Occurrence and molecular characterization of Meloidogyne graminicola on rice in Central Punjab, Pakistan

A survey of rice-growing areas of Faisalabad and Chiniot districts of central Punjab, Pakistan, was conducted during September 2014, 2015, and 2016. Five root samples of rice plants and 1000-ml composite soil samples were collected from each sampling site, preserved in polythene bags, and labeled. The samples were transported to the Nematology Lab, Department of Plant Pathology, University of Agriculture, Faisalabad, for further processing. The roots were gently washed with distilled water to remove adhering soil and plant debris. Nematode prevalence was determined by using the formula of Norton (1978): Nematode prevalence ( % ) = Number of locations infected with RKNs Total number of locations surveyed × 100

Second-stage juveniles (J2s) of M. graminicola were isolated from rice roots. The root samples from each field were pooled, chopped into pieces, and mixed thoroughly. Three subsamples of 5-g roots were taken, and juveniles were isolated from infected roots using the Baermann funnel method and collected in a beaker. Nematode extraction from soil samples was carried out using Whitehead’s tray method (Whitehead and Hemming, 1965). Soil samples were mixed thoroughly, and a 100-ml composite sample was placed in a plastic bucket and 1–2 liters of water were added. Plant debris, heavy soil particles, and rocks were drained manually. The supernatant was sieved through a 50-mesh-size sieve in a separate bucket. The procedure was repeated by adding 1,000-ml water again and agitated properly. After that, the suspension was left to settle and poured again into another basket using a 100-mesh sieve. The process was repeated twice again using 250- and 325-mesh sieves. The final suspension was transferred to a 500-ml beaker and the supernatant was allowed to settle for one hour. Three subsamples of 2 ml each were taken and examined in a counting dish. Second-stage juveniles (J2) were counted using a stereomicroscope (Olympus SZ2-ILGB). Mature females of M. graminicola were identified based on micrographs of the internal and external perineal patterns (Jepson, 1987). Stained hooked gall tissues were teased apart with a pointed needle to separate mature females. The neck region of individual nematodes was excised, and the posterior part was dipped in 45% lactic acid solution to remove body tissues. The perineal patterns were trimmed and transferred on a transparent glass slide in a glycerin drop. External views of the perineal patterns were visualized using scanning electron microscopy (SEM) at Brigham Young University, Provo Utah, USA. Accordingly, specimens were dehydrated via ascending ethanol series prior to critical point drying. The animals were then mounted on stubs and gold-sputtered. Micrographs were recorded via Helios Nanolab 600 SEM (Thermo-Fisher Scientific, Hillsborough, USA).

Data were subjected to statistical analysis using Statistix (Ver. 8.1). The experimental design for the analysis of galling index, juveniles/soil sample, juveniles/root sample, stylet, and non-stylet-bearing nematodes was by a completely randomized block design with treatment means separated using a LSD test at P = 0.05.

Isolates derived from single egg masses were used to extract DNA. Twenty larvae were picked, rinsed thrice with sterile distilled water, transferred to a microcentrifuge tube, and crushed in 500 µL of SDS extraction buffer containing Tris–HCl (1 M, pH 7.5), EDTA (0.5 M, pH 8.0), SDS (10% w/v), and dd H₂O with a grinding plastic stick (Mitkowski et al., 2003). Proteins in the solution were digested by adding 20 µL proteinase K, 100 µg ml⁻¹. Later, 500 µL of phenol (25:24:1, phenol/chloroform/isoamyl alcohol) was added and vortexed briefly. The tube was centrifuged at 14,000 rpm for 5 min and the supernatant was collected and transferred to another sterile microcentrifuge tube. Sodium acetate (3 M), 50 µL and ice-cold isopropanol, 500 µL, were added to the supernatant, vortexed gently, and centrifuged at 14,000 rpm for 5 min. The supernatant was discarded to save the pellet. Five-hundred µL of ethanol (96%) was added to the pellet and centrifuged for 3 min at 13,000 rpm. The supernatant was discarded again, and the pellet air-dried in a laminar flow chamber for 2 hr. DNA was dissolved in 30 µL of TE buffer (1 ml of 1 M Tris base (pH 8.0) and 0.2 ml of EDTA (0.5 M), dd H₂O) and stored at –20°C until required for PCR reactions.

The PCR reaction mixture was prepared by using 10 µL of 10X PCR buffer, 2-µL dNTPs (10 mM), 2-µL forward primer (10 µM), 2-µL reverse primer (10 µM), 2-µL template DNA (>  50 ng), 1-µL Taq polymerase, and 81-µL ddH₂O, for a total reaction volume of 100 µL. PCR reactions were carried out in a thermal cycler (BIO-RAD T100^TM) under the following conditions: (1) predenaturation at 94 °C for 5 min, (2) denaturation at 94°C for 1 min, (3) annealing at 64°C for 1 min, (4) extension at 72°C for 1 min, (5) 35 cycles of this process, and (6) final extension at 72°C for 5 min. The sequences of primers used for amplification of the internal transcribed spacer region are 1) forward primer rDNA2 (5’–TTGATTACGTCCCTGCCCTTT–3’) (Vrain et al., 1992) and reverse primer rDNA1. 5.8 s (5’–ACGAGCCCGAGTGATCCACCG–3’) (Cherry et al., 1997). Primers were synthesized by Sigma Genosys Inc, St. Louis, MO, USA.

The amplified PCR product was viewed on a gel stained with ethidium bromide under a UV transilluminator. DNA was excised from the gel and purified for sequencing using quick Gel Extraction Kit (Qiagen Gel Extraction Kit, Qiagen, Hilden, Germany). Purified DNA was sent for sequencing to L.G.C. Genomics, Germany, or the DNA sequencing center at Brigham Young University, Provo, Utah, USA.

Due to the high degree of interspecific variation in nucleotide sequences of nematodes (Hu and Gasser, 2006), the deduced internal transcribed spacer region sequences were used for phylogenetic study. The ITS sequences of the eight isolates were used to query the most similar curated sequences on GenBank by performing open-nucleotide BLAST (Basic Local Alignment Search Tool, Camacho et al., 2009). The nearest matches as well as those from closely related species of Meloidogyne (McClure et al., 2012) were downloaded from GenBank and used for subsequent phylogenetic analysis. Multiple-sequence alignment was generated using MUSCLE (Edgar, 2004). The alignment settings included optimization of profile-dependent parameters. Sequences were first grouped by similarity with anchor optimization. Iteration 1  =  kmer4_6 with pctid_kimura for subsequent interactions using the UPMGB clustering method and pseudo-tree rooting. CLUSTALW was used for the distance weighting scheme, with 32-base anchor spacing and 24-base minimum diagonals. Bayesian analyses were carried out using MrBayes 3.2.6 (Huelsenbeck and Ronquist, 2001). A general time-reversible model of sequence evolution with four categories of gamma rate variation was chosen as the optimal model of sequence evolution as per Posada and Crandall (1998). Bayesian analysis was initiated with a random starting tree with four heated chains of chain length 1,100,000, burn-in length of 100,000, and subsampling frequency of 200. Branch lengths were unconstrained.

The field survey data during the rice cropping season of 2014, 2015, and 2016 indicated that both districts Chiniot and Faisalabad have M. graminicola infestation during all the seasons. The GPS coordinates for each sample were used to plot the presence and absence of M. graminicola at the sampled sites in Faisalabad and Chiniot (Figure 1). The prevalence of M. graminicola at forty surveyed locations of Chiniot and Faisalabad is given in Tables 1 and 2. Maximum prevalence of M. graminicola (22.5 and 27.5%) was observed in Chiniot and Faisalabad, respectively, during the rice-growing season of 2016, while the minimum prevalence (17.5 and 20%, respectively) was recorded in Chiniot and Faisalabad during the cropping season of 2014. During 2014 to 2016 at Chiniot among 40 surveyed locations, the presence of M. graminicola was observed at 7, 8, and 9 locations respectively. Similarly, 40 locations were surveyed in Faisalabad during 2014–2016, and M. graminicola prevalence was recorded at 8, 10, and 11 locations, respectively. M. graminicola showed typical hook-shaped galls on rice roots that are a characteristic feature of M. graminicola infection (Figure 2).

Figure 1:

Figure 2:

The severity of M. graminicola attack on rice roots in infested fields was based on different attributes like galling index, juveniles per root system, juveniles per 100 mL of soil, number of stylet-bearing nematodes (SBN), and the number non-stylet-bearing nematodes (NSBN) from both of the surveyed districts (Tables 3 and 4). The highest galling index was observed in Chiniot and Faisalabad during 2016 and 2014, respectively. M. graminicola attack was observed at both districts with significantly high galling index indicative of high infestation of M. graminicola. In Chiniot, the highest juvenile/root sample population was recorded in 2016. The highest population of juveniles/soil sample and non-stylet-bearing nematodes was observed in 2014, while the maximum recorded number of stylet-bearing nematodes was from Chiniot in 2015. During 2016, the highest population of juveniles/root sample and stylet-bearing nematodes was observed in Faisalabad, while the highest number of juveniles/soil sample and non-stylet-bearing nematodes was recorded during 2015.

The infection of M. graminicola was recorded on eleven alternate hosts. All examined alternate hosts showed varying degrees of M. graminicola infestation (Table 5). Among them, the maximum juveniles/root sample, juveniles/soil sample, number of stylet-bearing nematodes, and number of non-stylet-bearing nematodes were recovered from Echinochloa crusgalli. The lowest number of juveniles/root sample, juveniles/soil sample, and non-stylet-bearing nematodes were observed in Brassica oleracea. The lowest number of stylet-bearing nematodes was recorded in Trigonella foenum-graecum. Most of the infested fields were canal-irrigated and a few were tube-well irrigated. Both types of irrigation systems generally favor nematode attack, but nematode populations were higher for in-canal irrigation than tube-well. Most of the farmers have a wheat-rice cropping system and only a few of them use a rice-vegetable cropping system (data not shown). In cropping systems that include vegetables, nematode infection was higher on alternate hosts. Grasses like Cyperus rotundus, Dactylocteniuma egyptium, Echinochloa crusgalli, Eclipta alba, and Paspalum distichum were reported as alternate hosts for rice-vegetable cropping systems, while Avena fatua, Phalaris minor, and Rumex dentatus were recorded as alternate hosts in the rice-wheat cropping system.

The morphological examination of perineal patterns among obtained isolates showed that they were oval to circular shaped, dorsoventral, moderate in height of the arc, and with no lateral incisures or gaps. The tail tip showed prominent, coarse, and well-separated striae. The obtained perineal patterns were similar to previously described patterns for M. graminicola (Figure 3).

Figure 3:

PCR amplification and sequencing yielded eight unique sequences. The isolates gave similar-sized bands of 326–328 bp on a gel stained with ethidium bromide (Figure 4). GenBank accession numbers for each of the obtained sequences are given in Tables 3–6. M. graminicola isolates JB1CT, JB2 UAF, JB3FSD1, JB3FSD2, JB3FSD3, JB3FSD4, JB3FSD5, and JB3FSD6 (accessions KX757064, 326 bp, KX757065, 328 bp, KX757066, 326 bp, KX757067, 326 bp, MH057345, 326 bp, MH057346, bp, MH057347, bp, and MH057348, 326 bp, respectively) showed 98–100% similarity with GenBank accession numbers KF250491, DQ909030, KF250491, MG773553, KF250481, KJ572383, JF949754, and DQ909040, which were previously curated as M. graminicola. The multiple-sequence alignment of the eight isolates demonstrates that there were very few single-nucleotide polymorphisms (SNPs) between the ITS sequences of these isolates (Figure 5). When trimmed for phylogenetic analysis, JB3FSD1 was no longer unique and was removed from subsequent analyses.

Figure 4:

Figure 5:

The Bayesian solution is presented in Figure 6. Bayesian posterior probabilities, represented as a percentage, are mapped at nodes where support is greater than 50%. The resulting phylogeny shows that six of the isolates sequenced in this study form a monophyletic clade with the other Asian isolates, including those from India, Nepal, China, and Vietnam. Isolate KX757067 belongs to an unresolved polytomy that contains isolates from Asia as well as Europe and South America. The relationships among the isolates are poorly resolved due to lack of synapomorphies. Three isolates from Pakistan, KX757067, MH057348, and MH057345, have several unique nucleotide substitutions, and thus longer branch lengths, relative to the other isolates of M. graminicola (Figure 6).

Figure 6: