play key roles in the pathogenicity of C. albicans (Mohammadi et al. 2023). By cleaving the ester bonds of glycerophospholipids in host cell membranes, phospholipases lyse cells and facilitate tissue penetration and invasion. In addition, they promote adhesion by altering the surface properties of host cells (Mashaly and Zeid 2022). C. albicans exhibits stronger phospholipase activity than other Candida species (Saiprom et al. 2023).

Tunç et al. (2021) detected PLB1 in all 30 C. albicans strains (100%) isolated from blood, with 26 strains (87.7%) exhibiting phenotypic phospholipase activity. In the same study, 30 C. albicans strains isolated from the oral cavity were also 100% PLB1-positive, with 80% showing phospholipase activity, and no statistically significant difference was observed between the two groups. Shrief et al. (2019) reported the presence of PLB1 in 52 of 100 isolates (52%), 56 of which were from blood samples. In the present study, PLB1 was detected in 47 of 50 isolates (94%) and absent in three (6%).

C. albicans is genotyped by 25S intron analysis based on the presence or absence of a transposable group I intron in the ITS1 region of rDNA. Previous studies have shown that genotype A is the most prevalent genotype worldwide (Moron and Cabrera 2019; Kumar and Tejashree 2022; Ali et al. 2024). Mahmoodi et al. (2023) reported the genotyping results of 20 C. albicans strains isolated from blood cultures as genotype A (12/20; 60%), genotype C (6/20; 30%) and genotype B (2/20; 10%). Similarly, Ali et al. (2024) investigated 55 C. albicans isolates from blood cultures and found that 28 strains (50.9%) were genotype A, 17 (30.9%) were genotype B, and 10 (18.2%) were genotype C. Karahan et al. (2012) determined the distribution of 121 blood culture isolates as genotype A (77/121; 63.7%), genotype B (24/121; 19.8%), and genotype C (20/121; 16.5%). In the present study, among the 50 C. albicans isolates analyzed, genotype A was the most common (28 isolates, 56%), followed by genotype B (14 isolates, 28%) and genotype C (eight isolates, 16%).

There are few studies comparing ABC genotypes of C. albicans in terms of virulence factors, and no comparative study has specifically addressed the presence of virulence genes. Ali et al. (2024) determined the genotypes of 55 C. albicans isolates from blood cultures and additionally assessed their phospholipase, protease, esterase, hemolysin, coagulase, and biofilm formation properties using phenotypic methods. They found no statistically significant differences in virulence factors among the genotypes. Mashaly et al. (2022) genotyped 88 C. albicans strains isolated from various clinical samples of pediatric patients, including 19 from blood, and evaluated proteinase, phospholipase, and biofilm formation using phenotypic methods. The study reported no significant differences in virulence factors among genotypes or clinical sample types. Similarly, Gharaghani et al. (2021) analyzed C. albicans isolates from urine samples of pediatric patients, grouping them only as genotype A (72%) and C (28%) with no genotype B detected. A statistically significant difference was found only in esterase activity, with genotype A strains showing higher activity than genotype C, while no differences were observed for other virulence factors. Moron et al. (2019) examined 26 C. albicans isolates from various clinical samples and investigated phospholipase, esterase, hemolysin production, biofilm formation, and phenotypic transformation using phenotypic methods. No significant differences in virulence factors among genotypes were detected. Da Silva-Rocha et al. (2014) grouped 76 C. albicans isolates from the oral cavities of kidney transplant patients as colonizers or causative agents according to genotype and evaluated phospholipase activity, phenotypic change, and resistance to phagocytosis. Since only three isolates were identified as genotype B, statistical comparisons were made between genotype A (n=58) and genotype C (n=15). While no differences were found in phospholipase activity or phenotypic change, genotype C strains exhibited greater resistance to phagocytosis. In the present study, no statistically significant differences were observed among genotypes A, B, and C regarding the presence of SAP1, SAP2, SAP4, ALS1, HWP1, and PLB1 virulence genes.

As a result, in the present study, a total of 50 C. albicans strains isolated from blood samples were genotyped by 25S intron analysis and examined for the presence of virulence genes SAP1, SAP2, SAP4, ALS1, HWP1 and PLB1. Genotype A was found to be the most common (56%), consistent with reports from other regions worldwide. The SAP1 gene was detected in 96% of the isolates, SAP2 and SAP4 in 98%, ALS1 and HWP1 in 92%, and PLB1 in 94%. A better understanding of the virulence factors and the pathogenesis of infections caused by Candida species, particularly C. albicans, is essential for improving diagnostic approaches, developing infection control strategies, guiding antifungal therapy, and discovering novel agents targeting virulence factors that could be used in combination with antifungal drugs. Considering the increasing incidence of antifungal resistance, efforts to design new therapeutic strategies targeting virulence factors have become particularly important. Studies in this field will contribute to a deeper understanding of fungal pathogenesis and help identify potential targets for more effective therapeutic approaches.

Notes

[1] Financial disclosure Funding

This study was supported by the Scientific Research Projects Coordination Unit of Istanbul University. Project No. 40642.

[2] Conflicts of interest Conflict of interest

The authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication.

DOI: https://doi.org/10.2478/am-2026-0008 | Journal eISSN: 2545-3149 | Journal ISSN: 0079-4252
Language: English, Polish
Page range: 103 - 109
Submitted on: Jan 6, 2026
Accepted on: Mar 24, 2026
Published on: Jul 28, 2026
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2026 Burak Pural, Sevda Ozel Yildiz, Gonca Erkose Genc, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.