Skip to main content
Have a personal or library account? Click to login
Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data Cover

Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data

Open Access
|Jun 2019

Figures & Tables

Table 1.

Overview of PCR primers designed in this study, which were used for mtCOI amplification from three Helicotylenchus spp. and one Rotylenchus sp.

Forward primer (5′-3′)Reverse primer (5′-3′)Approximate amplicon sizeName of species and corresponding GenBank sequence numbers
M3.5F: GGAGTGGiACARGiTGAACM8aRa: GCAACiACATAATAAGWATCATG700 H. pseudorobustus: MG663105
R. uniformis: MG663121
M6.9R: ACCiACARTAAAiATATGATG450 H. pseudorobustus: MG663104
H. varicaudatus: MG663116; MG663116; MG663116
R. uniformis: MG663122
M2Fb: ATTGGiGSTTTTGGTAATTRH1R: CCAACAATGAATATATGATG600 H. canadensis: MG663099; MG663100
H. pseudorobustus: MG663106; MG663107; MG663109; MG663110; MG663111; MG663112; MG663113
H. varicaudatus: MG663115
RH2F: GGTGGAAGAATTAATTTYTG350 H. canadensis: MG663098; MG663101
H. varicaudatus: MG663114; MG663118; MG663120

1 Note: i = inosine. aThis primer is a modified version of the COIR primer proposed by He et al. (2005). The primer was elongated by 4 nucleotides and two nucleotide modifications were incorporated; bThis primer is a shortened and modified version of the COI-F1 primer proposed by Kanzaki and Futai (2002). The primer was shortened from 29 nt to 19 and two nucleotide modification were introduced.

Table 2.

Hoplolaimidae species included in phylogenetic analyses.

SpeciesIndividualSoil sample codeSample locality (Voivodeship) CoordinatesVegetation type28S rDNA GenBank numbermtCOI GenBank number
Helicotylenchus 1CH 0040/04Dobrzyca (West Pomeranian)N 54.172277 E 15.926119 Buxus sempervirens L.; nurseryMG653526MG663098
canadensis 2CH 0197/01Ligota Mała (Lower Silesian)N 51.126219 E 17.346800 Rosa L.; cultivationMG663099
3CH 0199/01Kąty Bystrzyckie (Lower Silesian)N 50.312597 E 16.840489 Rosa L.; cultivationMG653526MG663100
4CH 0199/01Kąty Bystrzyckie (Lower Silesian)N 50.312597 E 16.840489 Rosa L.; cultivationMG653527
5CH 0199/01Kąty Bystrzyckie (Lower Silesian)N 50.312597 E 16.840489 Rosa L.; cultivationMG663101
6CH 0199/01Kąty Bystrzyckie (Lower Silesian)N 50.312597 E 16.840489 Rosa L.; cultivationMG653526
Helicotylenchus 1KW 0014/05Sierpówko (Greater Poland)N 52.473777 E 16.585961Mixed forestMG653532MG663104
pseudorobustus 2KW 0063/04Brzostów (Greater Poland)N 51.978670 E 17.405130Mixed forestMG653533MG663104
3KW 0063/04Brzostów (Greater Poland)N 51.978670 E 17.405130Mixed forestMG653533MG663105
4KW 0063/04Brzostów (Greater Poland)N 51.978670 E 17.405130Mixed forestMG663106
5KW 0008/01Kleszczele (Podlaskie)N 52.563534 E 23.312296 Solanum tuberosum L.; cultivationMG653534MG663107
6KW 0008/01Kleszczele (Podlaskie)N 52.563534 E 23.312296 Solanum tuberosum L.; cultivationMG653532MG663108
7KW 0008/01Kleszczele (Podlaskie)N 52.563534 E 23.312296 Solanum tuberosum L.; cultivationMG663109
8KW 0154/01/02Nowy Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663110
9KW 0154/01/02Nowy Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653532MG663111
10KW 0154/01/02Nowy Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663112
11KW 0078/01Radomierz (Lower Silesian)N 50.909560 E 15.911490Poaceae (R. Br.) Barnh.; meadowMG653534
12KW 0078/01Radomierz (Lower Silesian)N 50.909560 E 15.911490Poaceae (R. Br.) Barnh.; meadowMG653533MG663113
13KW 0080/02Rybnica (Lower Silesian)N 50.908020 E 15.675000Fagopyrum Mill; cultivationMG653532
Helicotylenchus 1KW 0013/02Turew (Greater Poland)N 52.060160 E 16.819668 Tilia L.; parkMG663114
varicaudatus 2KW 0013/01Turew (Greater Poland)N 52.060160 E 16.819668 Platanus L.; parkMG663115
3KW 0154/01/01Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653535
4KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653535MG663116
5KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653535MG663117
6KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663118
7KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663119
8KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653535MG663119
9KW 0154/01/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663120
Rotylenchus 1KW 0084/01Czernia (Lubusz)N 51.534330 E 15.240710 Secale L.; cultivationMG653536
uniformis 2KW 0088/01Miodnica and Gorzupia (Lubusz)N 51.708180 E 15.288050 Solanum tuberosum L.; cultivationMG653537
3KW 0088/01Miodnica and Gorzupia (Lubusz)N 51.708180 E 15.288050 Solanum tuberosum L.; cultivationMG653536
4KW 0088/01Miodnica and Gorzupia (Lubusz)N 51.708180 E 15.288050 Solanum tuberosum L.; cultivationMG653538MG663121
5KW 0088/01Miodnica and Gorzupia (Lubusz)N 51.708180 E 15.288050 Solanum tuberosum L.; cultivationMG653539
6KW 0067/01Toruń (Kuyavian-Pomeranian)N 53.027500 E 18.595470lawnMG653540MG663122

1 Note: Individuals from whom both 28S rDNA and the mtCOI sequences were obtained are marked in grey.

Table 3.

Morphometrics of Helicotylenchus canadensis populations from different localities.

LocalityPopulations analyzed in this study, PolandHolotype, Quebec, Canada acc. (Waseem, 1961)Paratypes, Quebec, Canada acc. (Waseem, 1961)Rothamsted, England acc. Yuen, 1964Populations from New Zealand, acc. (Yeates and Wouts, 1992)Populations from temperate Europe, acc. (Brzeski, 1998)
n 5152025
L793.1 ± 54 (698.7–866.6)860780 (680–970)680–840726–906680–1040
a22.4 ± 1.16 (20.9–24.1)24.524.3 (20.0–30.4)18–2623–3120–31
b5.9 ± 0.34 (5.3–6.3)5.25.4 (4.8–6.7)5.3–6.25.4–7.95.3–8.1
c50.5 ± 8.1 (38.5–61.8)62.356.4 (48.7–65.0)36–5445–6336–72
c′0.9 ± 0.1 (0.8–1.1)0.9–1.40.7–1.10.6–1.0
V58.3 ± 1.9 (55.5–59.5)6464(61–66)59–6457–6358–66
Stylet length28.8 ± 0.94 (28.2–30.7)3030 (28–30)31–3328–3327–33.5
Pharyngal length135.1 ± 11.6 (120.2–152.7)150–175103–140
Max. body diam.a 35.4 ± 2.9 (30.3–38.9)26–37
Tail length16.2 ± 3.1 (11.3–20.5)12–1615–2213–1912–22
Anal body diameter17.9 ± 2.34 (13.3–20.3)
Tail annuli number13.2 ± 2.5 (10.0–16.0)8–128–126–12
Phasmid position (number of annules anterior to anus)5.0±2.7 (3.0-9.0)4–96–123–12

1 Note: aMeasured at vulval region. Measurements are given in μm, V in %, and in the form: mean ± s.d. (range).

Figure 1:

Anterior and posterior regions of three Helicotylenchus species: (A) Anterior body and (D) tail of H. canadensis (CH 0199/01). (B) Anterior body and (E) tail of H. pseudorobustus (KW 0154/01). (C) Anterior body and (F) tail of H. varicaudatus female (KW 0154/02). (Scale bar =10 μm).

Table 4.

Morphometrics of Helicotylenchus pseudorobustus populations from different localities.

LocalityPopulations analyzed in this study, PolandTopotypes, Switzerland acc. (Sher, 1966) Topotypes, Switzerland acc. (Fortuner et al., 1984)Populations from New Zealand acc. (Yeates and Wouts, 1992) Populations from temperate Europe acc. (Brzeski, 1998) Populations from California, USA acc. (Subbotin et al., 2015) Populations from Iran acc. (Shokoohi et al., 2018)
n 132020862522
L767.2 ± 81.3 (675.1–865.9)600–820764697–840560–820642–895666–934
a26.4 ± 4.7 (21.7–34.3)27–342827.5–34.924–3425.3–31.824–35
b6.0 ± 0.9 (5.8–8.1)6.0–7.25.0–8.14.2–8.65.1–7.34.2–6.6
c42.6 ± 12.2 (34.1–64.0)32–5248.433–6132–5231.2–46.932.6–59
c′1.0 ± 0.3 (0.6–1.5)0.9–1.40.9–1.50.8–1.41.0–1.41–3.2
V61.9 ± 5.5 (48.1–71.8)59–6461.659–6659–6758.4–64.646–65
Stylet length28.0 ± 0.7 (26.5–29.5)26–3027.122–2824–30.525–27.523–27
Pharyngal length124.9 ± 21.3 (102.7–173.4)116133–178104–128116–160120–148
Max. body diam.a 29.1 ± 4.9 (21.9–35.5)27.823.7–28.525–3124–31
Tail length17.3 ± 3.3 (12.5–23.20)15.914.6–19.515–2216–2413.7–24.5
Anal body diam.13.9 ± 2.2 (12.2–19.7)15.615–2013.7–16
Tail annuli number10.0 ± 2.4 (6.0–13.0)7–127–178–15
Phasmid position (number of annules anterior to anus)7.5 ± 2.3 (4–10)2–73–116–112–125–10

1 Note: aMeasured at vulval region. Measurements are given in μm, V in %, and in the form: mean ± s.d. (range).

Table 5.

Morphometrics of Helicotylenchus varicaudatus populations from different localities.

LocalityPopulations analyzed in this study, PolandHolotype, Rothamsted, England, acc. (Yuen, 1964)Paratypes, Rothamsted, England, acc. (Yuen, 1964)Populations from New Zealand acc. (Yeates and Wouts, 1992) Populations from temperate Europe acc. (Brzeski, 1998) Population from Portugal acc. (Schreck Reis et al., 2010) Populations analyzed in this study, PolandPopulation from Portugal acc. (Schreck Reis et al., 2010)
n 5 females19 females48 females40 females4 males10 males
L734.7 ± 101.1 (623.8–876.5)670580–670586–814520–790510–890676.3 ± 39.1 (612.8–715.2)530–700
a24.9 ± 0.9 (24.8–26.0)2218–2622–3218–2923.5–35.825.0 ± 2.4 (22.5–27.8)30.3–37.4
b5.5 ± 1.2 (4.2–7.2)4.84.3–5.24.9–7.74.3–7.55.8–8.76.7 ± 0.7 (5.7–7.2)6.6–8.5
c42.5 ± 7.3 (34.1–52.4)39–5036–7738–7539.4–7033.5 ± 2.2 (31.4–37.2)34–37.3
c′1.3 ± 0.5 (0.7–1.8)0.6–10.5–1.20.7–1.31.7 ± 0.1 (1.6–1.9)1.6–2.2
V62.5 ± 1.9 (60.1–65)6260–6359–6759–6661–67
Stylet length29.7 ± 1.2 (29.0–31.3)3229–3331–3325–3322–2626.3 ± 0.7 (25.2–27.1)20–23
Pharyngal length131.9 ± 7.0 (120.7–139.9)104–13699–113120–167113.8 ± 15.0 (99.3–134.5)126–172
Max. body diam.a 31.3 ± 6.5 (24.0–40.3)22–3414–2625.9 ± 3.0 (24.6–30.7)17–20
Tail length17.8 ± 4.1 (13.3–21.4)12–178–198–199.5–17.520.3 ± 1.1 (19.2–22.0)17–20
Anal body diam.14.8 ± 2.8 (12.0–15.4)10–1711.9 ± 1.1 (10.4–13.6)9–11
Tail annuli number5.8 ± 1.3 (4–7)6–116–124–144–88–11
Phasmid position (number of annules anterior to anus)2.0 ± 2 (0–5)−1–+5−3–+3−1–+4−4–+7
Spicula length28.1 ± 1.9 (26.5–30.7)20–25
Gubernaculum9.1 ± 0.9 (7.9–10.2)4.4–7.0

1 Note: aFemales measured at vulval region, males measured at mid-body. Measurements are given in μm, V in %, and in the form: mean ± s.d. (range).

Figure 2:

Anterior and posterior regions of H. varicaudatus male (KW 0154/02). (A) Anterior body. (B) Tail, with focus on spicule and gubernaculum. (C) Tail, with focus on bursa and phasmid. Images of male were captured from the video documentation of temporary slides.

Figure 3:

The alignment of partial mtCOI sequences from representatives of Hoplolaimidae, translated from nucleotide into amino acid sequences using the standard invertebrate mitochondrial genetic code. X, unknown amino acid; *, TAA (grey frame) or TAG (black frame) codon.

Figure 4:

Phylogeny of the genus Helicotylenchus, as inferred by Bayesian analysis of 28S rDNA. The numbers near nodes indicate posterior probabilities. Roman numerals indicate major clades following Subbotin et al. (2011, 2015). The original 28S rDNA sequences are in boldface font.

Figure 5:

Phylogeny of the genus Helicotylenchus, as inferred by Baysian analysis of partial mtCOI sequences. Roman numerals indicate major clades according to Subbotin et al. (2011, 2015). The original mtCOI sequences are in boldface font.

DOI: https://doi.org/10.21307/jofnem-2019-033 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Page range: 1 - 17
Submitted on: Aug 30, 2018
Published on: Jun 6, 2019
Published by: Society of Nematologists, Inc.
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2019 K. Rybarczyk-Mydłowska, E. Dmowska, K. Kowalewska, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.