Table 1.
Overview of PCR primers designed in this study, which were used for mtCOI amplification from three Helicotylenchus spp. and one Rotylenchus sp.
| Forward primer (5′-3′) | Reverse primer (5′-3′) | Approximate amplicon size | Name of species and corresponding GenBank sequence numbers |
|---|---|---|---|
| M3.5F: GGAGTGGiACARGiTGAAC | M8aRa: GCAACiACATAATAAGWATCATG | 700 | H. pseudorobustus: MG663105 |
| R. uniformis: MG663121 | |||
| M6.9R: ACCiACARTAAAiATATGATG | 450 | H. pseudorobustus: MG663104 | |
| H. varicaudatus: MG663116; MG663116; MG663116 | |||
| R. uniformis: MG663122 | |||
| M2Fb: ATTGGiGSTTTTGGTAATT | RH1R: CCAACAATGAATATATGATG | 600 | H. canadensis: MG663099; MG663100 |
| H. pseudorobustus: MG663106; MG663107; MG663109; MG663110; MG663111; MG663112; MG663113 | |||
| H. varicaudatus: MG663115 | |||
| RH2F: GGTGGAAGAATTAATTTYTG | 350 | H. canadensis: MG663098; MG663101 | |
| H. varicaudatus: MG663114; MG663118; MG663120 |
1 Note: i = inosine. aThis primer is a modified version of the COIR primer proposed by He et al. (2005). The primer was elongated by 4 nucleotides and two nucleotide modifications were incorporated; bThis primer is a shortened and modified version of the COI-F1 primer proposed by Kanzaki and Futai (2002). The primer was shortened from 29 nt to 19 and two nucleotide modification were introduced.
Table 2.
Hoplolaimidae species included in phylogenetic analyses.
| Species | Individual | Soil sample code | Sample locality (Voivodeship) | Coordinates | Vegetation type | 28S rDNA GenBank number | mtCOI GenBank number |
|---|---|---|---|---|---|---|---|
| Helicotylenchus | 1 | CH 0040/04 | Dobrzyca (West Pomeranian) | N 54.172277 E 15.926119 | Buxus sempervirens L.; nursery | MG653526 | MG663098 |
| canadensis | 2 | CH 0197/01 | Ligota Mała (Lower Silesian) | N 51.126219 E 17.346800 | Rosa L.; cultivation | – | MG663099 |
| 3 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 | Rosa L.; cultivation | MG653526 | MG663100 | |
| 4 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 | Rosa L.; cultivation | MG653527 | – | |
| 5 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 | Rosa L.; cultivation | – | MG663101 | |
| 6 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 | Rosa L.; cultivation | MG653526 | – | |
| Helicotylenchus | 1 | KW 0014/05 | Sierpówko (Greater Poland) | N 52.473777 E 16.585961 | Mixed forest | MG653532 | MG663104 |
| pseudorobustus | 2 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | MG653533 | MG663104 |
| 3 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | MG653533 | MG663105 | |
| 4 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | – | MG663106 | |
| 5 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 | Solanum tuberosum L.; cultivation | MG653534 | MG663107 | |
| 6 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 | Solanum tuberosum L.; cultivation | MG653532 | MG663108 | |
| 7 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 | Solanum tuberosum L.; cultivation | – | MG663109 | |
| 8 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663110 | |
| 9 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653532 | MG663111 | |
| 10 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663112 | |
| 11 | KW 0078/01 | Radomierz (Lower Silesian) | N 50.909560 E 15.911490 | Poaceae (R. Br.) Barnh.; meadow | MG653534 | – | |
| 12 | KW 0078/01 | Radomierz (Lower Silesian) | N 50.909560 E 15.911490 | Poaceae (R. Br.) Barnh.; meadow | MG653533 | MG663113 | |
| 13 | KW 0080/02 | Rybnica (Lower Silesian) | N 50.908020 E 15.675000 | Fagopyrum Mill; cultivation | MG653532 | – | |
| Helicotylenchus | 1 | KW 0013/02 | Turew (Greater Poland) | N 52.060160 E 16.819668 | Tilia L.; park | – | MG663114 |
| varicaudatus | 2 | KW 0013/01 | Turew (Greater Poland) | N 52.060160 E 16.819668 | Platanus L.; park | – | MG663115 |
| 3 | KW 0154/01/01 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653535 | – | |
| 4 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653535 | MG663116 | |
| 5 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653535 | MG663117 | |
| 6 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663118 | |
| 7 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663119 | |
| 8 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653535 | MG663119 | |
| 9 | KW 0154/01/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663120 | |
| Rotylenchus | 1 | KW 0084/01 | Czernia (Lubusz) | N 51.534330 E 15.240710 | Secale L.; cultivation | MG653536 | – |
| uniformis | 2 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 | Solanum tuberosum L.; cultivation | MG653537 | – |
| 3 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 | Solanum tuberosum L.; cultivation | MG653536 | – | |
| 4 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 | Solanum tuberosum L.; cultivation | MG653538 | MG663121 | |
| 5 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 | Solanum tuberosum L.; cultivation | MG653539 | – | |
| 6 | KW 0067/01 | Toruń (Kuyavian-Pomeranian) | N 53.027500 E 18.595470 | lawn | MG653540 | MG663122 |
Table 3.
Morphometrics of Helicotylenchus canadensis populations from different localities.
| Locality | Populations analyzed in this study, Poland | Holotype, Quebec, Canada acc. (Waseem, 1961) | Paratypes, Quebec, Canada acc. (Waseem, 1961) | Rothamsted, England acc. Yuen, 1964 | Populations from New Zealand, acc. (Yeates and Wouts, 1992) | Populations from temperate Europe, acc. (Brzeski, 1998) |
|---|---|---|---|---|---|---|
| n | 5 | 15 | 20 | 25 | ||
| L | 793.1 ± 54 (698.7–866.6) | 860 | 780 (680–970) | 680–840 | 726–906 | 680–1040 |
| a | 22.4 ± 1.16 (20.9–24.1) | 24.5 | 24.3 (20.0–30.4) | 18–26 | 23–31 | 20–31 |
| b | 5.9 ± 0.34 (5.3–6.3) | 5.2 | 5.4 (4.8–6.7) | 5.3–6.2 | 5.4–7.9 | 5.3–8.1 |
| c | 50.5 ± 8.1 (38.5–61.8) | 62.3 | 56.4 (48.7–65.0) | 36–54 | 45–63 | 36–72 |
| c′ | 0.9 ± 0.1 (0.8–1.1) | 0.9–1.4 | – | – | 0.7–1.1 | 0.6–1.0 |
| V | 58.3 ± 1.9 (55.5–59.5) | 64 | 64(61–66) | 59–64 | 57–63 | 58–66 |
| Stylet length | 28.8 ± 0.94 (28.2–30.7) | 30 | 30 (28–30) | 31–33 | 28–33 | 27–33.5 |
| Pharyngal length | 135.1 ± 11.6 (120.2–152.7) | – | – | – | 150–175 | 103–140 |
| Max. body diam.a | 35.4 ± 2.9 (30.3–38.9) | – | – | – | 26–37 | – |
| Tail length | 16.2 ± 3.1 (11.3–20.5) | – | 12–16 | 15–22 | 13–19 | 12–22 |
| Anal body diameter | 17.9 ± 2.34 (13.3–20.3) | – | – | – | – | – |
| Tail annuli number | 13.2 ± 2.5 (10.0–16.0) | – | – | 8–12 | 8–12 | 6–12 |
| Phasmid position (number of annules anterior to anus) | 5.0±2.7 (3.0-9.0) | – | – | 4–9 | 6–12 | 3–12 |
Figure 1:
Anterior and posterior regions of three Helicotylenchus species: (A) Anterior body and (D) tail of H. canadensis (CH 0199/01). (B) Anterior body and (E) tail of H. pseudorobustus (KW 0154/01). (C) Anterior body and (F) tail of H. varicaudatus female (KW 0154/02). (Scale bar =10 μm).
Table 4.
Morphometrics of Helicotylenchus pseudorobustus populations from different localities.
| Locality | Populations analyzed in this study, Poland | Topotypes, Switzerland acc. (Sher, 1966) | Topotypes, Switzerland acc. (Fortuner et al., 1984) | Populations from New Zealand acc. (Yeates and Wouts, 1992) | Populations from temperate Europe acc. (Brzeski, 1998) | Populations from California, USA acc. (Subbotin et al., 2015) | Populations from Iran acc. (Shokoohi et al., 2018) |
|---|---|---|---|---|---|---|---|
| n | 13 | 20 | 20 | 86 | 25 | 22 | |
| L | 767.2 ± 81.3 (675.1–865.9) | 600–820 | 764 | 697–840 | 560–820 | 642–895 | 666–934 |
| a | 26.4 ± 4.7 (21.7–34.3) | 27–34 | 28 | 27.5–34.9 | 24–34 | 25.3–31.8 | 24–35 |
| b | 6.0 ± 0.9 (5.8–8.1) | 6.0–7.2 | – | 5.0–8.1 | 4.2–8.6 | 5.1–7.3 | 4.2–6.6 |
| c | 42.6 ± 12.2 (34.1–64.0) | 32–52 | 48.4 | 33–61 | 32–52 | 31.2–46.9 | 32.6–59 |
| c′ | 1.0 ± 0.3 (0.6–1.5) | 0.9–1.4 | – | 0.9–1.5 | 0.8–1.4 | 1.0–1.4 | 1–3.2 |
| V | 61.9 ± 5.5 (48.1–71.8) | 59–64 | 61.6 | 59–66 | 59–67 | 58.4–64.6 | 46–65 |
| Stylet length | 28.0 ± 0.7 (26.5–29.5) | 26–30 | 27.1 | 22–28 | 24–30.5 | 25–27.5 | 23–27 |
| Pharyngal length | 124.9 ± 21.3 (102.7–173.4) | – | 116 | 133–178 | 104–128 | 116–160 | 120–148 |
| Max. body diam.a | 29.1 ± 4.9 (21.9–35.5) | – | 27.8 | 23.7–28.5 | – | 25–31 | 24–31 |
| Tail length | 17.3 ± 3.3 (12.5–23.20) | – | 15.9 | 14.6–19.5 | 15–22 | 16–24 | 13.7–24.5 |
| Anal body diam. | 13.9 ± 2.2 (12.2–19.7) | – | 15.6 | – | – | 15–20 | 13.7–16 |
| Tail annuli number | 10.0 ± 2.4 (6.0–13.0) | 7–12 | – | – | 7–17 | 8–15 | – |
| Phasmid position (number of annules anterior to anus) | 7.5 ± 2.3 (4–10) | 2–7 | 3–11 | 6–11 | 2–12 | 5–10 | – |
Table 5.
Morphometrics of Helicotylenchus varicaudatus populations from different localities.
| Locality | Populations analyzed in this study, Poland | Holotype, Rothamsted, England, acc. (Yuen, 1964) | Paratypes, Rothamsted, England, acc. (Yuen, 1964) | Populations from New Zealand acc. (Yeates and Wouts, 1992) | Populations from temperate Europe acc. (Brzeski, 1998) | Population from Portugal acc. (Schreck Reis et al., 2010) | Populations analyzed in this study, Poland | Population from Portugal acc. (Schreck Reis et al., 2010) |
|---|---|---|---|---|---|---|---|---|
| n | 5 females | 19 females | 48 females | 40 females | 4 males | 10 males | ||
| L | 734.7 ± 101.1 (623.8–876.5) | 670 | 580–670 | 586–814 | 520–790 | 510–890 | 676.3 ± 39.1 (612.8–715.2) | 530–700 |
| a | 24.9 ± 0.9 (24.8–26.0) | 22 | 18–26 | 22–32 | 18–29 | 23.5–35.8 | 25.0 ± 2.4 (22.5–27.8) | 30.3–37.4 |
| b | 5.5 ± 1.2 (4.2–7.2) | 4.8 | 4.3–5.2 | 4.9–7.7 | 4.3–7.5 | 5.8–8.7 | 6.7 ± 0.7 (5.7–7.2) | 6.6–8.5 |
| c | 42.5 ± 7.3 (34.1–52.4) | – | 39–50 | 36–77 | 38–75 | 39.4–70 | 33.5 ± 2.2 (31.4–37.2) | 34–37.3 |
| c′ | 1.3 ± 0.5 (0.7–1.8) | – | – | 0.6–1 | 0.5–1.2 | 0.7–1.3 | 1.7 ± 0.1 (1.6–1.9) | 1.6–2.2 |
| V | 62.5 ± 1.9 (60.1–65) | 62 | 60–63 | 59–67 | 59–66 | 61–67 | ||
| Stylet length | 29.7 ± 1.2 (29.0–31.3) | 32 | 29–33 | 31–33 | 25–33 | 22–26 | 26.3 ± 0.7 (25.2–27.1) | 20–23 |
| Pharyngal length | 131.9 ± 7.0 (120.7–139.9) | – | – | 104–136 | 99–113 | 120–167 | 113.8 ± 15.0 (99.3–134.5) | 126–172 |
| Max. body diam.a | 31.3 ± 6.5 (24.0–40.3) | – | – | 22–34 | – | 14–26 | 25.9 ± 3.0 (24.6–30.7) | 17–20 |
| Tail length | 17.8 ± 4.1 (13.3–21.4) | – | 12–17 | 8–19 | 8–19 | 9.5–17.5 | 20.3 ± 1.1 (19.2–22.0) | 17–20 |
| Anal body diam. | 14.8 ± 2.8 (12.0–15.4) | – | – | – | – | 10–17 | 11.9 ± 1.1 (10.4–13.6) | 9–11 |
| Tail annuli number | 5.8 ± 1.3 (4–7) | – | 6–11 | 6–12 | 4–14 | 4–8 | – | 8–11 |
| Phasmid position (number of annules anterior to anus) | 2.0 ± 2 (0–5) | – | – | −1–+5 | −3–+3 | −1–+4 | – | −4–+7 |
| Spicula length | 28.1 ± 1.9 (26.5–30.7) | 20–25 | ||||||
| Gubernaculum | 9.1 ± 0.9 (7.9–10.2) | 4.4–7.0 |
Figure 2:
Anterior and posterior regions of H. varicaudatus male (KW 0154/02). (A) Anterior body. (B) Tail, with focus on spicule and gubernaculum. (C) Tail, with focus on bursa and phasmid. Images of male were captured from the video documentation of temporary slides.
Figure 3:
The alignment of partial mtCOI sequences from representatives of Hoplolaimidae, translated from nucleotide into amino acid sequences using the standard invertebrate mitochondrial genetic code. X, unknown amino acid; *, TAA (grey frame) or TAG (black frame) codon.
Figure 4:
Phylogeny of the genus Helicotylenchus, as inferred by Bayesian analysis of 28S rDNA. The numbers near nodes indicate posterior probabilities. Roman numerals indicate major clades following Subbotin et al. (2011, 2015). The original 28S rDNA sequences are in boldface font.
Figure 5:
Phylogeny of the genus Helicotylenchus, as inferred by Baysian analysis of partial mtCOI sequences. Roman numerals indicate major clades according to Subbotin et al. (2011, 2015). The original mtCOI sequences are in boldface font.