Table 1.
Agriculturally important nematodes tested in this study.
| Taxa | Origin and locality | PCR primer pair | Ta (°C) | Sequencing primers |
|---|---|---|---|---|
| Aphelenchoides fragariae | Live specimen 104J12, provided by Dr. Paula Agudelo, Clemson University, Clemson, South Carolina | 18S-CL-F3 and 28S-CL-R | 50 | 530F, 530R, 1912R, 18S-CL-F2, 18S-CL-R2, 18S-CL-R5, ITS-CL-F2,28S-CL-F1, D2AR, 28S-CL-F3, 28S-CL-R1 and 28S-CL-R |
| Bursaphelenchus sp. | Live specimen 104J7, isolated from walnut twig beetles, Washington | 18S-CL-F3 and 28S-CL-R | 57 | 530F, -530R, 18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R7, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, 28S-CL-F1, D2AR, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2 and 1006R |
| Bursaphelenchus xylophilus | Live specimen 104H46, isolated from Eastern white pine tree, New Hampshire | 18S-CL-F3 and 28S-CL-R | 57 | 530F, -530R, 18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R7, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, 28S-CL-F1, D2A, D2AR, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2 and 1006R |
| Crossonema sp. | Live specimen 104G38, isolated from the rhizosphere of bamboo, Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 530F, 530R, 1912R, 18S-CL-F2, 18S-CL-R2, 18S-CL-R5, ITS-CL-F2,28S-CL-F1, D2AR, 28S-CL-F3, 28S-CL-R1 and 28S-CL-R |
| Ditylenchus dipsaci | Live specimen 85A5, obtained from French Iris in Wisconsin by USDA-APHIS-PPQ interception | 18S-CL-F3 and 28S-CL-R | 50 | 530R, 1912R,18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R7, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, AR28, V2R, 28S-CL-F1, 28S-CL-F3, D2AR, 28S-CL-R1, and 28S-CL-F2 |
| Ditylenchus sp. | Live specimen 85C1, isolated from the rhizosphere of alfalfa, Moab, Utah | 18S-CL-F3 and 28S-CL-R | 50 | 530R, 1912R,18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R7, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, 5.8SF, AB28, V2R, 28S-CL-F1, 28S-CL-F3, 28S-CL-R3, 28S-CL-R1, 28S-CL-F2, 1006R |
| Ecumenicus sp. | Live specimen 85G11, isolated from the rhizosphere of alfalfa, St. George, Utah | 18S-CL-F3 and D3B | 50 | 530R, 530F,18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-R6, ITS-CL-F2, rDNA15.8S, 5.8SF, V2R, 28S-CL-F1, D2AR, D2A, 28S-CL-R3, 28S-CL-R1, 28S-CL-F2, 1006R |
| Helicotylenchus sp. | Live specimen 104G36, isolated from the rhizosphere of bamboo, Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 530R, 530F,1912R, 18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R5, 18S-CL-F8, ITS-CL-F2, 5.8SF, V2R, 28S-CL-F1, D2AR, 28S-CL-R1, 28S-CL-F2, 28S-CL-R |
| Heterodera glycines | Live J2 specimen Hg20, from the isolate, NL1-RHp originally was collected in on the east shore of Maryland and raised on soybean (G. max, cv. Kent) in sand-filled beakers | 18S-CL-F3 and D3B | 57 | 530R, 1912R, 18S-CL-R2, 18S-CL-F7,18S-CL-F2, 18S-CL-R7, 18S-Cl-F8, rDNA15.8S, 5.8SF, AB28, 28S-CL-F1, D2A, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2, 1006R, and 28S-CL-R |
| Heterodera orientalis | Live J2 specimen 104F80, isolated from the cyst in the rhizosphere of Miscanthus, Beltsville, Maryland. | 18S-CL-F3 and D3B | 57 | 530R, 530F, 1912R, 18S-CL-R2, ,18S-CL-F2, 18S-CL-R5, ITS-CL-F2, 28S-CL-F1, D2AR, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2, 28S-CL-R |
| Hoplolaimus sp. | Live specimen 104G35, isolated from the rhizosphere of bamboo, Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 530R, 530F, 1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-R5, 18S-CL-F8, ITS-CL-F2, rDNA15.8S, 5.8SF, AB28, V2R, 28S-CL-F1, D2A, 28S-CL-F3, 28S-CL-R3, 28S-CL-R1, and 28S-CL-F2 |
| Litylenchus sp. | Live specimen 104H88, isolated from the leaf of beech, Perry, Ohio | 18S-CL-F3 and 28S-CL-R | 50 | 530R, 530F, 1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-R5, 18S-CL-R7, ITS-CL-F2, rDNA15.8S, V2R, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2, 1006R and 28S-CL-R |
| Meloidogyne incognita | Live J2 specimen Me47 from the isolate, RKN Race 1, originally was collected in Maryland and maintained with ‘PA-136’ pepper in greenhouse pots | 18S-CL-F3 and D3B | 57 | 530R, 530F, 1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R7, ITS-CL-F2, 5.8SF, V2R, 28S-CL-R1, 28S-CL-F2 and 1006R |
| Pratylenchus scribneri | Live specimen Pr1 from a culture maintained with corn root explant; originally collected from soil in Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 18S-CL-F3, 530R, 530F, 1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R7, ITS-CL-F2, rDNA15.8S, 5.8SF, Ab28, V2R, D2Ar, D2A, 28S-CL-F3, 28S-CL-R3, 28S-CL-R1, 28S-CL-F2 and 28S-CL-R |
| Radopholus similis | Live specimen 31G1, obtained by USDA – APHIS – PPQ interception from Anthurium in Kurtistown, Hawaii | 18S-CL-F3 and 28S-CL-R | 50 | 530R, 530F,1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R7, ITS-CL-F2, rDNA15.8S, 5.8SF, AB28, V2R, D2AR, 28S-CL-F1, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2 and 1006R |
| Xiphinema sp. | Live specimen 06D2, isolated from soil in Clarksville, Maryland | 18S-CL-F3 and D3B | 50 | 18S-CL-F3,530R, 530F,1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R6, ITS-CL-F2, 5.8S-CL-F1, 5.8S-CL-R1(XitsS3), V2R, D2AR,D2A, 28S-CL-F3, 28S-CL-R1, 28S-CL-F2, and 1006R |
| Xiphinema sp. | Live specimen 104F83, isolated from the rhizosphere of bamboo, Beltsville, Maryland | 18S-CL-F3 and D3B | 57 | 18S-CL-F3, 530R, 530F,1912R, 18S-CL-R2, 18S-CL-F2, 18S-CL-F7, 18S-CL-R5, 18S-CL-R6, ITS-CL-F2, 5.8SF, 5.8S-CL-R1(Xist3), V2R, D2AR, 28S-CL-F2, 1006R and 28S-CL-R |
Table 2.
Ribosomal primers used for PCR and sequencing.
| Primers | Direction | Loci | Sequence (5′-3′) | PCR | Sequencing | References |
|---|---|---|---|---|---|---|
| 18S-CL-F3 | F | 18S | CTTGTCTCAAAGATTAAGCCATGCAT | ✓ | ✓ | Carta and Li (2018) |
| D3B | R | 28S | TCGGAAGGAACCAGCTACTA | ✓ | ✓ | Nunn (1992) |
| 28S-CL-R | R | 28S | CAGCTACTAGATGGTTCGATTAGTC | ✓ | ✓ | This study |
| 18S-530F (530F) | F | 18S | AAGTGTGGTGCCAGCAGCCGC | ✓ | Reverse complement of 530R | |
| 18S-530R (530R) | R | 18S | GCGGCTGCTGGCACCACACTT | ✓ | Thomas et al. (2011) | |
| 1912R | R | 18S | TTTACGGTCAGAACTAGGG | ✓ | Holterman et al. (2006) | |
| 18S-CL-R2 | R | 18S | GTTGAGTCAAATTAAGCCGCA | ✓ | Carta and Li (2018) | |
| 18S-CL-F7 | F | 18S | TGCGGCTTAATTTGACTCAAC | ✓ | This study | |
| 18S-CL-F2 | F | 18S | CTGTGATGCCCTTAGATGTCC | ✓ | Carta and Li (2018) | |
| 18S-CL-R5 | R | 18S | GCGGTGTGTACAAAGGGCAGGGAC | ✓ | Carta and Li (2018) | |
| 18S-CL-R6 | R | 18S | ACCTTGTTACGACTTTTACTTCCTCTA | ✓ | ✓ | This study |
| 18S-CL-R7 | R | 18S | ACCTTGTTACGACTTTTGCCCGGTTCA | ✓ | ✓ | This study |
| 18S-CL-F8 | F | 18S | TGAACCGGGCAAAAGTCGTAACAAGGT | ✓ | This study | |
| ITS-CL-F2 | F | ITS | ATTACGTCCCTGCCCTTTGTA | ✓ | ✓ | Carta and Li (2018) |
| 5.8S-CL-F1 | F | 5.8S | GATTCCATCATTCTAAGC | ✓ | This study | |
| 5.8S-CL-R1 | R | 5.8S | ACCGCTTAGAATGATGGAATC | ✓ | This study | |
| rDNA15.8S | F | 5.8S | ACGAGCCGAGTGATCCACCG | ✓ | Cherry et al. (1997) | |
| 5.8SF | F | 5.8S | CGGTGGATCACTCGGCTCGT | ✓ | Reverse complement of rDNA1.58S | |
| AB28 | R | 28S | ATATGCTTAAGTTCAGCGGGT | ✓ | Joyce et al. (1994) | |
| 28S-CL-F1 | F | 28S | CTGAACTTAAGCATATCAGTAAGC | ✓ | This study | |
| VRAIN 2R (V2R) | R | 28S | TTTCACTCGCCGTTACTAAGGGAATC | ✓ | Vrain et al. (1992) | |
| D2AR | R | 28S | ACTTTCCCTCACGGTACTTGT | ✓ | Reverse complement of D2A | |
| D2A | F | 28S | ACAAGTACCGTGAGGGAAAGT | ✓ | Nunn (1992) | |
| 28S-CL-R3 | R | 28S | GCAACTTTCCCTCACGGTACTTG | This study | ||
| 28S-CL-F3 | F | 28S | AAGAGAGAGTTAAAGAGGACGTGAA | ✓ | This study | |
| 28S-CL-R1 | R | 28S | ACTCCTTGGTCCGTGTTTCAAG | ✓ | This study | |
| 28S-CL-F2 | F | 28S | CGACCCGTCTTGAAACAC | ✓ | This study | |
| 28S-1006rev (1006R) | R | 28S | GTTCGATTAGTCTTTCGCCCCT | ✓ | Holterman et al. (2008) |

Figure 1:
Position diagram of primers. (A): rDNA (AF248477), Meloidogyne artiellia; (B): rDNA (AY580056), Xiphinema americanum. (C): rDNA (X03680), Caenorhabditis elegans. Created with SnapGene software (GSL Biotech, Chicago, IL; available at snapgene.com) and assembled with Adobe Photoshop CC 2018 (Adobe Systems Incorporated, San Jose, CA).

Figure 2:
PCR Amplification of 3.3 to 4.2 kb of rDNA from agriculturally important nematodes. M: DNA markers; 1: Heterodera orientalis 104F80; 2: Xiphinema sp. 104F83; 3: Hoplolaimus sp. 104G35; 4: Helicotylenchus sp. 104G36; 5: Meloidogyne incognita Me47; 6: Pratylenchus scribneri Pr1 and 7: Negative control.