Spiral nematodes, which belong to the Helicotylenchus spp. (Hoplolaimidae), are representatives of Tylenchomorpha, which is considered the most successful lineage of plant parasitic nematodes. They evolved by gradual transitions from fungal feeders through facultative plant parasites toward obligatory plant parasites (Holterman et al., 2017). Furthermore, the phylogenetic tree of this group reveals main evolutionary pathways, leading from ectoparasitism or migratory endoparasitism to the most specialized, sedentary endoparasitic lifestyles, exhibited by the most harmful plant-damaging nematode species. Although the majority of research focuses on the latter pests, the investigation of species that developed less sophisticated mechanisms of parasitism should not be overlooked. Analyses of molecular information hidden in their genomes bring us closer to an explanation why some groups of nematodes became more successfully adapted to plant parasitism than others.
Unlike the closely related, sedentary endoparasitic cyst nematodes, most representatives of the genus Helicotylenchus (Steiner, 1945) are considered mild plant pathogens of minor economic importance. However, several species like H. dihystera (Cobb, 1893; Sher, 1961), H. digonicus (Perry in Perry, Darling & Thorne, 1959), H. multicinctus (Cobb, 1893; Golden, 1956), H. pseudorobustus (Steiner, 1914; Golden, 1956), or H. varicaudatus (Yuen, 1964) were proven to be associated with plant growth suppression or more severe crop-plant damage (Perry et al., 1959; Siddiqi, 2000; Schreck Reis et al., 2010). They are classified as ectoparasites or semi-endoparasites and can be found in root systems of diverse cultivated and uncultivated plants (Siddiqi, 2000; Subbotin et al., 2011). In total, this cosmopolitan genus encompasses over 200 described species (Uzma et al., 2015), of which many await a more detailed characterization.
To determine particular Helicotylenchus species, a precise evaluation of morphological and morphometrical features is used, usually after the preliminary recognition of the characteristic coiled body shape observed in the relaxed state or after death. However, the available keys do not always allow for proper species identification due to high intra-specific and minor inter-specific variability within the genus (Fortuner, 1984; Fortuner et al., 1984). The proposed diagnostic characters and features can match and overlap between closely related species. Therefore, to facilitate the species identification process as well as to delineate more phylogenetically distant species, which share the same morphology (cryptic species), the support of a molecular approach is needed.
To date, only about 20% of Helicotylenchus species has been molecularly characterized using mostly ribosomal DNA fragments (18S, ITS, 28S rDNA; GenBank resources). Mitochondrial cytochrome c oxidase subunit I (mtCOI) sequences were reported for one species, the recently described H. oleae (Palomares-Rius et al., 2018), and a cytochrome c oxidase subunit II sequence was reported solely for H. dihystera (Riepsamen et al., 2011). A combination of both the nuclear genome-derived large subunit ribosomal DNA gene (28S rDNA) and more variable genes such as mtCOI has been suggested to comprise valuable markers for subsequent phylogenetic analyses in this group (Subbotin et al., 2011; Palomares-Rius et al., 2018).
The objectives of this study were as follows: to deliver molecular characteristics of three Hecicotylenchus species commonly occurring in Poland, namely, H. canadensis, H. pseudorobustus and H. varicaudatus, by the use of nuclear 28S rDNA and mtCOI data, and to further evaluate the potential of mtCOI sequences for species identification and phylogenetic study of the genus Helicotylenchus.
Materials and methods
Sampling, nematode extraction, and conservation
Three Hoplolaimidae species originating from Poland were analyzed: H. canadensis, H. pseudorobustus, and H. varicaudatus. Nematodes were collected during a study conducted between 2010 and 2014 on the characterization, occurrence, and distribution of plant parasitic nematodes in Poland. Soil samples were derived from various habitats and vegetation types. Each sample (about 1 kg of soil) was taken to a depth of 30 cm from the root zone using a soil sampler. Nematode extraction was performed by the decantation and sieving method, followed by the centrifugal flotation method (van Bezooijen, 2006). Nematodes were killed with hot water at 60°C. The parts of the samples of selected Hoplolaimidae were fixed in TAF and designated for morphological analysis. The rest of the samples were fixed in DESS and given to molecular studies.
Morphological identification
Morphological observations and morphometrical analyses were performed using Leica light microscope with Nomarski differential interference contrast. Morphological identification was performed using identification keys and descriptions by Waseem (1961), Yuen (1964), Sher (1966), Brzeski (1998), and Andrássy (2007). Nematodes fixed in DESS were subjected to morphological vouchering and DNA amplification procedure of Yoder et al. (2006). Nematodes were identified on the temporary slides, and subsequently multifocal images were made for every specimen.
DNA extraction
After morphological identification, analyzed nematode individuals were marked with specific codes and assigned for further molecular studies. Genomic DNA from single nematode specimens was extracted using either GenElute™ Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) or QIAamp DNA Micro Kit (Qiagen) according to the manufacturers’ instructions. For each sample, DNA was eluted in 30 μ l H2O. Extracted DNA was stored at −20°C.
Primers, DNA amplification, and sequencing
The mitochondrial DNA fragments of the mtCOI as well as the genomic DNA fragments of the large subunit rDNA (28S rDNA) were amplified from the collected Hoplolaimidae species. Initially, during the ongoing survey project, the publicly available JB3 and JB4 or JB5 mtCOI primers (Hu et al., 2002; Derycke et al., 2010) were tested for amplification of mtCOI fragments from numerous plant parasitic species. However, from these primers, PCR amplification failed. Therefore, a new set of primers was developed according to the slightly modified primer design methodology, as in Rybarczyk-Mydłowska et al. (2012, 2014). An alignment comprising of mtCOI publicly available sequences from different nematode taxa served as a starting point for identification of the most conserved regions, which were subsequently used for design of various variants of forward and reverse primers. GenBank accession numbers of nematode mtCOI sequences used in the alignment are listed in the Supplementary Table 1 (Table S1). Primer combinations that worked best for genus Helicotylenchus and resulted in a successful amplification of partial mtCOI sequences are listed in Table 1. It is worth mentioning that, in their recent work, Palomares-Rius et al. (2018) used a primer pair originally developed by Kanzaki and Futai (2002), which allowed them to amplify approximately 660 bp, covering a broader region of this gene from H. oleae. Remarkably, the use of the hereby presented M3.5F and M8aR primer combination targets a mtCOI region of comparable length of 670, slightly shifted to the 3′ end.
Table 1.
Overview of PCR primers designed in this study, which were used for mtCOI amplification from three Helicotylenchus spp. and one Rotylenchus sp.
| Forward primer (5′-3′) | Reverse primer (5′-3′) | Approximate amplicon size | Name of species and corresponding GenBank sequence numbers | |||||
|---|---|---|---|---|---|---|---|---|
| M3.5F: GGAGTGGiACARGiTGAAC | M8aRa: GCAACiACATAATAAGWATCATG | 700 | H. pseudorobustus: MG663105 | |||||
| R. uniformis: MG663121 | ||||||||
| M6.9R: ACCiACARTAAAiATATGATG | 450 | H. pseudorobustus: MG663104 | ||||||
| H. varicaudatus: MG663116; MG663116; MG663116 | ||||||||
| R. uniformis: MG663122 | ||||||||
| M2Fb: ATTGGiGSTTTTGGTAATT | RH1R: CCAACAATGAATATATGATG | 600 | H. canadensis: MG663099; MG663100 | |||||
| H. pseudorobustus: MG663106; MG663107; MG663109; MG663110; MG663111; MG663112; MG663113 | ||||||||
| H. varicaudatus: MG663115 | ||||||||
| RH2F: GGTGGAAGAATTAATTTYTG | 350 | H. canadensis: MG663098; MG663101 | ||||||
| H. varicaudatus: MG663114; MG663118; MG663120 |
| Species | Individual | Soil sample code | Sample locality (Voivodeship) | Coordinates | Vegetation type | 28S rDNA GenBank number | mtCOI GenBank number | |
|---|---|---|---|---|---|---|---|---|
| Helicotylenchus | 1 | CH 0040/04 | Dobrzyca (West Pomeranian) | N 54.172277 E 15.926119 | Buxus sempervirens L.; nursery | MG653526 | MG663098 | |
| canadensis | 2 | CH 0197/01 | Ligota Mała (Lower Silesian) | N 51.126219 E 17.346800 | Rosa L.; cultivation | – | MG663099 | |
| 3 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 | Rosa L.; cultivation | MG653526 | MG663100 | ||
| 4 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 | Rosa L.; cultivation | MG653527 | – | ||
| 5 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 | Rosa L.; cultivation | – | MG663101 | ||
| 6 | CH 0199/01 | Kąty Bystrzyckie (Lower Silesian) | N 50.312597 E 16.840489 | Rosa L.; cultivation | MG653526 | – | ||
| Helicotylenchus | 1 | KW 0014/05 | Sierpówko (Greater Poland) | N 52.473777 E 16.585961 | Mixed forest | MG653532 | MG663104 | |
| pseudorobustus | 2 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | MG653533 | MG663104 | |
| 3 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | MG653533 | MG663105 | ||
| 4 | KW 0063/04 | Brzostów (Greater Poland) | N 51.978670 E 17.405130 | Mixed forest | – | MG663106 | ||
| 5 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 | Solanum tuberosum L.; cultivation | MG653534 | MG663107 | ||
| 6 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 | Solanum tuberosum L.; cultivation | MG653532 | MG663108 | ||
| 7 | KW 0008/01 | Kleszczele (Podlaskie) | N 52.563534 E 23.312296 | Solanum tuberosum L.; cultivation | – | MG663109 | ||
| 8 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663110 | ||
| 9 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653532 | MG663111 | ||
| 10 | KW 0154/01/02 | Nowy Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663112 | ||
| 11 | KW 0078/01 | Radomierz (Lower Silesian) | N 50.909560 E 15.911490 | Poaceae (R. Br.) Barnh.; meadow | MG653534 | – | ||
| 12 | KW 0078/01 | Radomierz (Lower Silesian) | N 50.909560 E 15.911490 | Poaceae (R. Br.) Barnh.; meadow | MG653533 | MG663113 | ||
| 13 | KW 0080/02 | Rybnica (Lower Silesian) | N 50.908020 E 15.675000 | Fagopyrum Mill; cultivation | MG653532 | – | ||
| Helicotylenchus | 1 | KW 0013/02 | Turew (Greater Poland) | N 52.060160 E 16.819668 | Tilia L.; park | – | MG663114 | |
| varicaudatus | 2 | KW 0013/01 | Turew (Greater Poland) | N 52.060160 E 16.819668 | Platanus L.; park | – | MG663115 | |
| 3 | KW 0154/01/01 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653535 | – | ||
| 4 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653535 | MG663116 | ||
| 5 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653535 | MG663117 | ||
| 6 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663118 | ||
| 7 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663119 | ||
| 8 | KW 0154/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | MG653535 | MG663119 | ||
| 9 | KW 0154/01/02 | Nowy Duninów and Stary Duninów (Masovian) | N 52.577483 E 19.502000 | Acer negundo L.; fallow | – | MG663120 | ||
| Rotylenchus | 1 | KW 0084/01 | Czernia (Lubusz) | N 51.534330 E 15.240710 | Secale L.; cultivation | MG653536 | – | |
| uniformis | 2 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 | Solanum tuberosum L.; cultivation | MG653537 | – | |
| 3 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 | Solanum tuberosum L.; cultivation | MG653536 | – | ||
| 4 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 | Solanum tuberosum L.; cultivation | MG653538 | MG663121 | ||
| 5 | KW 0088/01 | Miodnica and Gorzupia (Lubusz) | N 51.708180 E 15.288050 | Solanum tuberosum L.; cultivation | MG653539 | – | ||
| 6 | KW 0067/01 | Toruń (Kuyavian-Pomeranian) | N 53.027500 E 18.595470 | lawn | MG653540 | MG663122 |
| Locality | Populations analyzed in this study, Poland | Holotype, Quebec, Canada acc. (Waseem, 1961) | Paratypes, Quebec, Canada acc. (Waseem, 1961) | Rothamsted, England acc. Yuen, 1964 | Populations from New Zealand, acc. (Yeates and Wouts, 1992) | Populations from temperate Europe, acc. (Brzeski, 1998) | ||
|---|---|---|---|---|---|---|---|---|
| n | 5 | 15 | 20 | 25 | ||||
| L | 793.1 ± 54 (698.7–866.6) | 860 | 780 (680–970) | 680–840 | 726–906 | 680–1040 | ||
| a | 22.4 ± 1.16 (20.9–24.1) | 24.5 | 24.3 (20.0–30.4) | 18–26 | 23–31 | 20–31 | ||
| b | 5.9 ± 0.34 (5.3–6.3) | 5.2 | 5.4 (4.8–6.7) | 5.3–6.2 | 5.4–7.9 | 5.3–8.1 | ||
| c | 50.5 ± 8.1 (38.5–61.8) | 62.3 | 56.4 (48.7–65.0) | 36–54 | 45–63 | 36–72 | ||
| c′ | 0.9 ± 0.1 (0.8–1.1) | 0.9–1.4 | – | – | 0.7–1.1 | 0.6–1.0 | ||
| V | 58.3 ± 1.9 (55.5–59.5) | 64 | 64(61–66) | 59–64 | 57–63 | 58–66 | ||
| Stylet length | 28.8 ± 0.94 (28.2–30.7) | 30 | 30 (28–30) | 31–33 | 28–33 | 27–33.5 | ||
| Pharyngal length | 135.1 ± 11.6 (120.2–152.7) | – | – | – | 150–175 | 103–140 | ||
| Max. body diam.a | 35.4 ± 2.9 (30.3–38.9) | – | – | – | 26–37 | – | ||
| Tail length | 16.2 ± 3.1 (11.3–20.5) | – | 12–16 | 15–22 | 13–19 | 12–22 | ||
| Anal body diameter | 17.9 ± 2.34 (13.3–20.3) | – | – | – | – | – | ||
| Tail annuli number | 13.2 ± 2.5 (10.0–16.0) | – | – | 8–12 | 8–12 | 6–12 | ||
| Phasmid position (number of annules anterior to anus) | 5.0±2.7 (3.0-9.0) | – | – | 4–9 | 6–12 | 3–12 |
| Locality | Populations analyzed in this study, Poland | Topotypes, Switzerland acc. (Sher, 1966) | Topotypes, Switzerland acc. (Fortuner et al., 1984) | Populations from New Zealand acc. (Yeates and Wouts, 1992) | Populations from temperate Europe acc. (Brzeski, 1998) | Populations from California, USA acc. (Subbotin et al., 2015) | Populations from Iran acc. (Shokoohi et al., 2018) | |
|---|---|---|---|---|---|---|---|---|
| n | 13 | 20 | 20 | 86 | 25 | 22 | ||
| L | 767.2 ± 81.3 (675.1–865.9) | 600–820 | 764 | 697–840 | 560–820 | 642–895 | 666–934 | |
| a | 26.4 ± 4.7 (21.7–34.3) | 27–34 | 28 | 27.5–34.9 | 24–34 | 25.3–31.8 | 24–35 | |
| b | 6.0 ± 0.9 (5.8–8.1) | 6.0–7.2 | – | 5.0–8.1 | 4.2–8.6 | 5.1–7.3 | 4.2–6.6 | |
| c | 42.6 ± 12.2 (34.1–64.0) | 32–52 | 48.4 | 33–61 | 32–52 | 31.2–46.9 | 32.6–59 | |
| c′ | 1.0 ± 0.3 (0.6–1.5) | 0.9–1.4 | – | 0.9–1.5 | 0.8–1.4 | 1.0–1.4 | 1–3.2 | |
| V | 61.9 ± 5.5 (48.1–71.8) | 59–64 | 61.6 | 59–66 | 59–67 | 58.4–64.6 | 46–65 | |
| Stylet length | 28.0 ± 0.7 (26.5–29.5) | 26–30 | 27.1 | 22–28 | 24–30.5 | 25–27.5 | 23–27 | |
| Pharyngal length | 124.9 ± 21.3 (102.7–173.4) | – | 116 | 133–178 | 104–128 | 116–160 | 120–148 | |
| Max. body diam.a | 29.1 ± 4.9 (21.9–35.5) | – | 27.8 | 23.7–28.5 | – | 25–31 | 24–31 | |
| Tail length | 17.3 ± 3.3 (12.5–23.20) | – | 15.9 | 14.6–19.5 | 15–22 | 16–24 | 13.7–24.5 | |
| Anal body diam. | 13.9 ± 2.2 (12.2–19.7) | – | 15.6 | – | – | 15–20 | 13.7–16 | |
| Tail annuli number | 10.0 ± 2.4 (6.0–13.0) | 7–12 | – | – | 7–17 | 8–15 | – | |
| Phasmid position (number of annules anterior to anus) | 7.5 ± 2.3 (4–10) | 2–7 | 3–11 | 6–11 | 2–12 | 5–10 | – |
| Locality | Populations analyzed in this study, Poland | Holotype, Rothamsted, England, acc. (Yuen, 1964) | Paratypes, Rothamsted, England, acc. (Yuen, 1964) | Populations from New Zealand acc. (Yeates and Wouts, 1992) | Populations from temperate Europe acc. (Brzeski, 1998) | Population from Portugal acc. (Schreck Reis et al., 2010) | Populations analyzed in this study, Poland | Population from Portugal acc. (Schreck Reis et al., 2010) |
|---|---|---|---|---|---|---|---|---|
| n | 5 females | 19 females | 48 females | 40 females | 4 males | 10 males | ||
| L | 734.7 ± 101.1 (623.8–876.5) | 670 | 580–670 | 586–814 | 520–790 | 510–890 | 676.3 ± 39.1 (612.8–715.2) | 530–700 |
| a | 24.9 ± 0.9 (24.8–26.0) | 22 | 18–26 | 22–32 | 18–29 | 23.5–35.8 | 25.0 ± 2.4 (22.5–27.8) | 30.3–37.4 |
| b | 5.5 ± 1.2 (4.2–7.2) | 4.8 | 4.3–5.2 | 4.9–7.7 | 4.3–7.5 | 5.8–8.7 | 6.7 ± 0.7 (5.7–7.2) | 6.6–8.5 |
| c | 42.5 ± 7.3 (34.1–52.4) | – | 39–50 | 36–77 | 38–75 | 39.4–70 | 33.5 ± 2.2 (31.4–37.2) | 34–37.3 |
| c′ | 1.3 ± 0.5 (0.7–1.8) | – | – | 0.6–1 | 0.5–1.2 | 0.7–1.3 | 1.7 ± 0.1 (1.6–1.9) | 1.6–2.2 |
| V | 62.5 ± 1.9 (60.1–65) | 62 | 60–63 | 59–67 | 59–66 | 61–67 | ||
| Stylet length | 29.7 ± 1.2 (29.0–31.3) | 32 | 29–33 | 31–33 | 25–33 | 22–26 | 26.3 ± 0.7 (25.2–27.1) | 20–23 |
| Pharyngal length | 131.9 ± 7.0 (120.7–139.9) | – | – | 104–136 | 99–113 | 120–167 | 113.8 ± 15.0 (99.3–134.5) | 126–172 |
| Max. body diam.a | 31.3 ± 6.5 (24.0–40.3) | – | – | 22–34 | – | 14–26 | 25.9 ± 3.0 (24.6–30.7) | 17–20 |
| Tail length | 17.8 ± 4.1 (13.3–21.4) | – | 12–17 | 8–19 | 8–19 | 9.5–17.5 | 20.3 ± 1.1 (19.2–22.0) | 17–20 |
| Anal body diam. | 14.8 ± 2.8 (12.0–15.4) | – | – | – | – | 10–17 | 11.9 ± 1.1 (10.4–13.6) | 9–11 |
| Tail annuli number | 5.8 ± 1.3 (4–7) | – | 6–11 | 6–12 | 4–14 | 4–8 | – | 8–11 |
| Phasmid position (number of annules anterior to anus) | 2.0 ± 2 (0–5) | – | – | −1–+5 | −3–+3 | −1–+4 | – | −4–+7 |
| Spicula length | 28.1 ± 1.9 (26.5–30.7) | 20–25 | ||||||
| Gubernaculum | 9.1 ± 0.9 (7.9–10.2) | 4.4–7.0 |




