Have a personal or library account? Click to login
Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data Cover

Phylogenetic studies on three Helicotylenchus species based on 28S rDNA and mtCOI sequence data

Open Access
|Jun 2019

Full Article

Spiral nematodes, which belong to the Helicotylenchus spp. (Hoplolaimidae), are representatives of Tylenchomorpha, which is considered the most successful lineage of plant parasitic nematodes. They evolved by gradual transitions from fungal feeders through facultative plant parasites toward obligatory plant parasites (Holterman et al., 2017). Furthermore, the phylogenetic tree of this group reveals main evolutionary pathways, leading from ectoparasitism or migratory endoparasitism to the most specialized, sedentary endoparasitic lifestyles, exhibited by the most harmful plant-damaging nematode species. Although the majority of research focuses on the latter pests, the investigation of species that developed less sophisticated mechanisms of parasitism should not be overlooked. Analyses of molecular information hidden in their genomes bring us closer to an explanation why some groups of nematodes became more successfully adapted to plant parasitism than others.

Unlike the closely related, sedentary endoparasitic cyst nematodes, most representatives of the genus Helicotylenchus (Steiner, 1945) are considered mild plant pathogens of minor economic importance. However, several species like H. dihystera (Cobb, 1893; Sher, 1961), H. digonicus (Perry in Perry, Darling & Thorne, 1959), H. multicinctus (Cobb, 1893; Golden, 1956), H. pseudorobustus (Steiner, 1914; Golden, 1956), or H. varicaudatus (Yuen, 1964) were proven to be associated with plant growth suppression or more severe crop-plant damage (Perry et al., 1959; Siddiqi, 2000; Schreck Reis et al., 2010). They are classified as ectoparasites or semi-endoparasites and can be found in root systems of diverse cultivated and uncultivated plants (Siddiqi, 2000; Subbotin et al., 2011). In total, this cosmopolitan genus encompasses over 200 described species (Uzma et al., 2015), of which many await a more detailed characterization.

To determine particular Helicotylenchus species, a precise evaluation of morphological and morphometrical features is used, usually after the preliminary recognition of the characteristic coiled body shape observed in the relaxed state or after death. However, the available keys do not always allow for proper species identification due to high intra-specific and minor inter-specific variability within the genus (Fortuner, 1984; Fortuner et al., 1984). The proposed diagnostic characters and features can match and overlap between closely related species. Therefore, to facilitate the species identification process as well as to delineate more phylogenetically distant species, which share the same morphology (cryptic species), the support of a molecular approach is needed.

To date, only about 20% of Helicotylenchus species has been molecularly characterized using mostly ribosomal DNA fragments (18S, ITS, 28S rDNA; GenBank resources). Mitochondrial cytochrome c oxidase subunit I (mtCOI) sequences were reported for one species, the recently described H. oleae (Palomares-Rius et al., 2018), and a cytochrome c oxidase subunit II sequence was reported solely for H. dihystera (Riepsamen et al., 2011). A combination of both the nuclear genome-derived large subunit ribosomal DNA gene (28S rDNA) and more variable genes such as mtCOI has been suggested to comprise valuable markers for subsequent phylogenetic analyses in this group (Subbotin et al., 2011; Palomares-Rius et al., 2018).

The objectives of this study were as follows: to deliver molecular characteristics of three Hecicotylenchus species commonly occurring in Poland, namely, H. canadensis, H. pseudorobustus and H. varicaudatus, by the use of nuclear 28S rDNA and mtCOI data, and to further evaluate the potential of mtCOI sequences for species identification and phylogenetic study of the genus Helicotylenchus.

Materials and methods
Sampling, nematode extraction, and conservation

Three Hoplolaimidae species originating from Poland were analyzed: H. canadensis, H. pseudorobustus, and H. varicaudatus. Nematodes were collected during a study conducted between 2010 and 2014 on the characterization, occurrence, and distribution of plant parasitic nematodes in Poland. Soil samples were derived from various habitats and vegetation types. Each sample (about 1 kg of soil) was taken to a depth of 30 cm from the root zone using a soil sampler. Nematode extraction was performed by the decantation and sieving method, followed by the centrifugal flotation method (van Bezooijen, 2006). Nematodes were killed with hot water at 60°C. The parts of the samples of selected Hoplolaimidae were fixed in TAF and designated for morphological analysis. The rest of the samples were fixed in DESS and given to molecular studies.

Morphological identification

Morphological observations and morphometrical analyses were performed using Leica light microscope with Nomarski differential interference contrast. Morphological identification was performed using identification keys and descriptions by Waseem (1961), Yuen (1964), Sher (1966), Brzeski (1998), and Andrássy (2007). Nematodes fixed in DESS were subjected to morphological vouchering and DNA amplification procedure of Yoder et al. (2006). Nematodes were identified on the temporary slides, and subsequently multifocal images were made for every specimen.

DNA extraction

After morphological identification, analyzed nematode individuals were marked with specific codes and assigned for further molecular studies. Genomic DNA from single nematode specimens was extracted using either GenElute™ Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) or QIAamp DNA Micro Kit (Qiagen) according to the manufacturers’ instructions. For each sample, DNA was eluted in 30 μ l H2O. Extracted DNA was stored at −20°C.

Primers, DNA amplification, and sequencing

The mitochondrial DNA fragments of the mtCOI as well as the genomic DNA fragments of the large subunit rDNA (28S rDNA) were amplified from the collected Hoplolaimidae species. Initially, during the ongoing survey project, the publicly available JB3 and JB4 or JB5 mtCOI primers (Hu et al., 2002; Derycke et al., 2010) were tested for amplification of mtCOI fragments from numerous plant parasitic species. However, from these primers, PCR amplification failed. Therefore, a new set of primers was developed according to the slightly modified primer design methodology, as in Rybarczyk-Mydłowska et al. (2012, 2014). An alignment comprising of mtCOI publicly available sequences from different nematode taxa served as a starting point for identification of the most conserved regions, which were subsequently used for design of various variants of forward and reverse primers. GenBank accession numbers of nematode mtCOI sequences used in the alignment are listed in the Supplementary Table 1 (Table S1). Primer combinations that worked best for genus Helicotylenchus and resulted in a successful amplification of partial mtCOI sequences are listed in Table 1. It is worth mentioning that, in their recent work, Palomares-Rius et al. (2018) used a primer pair originally developed by Kanzaki and Futai (2002), which allowed them to amplify approximately 660 bp, covering a broader region of this gene from H. oleae. Remarkably, the use of the hereby presented M3.5F and M8aR primer combination targets a mtCOI region of comparable length of 670, slightly shifted to the 3′ end.

Table 1.

Overview of PCR primers designed in this study, which were used for mtCOI amplification from three Helicotylenchus spp. and one Rotylenchus sp.

Forward primer (5′-3′)Reverse primer (5′-3′)Approximate amplicon sizeName of species and corresponding GenBank sequence numbers
M3.5F: GGAGTGGiACARGiTGAACM8aRa: GCAACiACATAATAAGWATCATG700 H. pseudorobustus: MG663105
R. uniformis: MG663121
M6.9R: ACCiACARTAAAiATATGATG450 H. pseudorobustus: MG663104
H. varicaudatus: MG663116; MG663116; MG663116
R. uniformis: MG663122
M2Fb: ATTGGiGSTTTTGGTAATTRH1R: CCAACAATGAATATATGATG600 H. canadensis: MG663099; MG663100
H. pseudorobustus: MG663106; MG663107; MG663109; MG663110; MG663111; MG663112; MG663113
H. varicaudatus: MG663115
RH2F: GGTGGAAGAATTAATTTYTG350 H. canadensis: MG663098; MG663101
H. varicaudatus: MG663114; MG663118; MG663120

Note: i = inosine. aThis primer is a modified version of the COIR primer proposed by He et al. (2005). The primer was elongated by 4 nucleotides and two nucleotide modifications were incorporated; bThis primer is a shortened and modified version of the COI-F1 primer proposed by Kanzaki and Futai (2002). The primer was shortened from 29 nt to 19 and two nucleotide modification were introduced.

28S rDNA fragments were acquired using MCB1F and MCB1R primers (Dobosz et al., 2013). All primers used in this study were supplied either by Oligo.pl (Warsaw, PL) or by Sigma-Aldrich (USA). The amplification of the 28S rDNA and mtCOI fragments was performed in reactions containing 12.5 μ l JumpStart Taq Ready Mix or RedTaq Ready Mix (Sigma-Aldrich), 1 μ l of corresponding primer (5 μ M), 1 to 3 μ l DNA template and H2O with a total volume of 25 μ l. Annealing temperatures used for the amplification of 28S rDNA and mtCOI fragments were 58 to 60°C and 40 to 43°C, respectively. All PCR reactions were performed in Veriti 96-Well Thermal Cycler (Applied Biosystems, Foster City, CA, USA). Amplicons were visualized by UV illumination after Midori Green (Nippon Genetics Europe, Duren, Germany) gel staining and gel electrophoresis. Excess dNTPs and unincorporated primers were removed from the PCR product using the Clean-Up Purification Kit (A&A Biotechnology, Gdynia, Poland). As a final step, the purified DNA was eluted in 40 μ l H2O. Sequencing PCR reactions consisted of 1 μ l BigDye Terminator v. 3.1 Ready Reaction Mix (ThermoFisher Scientific, Waltham, MA, USA), 2 μ l BigDye sequencing buffer (ThermoFisher Scientific), 1.6 μ l (5 μ M) forward or reverse primer, and H2O with 10 μ l total volume. The thermal profile for sequencing reactions comprised of an initial denaturation step at 96°C for 1 min, followed by 25 cycles at 96°C for 10 s, 50°C for 5 s and 60°C for 105 s. 28S rDNA and mitochondrial sequences were sequenced with an ABI 3500xL genetic analyzer (Applied Biosystems).

Phylogenetic analyses

Multiple sequence alignments and subsequent comparison of the newly acquired (Tables 1 and 2) and GenBank-derived Helicotylenchus spp. sequences were performed using ClustalW algorithm as implemented in the BioEdit program v. 7.2.5 (Hall, 1999). The final multiple-sequence alignments were 595 and 588 nucleotide sites long in the case of 28S rDNA and mtCOI data, respectively. For the 28S rDNA data set, two Rotylenchus and two Hoplolaimus species were selected as outgroup: R. uniformis (MG653537, acquired in this study), R. magnus (EU280789), H. seinhorsti (DQ328752) and H. galeatus (EU626787). Heterodera glycines (HM462017) and R. uniformis (MG663121-2; this study) sequences were used as outgroups in mtCOI data set. Substitution models were tested using the “FindModel,” an online implementation of MODELTEST (Posada and Crandall, 1998). A GTR + I + G substitution model was chosen for both 28S rDNA and mtCOI DNA data sets. The Bayesian phylogenetic trees were constructed with the program MrBayes v. 3.1 (Ronquist and Huelsenbeck, 2003). In both cases, two independent runs were performed with four Markov chains per run. In case of the 28S rDNA, the program was run for 3,000,000 generations and in case of mtCOI for 1,000,000 generations, with a sampling frequency of 100 generations. Burn-in trees of 50,000 and 25,000 generations, respectively, were discarded. For the mtCOI data, the partition by codon position was set. The sampled trees from each run were combined in a single 50% majority-rule tree. The stabilization of the likelihood and parameters was checked with the program Tracer v. 1.6 (Rambaut et al., 2014).

Table 2.

Hoplolaimidae species included in phylogenetic analyses.

SpeciesIndividualSoil sample codeSample locality (Voivodeship) CoordinatesVegetation type28S rDNA GenBank numbermtCOI GenBank number
Helicotylenchus 1CH 0040/04Dobrzyca (West Pomeranian)N 54.172277 E 15.926119 Buxus sempervirens L.; nurseryMG653526MG663098
canadensis 2CH 0197/01Ligota Mała (Lower Silesian)N 51.126219 E 17.346800 Rosa L.; cultivationMG663099
3CH 0199/01Kąty Bystrzyckie (Lower Silesian)N 50.312597 E 16.840489 Rosa L.; cultivationMG653526MG663100
4CH 0199/01Kąty Bystrzyckie (Lower Silesian)N 50.312597 E 16.840489 Rosa L.; cultivationMG653527
5CH 0199/01Kąty Bystrzyckie (Lower Silesian)N 50.312597 E 16.840489 Rosa L.; cultivationMG663101
6CH 0199/01Kąty Bystrzyckie (Lower Silesian)N 50.312597 E 16.840489 Rosa L.; cultivationMG653526
Helicotylenchus 1KW 0014/05Sierpówko (Greater Poland)N 52.473777 E 16.585961Mixed forestMG653532MG663104
pseudorobustus 2KW 0063/04Brzostów (Greater Poland)N 51.978670 E 17.405130Mixed forestMG653533MG663104
3KW 0063/04Brzostów (Greater Poland)N 51.978670 E 17.405130Mixed forestMG653533MG663105
4KW 0063/04Brzostów (Greater Poland)N 51.978670 E 17.405130Mixed forestMG663106
5KW 0008/01Kleszczele (Podlaskie)N 52.563534 E 23.312296 Solanum tuberosum L.; cultivationMG653534MG663107
6KW 0008/01Kleszczele (Podlaskie)N 52.563534 E 23.312296 Solanum tuberosum L.; cultivationMG653532MG663108
7KW 0008/01Kleszczele (Podlaskie)N 52.563534 E 23.312296 Solanum tuberosum L.; cultivationMG663109
8KW 0154/01/02Nowy Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663110
9KW 0154/01/02Nowy Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653532MG663111
10KW 0154/01/02Nowy Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663112
11KW 0078/01Radomierz (Lower Silesian)N 50.909560 E 15.911490Poaceae (R. Br.) Barnh.; meadowMG653534
12KW 0078/01Radomierz (Lower Silesian)N 50.909560 E 15.911490Poaceae (R. Br.) Barnh.; meadowMG653533MG663113
13KW 0080/02Rybnica (Lower Silesian)N 50.908020 E 15.675000Fagopyrum Mill; cultivationMG653532
Helicotylenchus 1KW 0013/02Turew (Greater Poland)N 52.060160 E 16.819668 Tilia L.; parkMG663114
varicaudatus 2KW 0013/01Turew (Greater Poland)N 52.060160 E 16.819668 Platanus L.; parkMG663115
3KW 0154/01/01Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653535
4KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653535MG663116
5KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653535MG663117
6KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663118
7KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663119
8KW 0154/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG653535MG663119
9KW 0154/01/02Nowy Duninów and Stary Duninów (Masovian)N 52.577483 E 19.502000 Acer negundo L.; fallowMG663120
Rotylenchus 1KW 0084/01Czernia (Lubusz)N 51.534330 E 15.240710 Secale L.; cultivationMG653536
uniformis 2KW 0088/01Miodnica and Gorzupia (Lubusz)N 51.708180 E 15.288050 Solanum tuberosum L.; cultivationMG653537
3KW 0088/01Miodnica and Gorzupia (Lubusz)N 51.708180 E 15.288050 Solanum tuberosum L.; cultivationMG653536
4KW 0088/01Miodnica and Gorzupia (Lubusz)N 51.708180 E 15.288050 Solanum tuberosum L.; cultivationMG653538MG663121
5KW 0088/01Miodnica and Gorzupia (Lubusz)N 51.708180 E 15.288050 Solanum tuberosum L.; cultivationMG653539
6KW 0067/01Toruń (Kuyavian-Pomeranian)N 53.027500 E 18.595470lawnMG653540MG663122

Note: Individuals from whom both 28S rDNA and the mtCOI sequences were obtained are marked in grey.

Results

Helicotylenchus canadensis (Waseem, 1961).

(Fig. 1A and D; Table 3).

Table 3.

Morphometrics of Helicotylenchus canadensis populations from different localities.

LocalityPopulations analyzed in this study, PolandHolotype, Quebec, Canada acc. (Waseem, 1961)Paratypes, Quebec, Canada acc. (Waseem, 1961)Rothamsted, England acc. Yuen, 1964Populations from New Zealand, acc. (Yeates and Wouts, 1992)Populations from temperate Europe, acc. (Brzeski, 1998)
n 5152025
L793.1 ± 54 (698.7–866.6)860780 (680–970)680–840726–906680–1040
a22.4 ± 1.16 (20.9–24.1)24.524.3 (20.0–30.4)18–2623–3120–31
b5.9 ± 0.34 (5.3–6.3)5.25.4 (4.8–6.7)5.3–6.25.4–7.95.3–8.1
c50.5 ± 8.1 (38.5–61.8)62.356.4 (48.7–65.0)36–5445–6336–72
c′0.9 ± 0.1 (0.8–1.1)0.9–1.40.7–1.10.6–1.0
V58.3 ± 1.9 (55.5–59.5)6464(61–66)59–6457–6358–66
Stylet length28.8 ± 0.94 (28.2–30.7)3030 (28–30)31–3328–3327–33.5
Pharyngal length135.1 ± 11.6 (120.2–152.7)150–175103–140
Max. body diam.a 35.4 ± 2.9 (30.3–38.9)26–37
Tail length16.2 ± 3.1 (11.3–20.5)12–1615–2213–1912–22
Anal body diameter17.9 ± 2.34 (13.3–20.3)
Tail annuli number13.2 ± 2.5 (10.0–16.0)8–128–126–12
Phasmid position (number of annules anterior to anus)5.0±2.7 (3.0-9.0)4–96–123–12

Note: aMeasured at vulval region. Measurements are given in μm, V in %, and in the form: mean ± s.d. (range).

Figure 1:

Anterior and posterior regions of three Helicotylenchus species: (A) Anterior body and (D) tail of H. canadensis (CH 0199/01). (B) Anterior body and (E) tail of H. pseudorobustus (KW 0154/01). (C) Anterior body and (F) tail of H. varicaudatus female (KW 0154/02). (Scale bar =10 μm).

The morphological characteristics of H. canadensis females (n = 5) are as follows: the body is spiral when relaxed. The lateral field exists with four lines. Head is conical, truncated, bearing four to five annuli, continuous with body contour. Pharyngeal glands overlap intestine on the ventral side. The median oesophagus bulb is oval. Spermatheca is empty. Phasmids’ position is three to nine annuli anterior to anus. The tail is slightly curved dorsally, bearing 10 to 16 annuli, a bit ventrally flattened with rounded, striated terminus.

Remarks: The morphological characteristics of H. canadensis under study agree with the first description of the species (Waseem, 1961) as well as following ones given for populations from England (Yuen, 1964), New Zealand (Yeates and Wouts, 1992), Poland (Brzeski, 1998), and Hungary (Andrássy, 2007). Although the ranges of some parameters (V, pharyngeal length, body diameter, tail length, and phasmids’ position) slightly differed from those given for the paratypes, they corresponded well to the ranges given by Brzeski (1998) for H. candensis occurring in European regions of the temperate climate.

Males: Not found.

Molecular data: 28S rDNA: MG653526-MG653527, mtCOI: MG663098-MG663101.

Locality and habitat: See Table 2.

Helicotylenchus pseudorobustus (Steiner, 1914; Golden, 1956).

(Fig. 1B and E; Table 4).

Table 4.

Morphometrics of Helicotylenchus pseudorobustus populations from different localities.

LocalityPopulations analyzed in this study, PolandTopotypes, Switzerland acc. (Sher, 1966) Topotypes, Switzerland acc. (Fortuner et al., 1984)Populations from New Zealand acc. (Yeates and Wouts, 1992) Populations from temperate Europe acc. (Brzeski, 1998) Populations from California, USA acc. (Subbotin et al., 2015) Populations from Iran acc. (Shokoohi et al., 2018)
n 132020862522
L767.2 ± 81.3 (675.1–865.9)600–820764697–840560–820642–895666–934
a26.4 ± 4.7 (21.7–34.3)27–342827.5–34.924–3425.3–31.824–35
b6.0 ± 0.9 (5.8–8.1)6.0–7.25.0–8.14.2–8.65.1–7.34.2–6.6
c42.6 ± 12.2 (34.1–64.0)32–5248.433–6132–5231.2–46.932.6–59
c′1.0 ± 0.3 (0.6–1.5)0.9–1.40.9–1.50.8–1.41.0–1.41–3.2
V61.9 ± 5.5 (48.1–71.8)59–6461.659–6659–6758.4–64.646–65
Stylet length28.0 ± 0.7 (26.5–29.5)26–3027.122–2824–30.525–27.523–27
Pharyngal length124.9 ± 21.3 (102.7–173.4)116133–178104–128116–160120–148
Max. body diam.a 29.1 ± 4.9 (21.9–35.5)27.823.7–28.525–3124–31
Tail length17.3 ± 3.3 (12.5–23.20)15.914.6–19.515–2216–2413.7–24.5
Anal body diam.13.9 ± 2.2 (12.2–19.7)15.615–2013.7–16
Tail annuli number10.0 ± 2.4 (6.0–13.0)7–127–178–15
Phasmid position (number of annules anterior to anus)7.5 ± 2.3 (4–10)2–73–116–112–125–10

Note: aMeasured at vulval region. Measurements are given in μm, V in %, and in the form: mean ± s.d. (range).

The morphological features of the H. pseudorobustus females (n = 13) are as follows: the body is spiral when relaxed. The lateral field exists with four lines. The lip region is hemispherical, continuous with body contour, with four to five annuli. Stylet is present with anteriorly flattened knobs. Pharyngeal glands overlap intestine on ventral side; the median pharyngeal bulb is oval. Spermatheca is empty. Phasmids’ position is seven to ten annules anterior to anus. The tail is curved dorsally, bearing 6 to 13 annuli, with small, but distinct rounded ventral projection.

Remarks: The morphological features of the investigated H. pseudorobustus individuals were congruent with the descriptions of the topotypes (Sher, 1966; Fortuner, 1984). However, the range of most of the parameters was larger. H. pseudorobustus is a cosmopolitan species and there are many descriptions available of this species from different regions. Consequently, the ranges of many parameters extended, compared to the original ones. Most morphometric parameters of H. pseudorobustus analyzed in our study were consistent with those given by Yeates and Wouts (1992), Brzeski (1998), Subbotin et al. (2015), and Shokoohi et al. (2018). However, lower ranges of c′, tail length and anal body diameter were slightly smaller (Table 4). This finding confirms the claims of Fortuner et al. (1984) and Subbotin et al. (2015) concerning the large morphological variability of H. pseudorobustus.

Males: Not found.

Molecular data: 28S rDNA: MG653532-MG653534, mtCOI: MG663104-MG663113.

Locality and habitat: See Table 2.

Helicotylenchus varicaudatus (Yuen, 1964).

(Fig. 1C and F; Fig. 2A to C; Table 5).

Table 5.

Morphometrics of Helicotylenchus varicaudatus populations from different localities.

LocalityPopulations analyzed in this study, PolandHolotype, Rothamsted, England, acc. (Yuen, 1964)Paratypes, Rothamsted, England, acc. (Yuen, 1964)Populations from New Zealand acc. (Yeates and Wouts, 1992) Populations from temperate Europe acc. (Brzeski, 1998) Population from Portugal acc. (Schreck Reis et al., 2010) Populations analyzed in this study, PolandPopulation from Portugal acc. (Schreck Reis et al., 2010)
n 5 females19 females48 females40 females4 males10 males
L734.7 ± 101.1 (623.8–876.5)670580–670586–814520–790510–890676.3 ± 39.1 (612.8–715.2)530–700
a24.9 ± 0.9 (24.8–26.0)2218–2622–3218–2923.5–35.825.0 ± 2.4 (22.5–27.8)30.3–37.4
b5.5 ± 1.2 (4.2–7.2)4.84.3–5.24.9–7.74.3–7.55.8–8.76.7 ± 0.7 (5.7–7.2)6.6–8.5
c42.5 ± 7.3 (34.1–52.4)39–5036–7738–7539.4–7033.5 ± 2.2 (31.4–37.2)34–37.3
c′1.3 ± 0.5 (0.7–1.8)0.6–10.5–1.20.7–1.31.7 ± 0.1 (1.6–1.9)1.6–2.2
V62.5 ± 1.9 (60.1–65)6260–6359–6759–6661–67
Stylet length29.7 ± 1.2 (29.0–31.3)3229–3331–3325–3322–2626.3 ± 0.7 (25.2–27.1)20–23
Pharyngal length131.9 ± 7.0 (120.7–139.9)104–13699–113120–167113.8 ± 15.0 (99.3–134.5)126–172
Max. body diam.a 31.3 ± 6.5 (24.0–40.3)22–3414–2625.9 ± 3.0 (24.6–30.7)17–20
Tail length17.8 ± 4.1 (13.3–21.4)12–178–198–199.5–17.520.3 ± 1.1 (19.2–22.0)17–20
Anal body diam.14.8 ± 2.8 (12.0–15.4)10–1711.9 ± 1.1 (10.4–13.6)9–11
Tail annuli number5.8 ± 1.3 (4–7)6–116–124–144–88–11
Phasmid position (number of annules anterior to anus)2.0 ± 2 (0–5)−1–+5−3–+3−1–+4−4–+7
Spicula length28.1 ± 1.9 (26.5–30.7)20–25
Gubernaculum9.1 ± 0.9 (7.9–10.2)4.4–7.0

Note: aFemales measured at vulval region, males measured at mid-body. Measurements are given in μm, V in %, and in the form: mean ± s.d. (range).

Figure 2:

Anterior and posterior regions of H. varicaudatus male (KW 0154/02). (A) Anterior body. (B) Tail, with focus on spicule and gubernaculum. (C) Tail, with focus on bursa and phasmid. Images of male were captured from the video documentation of temporary slides.

The morphological features of the H. varicaudatus females are as follows: (n = 5). Habitus is loose spiral, the lateral field exists with four lines, head is conical, with four to five annuli, continuous with body contour. The length of stylet is 29 to 31.3 μ m, esophageal glands overlap intestine on ventral side. Spermatheca is empty. The tail of specimens is dorsally convex with a nearly straight ventral contour. The connection of dorsal contour with ventral one is almost at right angle. The tail is irregular at ventral terminus, with four to seven annuli and phasmids are located near anus (at anus level up to five annuli anterior to anus).

Remarks: Two H. varicaudatus populations were analyzed: one with and one without males (from Nowy Duninów/ Stary Duninów and Turew, respectively). Although, morphologically, our individuals corresponded well with the first description of H. varicaudatus made by Yuen (1964), ranges of most of the parameters differed from the original ones. H. varicaudatus was recorded in many countries and more descriptions of this species are available (Yeates and Wouts, 1992; Brzeski, 1998; Schreck Reis et al., 2010). Most parameters obtained in the current study were congruent with these descriptions. Nevertheless, tails of some females analyzed in our study were a little longer than tails of H. varicaudatus females described by other authors. It substantiates the claims of many authors (Yuen, 1964; Loof (1984); Brzeski, 1998) on the large variability of tail shape in this species and relates to the origin of the species name. Strikingly, female spermathecae of the bisexual population analyzed in our study were empty. Analyzing Dutch, bisexual population of H. varicaudatus, Loof (1984) also observed that some females had empty spermatheca. Of 86 analyzed females, only 47 had spermatheca filled with sperm.

The morphological features of the H. varicaudatus males (n = 4) are as follows: arcuate ventrally, in many respects (number of lines in lateral field, ventral overlapping of oesophageal glands, shape of head, number of head annuli) similar to females. The body is usually shorter than females (612.8 to 715.2 vs 623.8 to 876.55), with shorter stylet than females (25.2 to 27.1 vs 29.0 to 31.3). Bursa is extended to the end of tail. Spicule is slightly arcuate 26.5 to 30.7 µm, gubernaculum 7.9 to 10.2 µm.

Remarks: Although females of H. varicaudatus have been recorded in many countries, males of this species occur extremely rarely. They were noted only in some locations in the Netherlands (Loof, 1984; Bongers, 1994), in Poland (Brzeski, 1998) and in coastal sand dunes in Portugal (Schreck Reis et al., 2010). Therefore, the descriptions of H. varicaudatus males are very scarce. In our study, we found only four males of H. varicaudatus in the rhizosphere of ash-leaved maple. Although these specimens corresponded to the description of Loof (1984) in respect of morphology, they differed in some morphometric parameters in relation to the Portuguese population. The males analyzed in our study had longer spicules than in the Portuguese population, 26.5 to 30.7 µm vs 20 to 25 µm. However, the spicule length of H. varicaudatus males herein did not significantly differ from the spicule length (23 to 28 µm) of males from Poland, as previously described by Brzeski (1998). The gubernaculum of H. varicaudatus males obtained in this study was much longer than those of males from Portugal as well as those from Poland (7.9 to 10.2 µm vs 5 to 7 µm).

Molecular data: 28S rDNA: MG653535, mtCOI: MG663114-MG663120.

Locality and habitat: See Table 2.

Sequence analysis

All sequences reported in this study have been deposited in GenBank and their accession numbers are listed in Table 2. By the use of the newly designed primers, we obtained mitochondrial sequences from 4 representatives of H. canadensis, 11 of H. pseudorobustus and 8 of H. varicaudatus (Table 2). The particular amplicon and a derived size of the newly obtained sequences varied depending on the primer combination used (Table 1). The designed primers, in most combinations, targeted the region relatively closer to the 5′ end of the mtCOI gene sequence. The longest PCR amplicons, which were approximately 700 bp, were obtained using the M3.5 F and M8aR primer combination, which also amplified a part of the mitochondrial sequence closer to the 3′ end of the mtCOI gene. However, the most successful primer combination was the M2F and RH1R one, which allowed for the amplification of PCR product of approximately 600 bp from all analyzed Helicotylenchus species.

There was no intra-specific nucleotide variation concerning the four mtCOI sequences derived from H. canadensis. The potential minor nucleotide differences concerned few degenerate nucleotides, namely, K (G or T), Y (C or T), and R (A or G). The highest amplification success was obtained for the H. pseudorobustus and H. varicaudatus. By the use of three of the four presented primer combinations, we were able to obtain amplicons and subsequent mitochondrial sequences from 11 and 8 nematode individuals, respectively. The variability of the sequence amplified from H. pseudorobustus involved only some minor ambiguous nucleotides, possibly due to sequencing error. The only significant nucleotide substitution (A/T) was localized in the middle of the sequence at site 418 (MG663108), which had no influence on the potential amino acid sequence translation. Importantly, the more insightful analysis of the H. pseudorobustus mitochondrial nucleotide sequences revealed that all of them contain multiple TAA and TAG codons, which in the regular invertebrate mitochondrial genetic code would be translated as termination codons. A comparison of these sequences with the publicly available sequences derived from other Hoplolaimidae species (Fig. 3) suggests that Tyrosine (Y) and Phenylalanine (F) codons are the most vulnerable to such substitutions in this family, and that H. oleae-derived sequences also contain TAA codons (Cantalapiedra-Navarrete et al., 2013; van den Berg et al., 2016; Palomares-Rius et al., 2018). Both TAA and TAG triplets were also detected in sequences derived from two Scutellonema: S. brachyurus and S. truncatum, reported from study of van den Berg et al. (2013, 2017). No amino acid sequence ambiguities were predicted for the two other Helicotylenchus species analyzed here. Furthermore, no intra-specific variation on the nucleotide level was observed in the case of mtCOI sequences obtained from H. varicaudatus individuals.

Figure 3:

The alignment of partial mtCOI sequences from representatives of Hoplolaimidae, translated from nucleotide into amino acid sequences using the standard invertebrate mitochondrial genetic code. X, unknown amino acid; *, TAA (grey frame) or TAG (black frame) codon.

28S rDNA fragments were successfully acquired from four H. canadensis, nine H. pseudorobustus, and four H. varicaudatus individuals (Table 2). All fragments were approximately 550 nucleotides long and they were characterized by a lack of intra-specific sequence variation.

The highest values of inter-specific variations were observed between H. pseudorobustus and two other species: 32 to 39% in case of mitochondrial sequences and 12 to 13% in case of the 28S rDNA. The lowest inter-specific variation was between H. canadensis and H. varicaudatus, which was on the level of 16 to 20% in the case of mitochondrial sequences and 5% in the case of 28S rDNA.

28S rDNA and mtCOI-based phylogenetic relationships of the investigated Hoplolaimidae species

Bayesian phylogenetic analysis of the 28S rDNA sequences derived from various Helicotylenchus species resulted in a tree topology (Fig. 4) that agrees with the phylogenetic data presented by Subbotin et al. (2015), Palomares-Rius et al. (2018), and Shokoohi et al. (2018). In total, 12 Helicotylenchus clades (I to XI, as defined in Subbotin et al. 2015; number XII was given in this study to the H. oleae lineage) were recovered, and the Helicotylenchus sequences acquired here were inferred to belong to two of them. According to the expectations, H. pseudorobustus sequences were placed in Clade I and clustered with the other publicly available H. pseudorobustus sequences. The rest of the new sequences derived from the two other analyzed Helicotylenchus species were inferred to be in Clade IX. However, the representatives of each of the two species were redistributed as lineages separated by closer relationships to other species. Sequences of H. canadensis clustered within Clade IX, together with representatives of H. vulgaris Type A, whereas the H. varicaudatus-derived sequence was inferred to be a sister lineage of all other Clade IX taxa. Designating Hoplolaimus species as outgroup, Rotylenchus uniformis (MG653537, obtained in this study), together with its congener R. magnus (EU280789), formed the sister group to Helicotylenchus.

Figure 4:

Phylogeny of the genus Helicotylenchus, as inferred by Bayesian analysis of 28S rDNA. The numbers near nodes indicate posterior probabilities. Roman numerals indicate major clades following Subbotin et al. (2011, 2015). The original 28S rDNA sequences are in boldface font.

Congruent with results of 28S rRNA analyses above, the topology of the phylogenetic tree inferred from mtCOI showed that H. canadensis and H. varicaudatus share the closest pairwise relationship of the three Helicotylenchus species analyzed (Fig. 5) and they were inferred to be in Clade IX of the 28S rDNA-based tree. The species H. pseudorobustus (representative of Clade I) represented a separate lineage, whose most recent common ancestor with the former two species was that of all Helicotylenchus species. However, the relationships between the three distant lineages (Clades I, IX and XII) have not been resolved on the basis of the available mitochondrial data, most probably due to insufficient number of analyzed taxa.

Figure 5:

Phylogeny of the genus Helicotylenchus, as inferred by Baysian analysis of partial mtCOI sequences. Roman numerals indicate major clades according to Subbotin et al. (2011, 2015). The original mtCOI sequences are in boldface font.

Discussion

Morphological and molecular data in this study included three Helicotylenchus species: H. canadensis, H. pseudorobustus and H. varicaudatus, extracted from various locations and vegetation types in Poland (Table 2). The morphological evaluation of the H. pseudorobustus nematode individuals and their positioning in the Clade I of the Helicotylenchus 28S rDNA tree agreed with the type characterization of this species, as described in Subbotin et al. (2015). Newly generated 28S rDNA sequences from H. canadensis and H. varicaudatus that are positioned in Clade IX are reported for the first time for those species. Morphological and morphometrical studies on these species were congruent with previous descriptions. The inferred, close phylogenetic relationship of H. canadensis to Helicotylenchus vulgaris (Yuen, 1964) supports morphological comparisons of these two species as being very similar. The most clearly observable differences between these two species were the length of the tail and the width of the annuli at the tail end: the tail of H. vulgaris is shorter than the tail of H. canadensis, and the middle annuli at the end of the H. vulgaris tail are narrower than other annules, whereas the annuli of the H. canadensis tail are of equal width. The mtCOI-based phylogenetic analysis included four newly sequenced Helicotylenchus spp. (Fig. 5) and it also revealed that H. canadensis and H. varicaudatus are more closely related to each other than either is to H. pseudorobustus.

By providing the 28S rDNA and mtCOI data acquired in this study, the molecular characteristics of H. canadensis, H. pseudorobustus and H. varicaudatus were substantially enriched. So far, H. canadensis and H. varicaudatus had been characterized only by 18S rDNA fragments (van Megen et al., 2009; Schreck Reis et al., 2010). The 28S rDNA region is often more variable than the small subunit ribosomal DNA (Hillis and Dixon, 1991; Holterman, 2008) and it has been useful for resolving phylogenetic relationships within Hoplolaiminae (Bae et al., 2009; Subbotin et al., 2011, 2015; Palomares-Rius et al., 2018). Accordingly, the majority of the Helicotylenchus sequences deposited in GenBank comprise 28S rDNA data. Although GenBank already included 18S rDNA and 28S rDNA sequences for H. pseudorobustus, this study provides the first mtCOI fragments for this species. Characterized by a very high sequence variability, the mitochondrial data of Helicotylenchus species as well as other nematode genera are slowly increasing, being particularly useful in supporting the process of delineation of the most dubiously designated species.

The mitochondrial DNA region encoding for mtCOI gene has been widely explored for barcoding application purposes in many animal organisms (Rach et al., 2017). It was also used in Hoplolaimidae and other nematode groups (Kanzaki and Futai, 2002; Derycke et al., 2010; Riepsamen et al., 2011; Gutiérrez-Gutiérrez et al., 2012; Kumari and Subbotin, 2012; van den Berg et al., 2013; Cantalapiedra-Navarrete et al., 2013; Holguin et al., 2015; Vovlas et al., 2015; van den Berg et al., 2017; Sanchez-Monge et al., 2017; Skwiercz et al., 2017). In this study, to enhance the process of delineation and species identification within genus Helicotylenchus, which was underrepresented in terms of available mtCOI sequences, a new set of mtCOI primers was developed and tested. These newly designed primers offer an alternative to the most frequently used mtCOI primers combinations, especially in a situation when the original ones fail in the amplification of a desired PCR product. Most of the primer combinations presented in this publication allowed for the amplification of the fragments closer to the 5′ end of the assumed cytochrome oxidase c nucleotide sequence. The primer M2F in combination with the RH1R primer was the most successful in our study and allowed for amplification of a mtCOI sequence (600 bp) from all Helicotylenchus species analyzed here. The longest mtCOI sequence, including more nucleotides at its 3′ end, was acquired using the M3.5F and M8aR primer combination on H. pseudorbustus (and R. uniformis that was used as an outgroup species).

The inspection of mitochondrial sequences obtained here shows that all 11 mtCOI sequences from the nematode representatives of H. pseudorobustus were almost identical and included TAA and TAG codons at the same implied amino acid positions. Strikingly, such sequences were obtained each time for the H. pseudorobustus representatives, using three different mtCOI-targeted primer combinations (Table 1), whereas none of the sequences acquired from the other two Helicotylenchus species analyzed here revealed such nucleotide substitutions. In contrast, the homologous triplets in the mtCOI sequences of H. candadensis and H. varicaudatus instead contain triplets translated into tyrosine (TAT) and the phenylalanine (TTT) according to the standard invertebrate mitochondrial genetic code. This finding suggests alterations to the mitochondrial genetic code in H. pseudorobustus, if sequences are indeed translated through putative stop codons in this species.

Genetic code alterations in both nuclear and mitochondrial genomes have been reported in various organisms (Bessho et al., 1992; Telford et al. 2000; Lavrov et al., 2012; Lavrov, 2014; Bezerra et al., 2015; Pánek et al., 2017). In their studies, Jacob et al. (2009) showed that such alterations can also be found in nematodes. In the mitochondrial genome of nematode Radopholus similis (Pratylenchidae), the UAA (TAA) codon is reassigned from translation termination to tyrosine. Consequently, the usage of the TAA codon can be observed in mtCOI sequences acquired from various Hoplolaimidae species, including Rotylenchulus spp. (van den Berg et al., 2016) and the recently investigated H. oleae (Palomares-Rius et al., 2018). Although the simultaneous presence of TAA and TAG codons can be found in the sequences of Scutellonema brachyurus and S. truncatum, derived from the study of van den Berg et al. (2013, 2017), the authors did not elaborate on this matter.

On the contrary, the occurrence of stop codons in the mitochondrial sequences acquired from nematodes could also be an indication of nuclear copies of mitochondrial-derived genes (numts) or COI pseudogenes, as were highlighted by Holguin et al. (2015) in their studies on genetic diversity of Hoplolaimus spp. Although the researchers did not detect such changes in the mtCOI sequences in the species of their interest, they raised an important issue concerning the use of mtCOI sequences in the phylogenetic studies of nematodes. As long as the occurrence of TAG codons in the reported sequences is properly investigated, phylogenetic analyses based on mtCOI sequences should be treated with suitable consideration.

DOI: https://doi.org/10.21307/jofnem-2019-033 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Page range: 1 - 17
Submitted on: Aug 30, 2018
|
Published on: Jun 6, 2019
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2019 K. Rybarczyk-Mydłowska, E. Dmowska, K. Kowalewska, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.