Figure 1
Figure 2
Figure 3
Primers used for PCR and sequencing_
| Primers | Direction | Sequence (5'-3') | Loci | PCR | Sequencing | Reference |
|---|---|---|---|---|---|---|
| 18S-CL-F3 | F | CTTGTCTCAAAGATTAAGCCATGCAT | 18S | √ | √ | This study |
| 1912R | R | TTTACGGTCAGAACTAGGG | 18S | √ | √ | Holterman et al. (2006) |
| 18S-530R | R | GCGGCTGCTGGCACCACACTT | 18S | √ | Thomas (2011) | |
| 530F | F | AAGTCTGGTGCCAGCAGCCGC | 18S | √ | Thomas (2011) | |
| D2A | F | ACAAGTACCGTGAGGGAAAGTTG | 28S | √ | √ | Nunn (1992) |
| D3B | R | TCGGAAGGAACCAGCTACTA | 28S | √ | √ | Nunn (1992) |
| D3A | F | GACCCGTCTTGAAACACGGA | 28S | √ | Nunn (1992) | |
| ITS-CL-F2 | F | ATTACGTCCCTGCCCTTTGTA | ITS | √ | √ | This study |
| VRAIN 2R | R | TTTCACTCGCCGTTACTAAGGGAATC | ITS | √ | √ | Vrain et al. (1992) |
| rDNA1.58S | R | ACGAGCCGAGTGATCCACCG | ITS | √ | Cherry et al. (1997) | |
| COI-CL-F8 | F | AGAGAGTTCTAATCATAAAGATATTGG | COI | √ | √ | This study |
| COI-R2 | R | GTAGCAGCAGTAAAATAAGCACG | COI | √ | √ | Kanzaki and Futai (2002) |
| COI-F2 | F | CCTGTCTTGGCTGGTGCTATTAC | COI | √ | Kanzaki and Futai (2002) |
Summary of 28S rDNA sequences in Figure 3 tree
| Taxon | Isolate/Strain | Accession | Length (bp) | Locality |
|---|---|---|---|---|
| Bursaphelenchus abietinus | 137 | AY508074 | 724 | Austria |
| Bursaphelenchus antoniae | 104F25F3 | MA, USA | ||
| Bursaphelenchus antoniae | AM279710 | Portugal | ||
| Bursaphelenchus chengi | HLi104111UGMD | EU107359 | 741 | Taiwan |
| Bursaphelenchus hellenicus | 154 | AY508083 | 724 | Greece |
| Bursaphelenchus hofmanni | 155 | AY508084 | 725 | Germany |
| Bursaphelenchus hylobianum | Ne-2-98 | KT806477 | 782 | China |
| Bursaphelenchus niphades | BnFFPRI | AB849479 | 708 | Japan |
| Bursaphelenchus parantoniae | JH2015 | KT223042 | 786 | Belgium |
| Bursaphelenchus rainulfi | BrBRA | KF978102 | 785 | Brazil |
| Bursaphelenchus rufipennis | AB368530 | 1,241 | Alaska, USA |
Summary of 18S rDNA sequences in Figure 2 tree_
| Taxon | Isolate/Strain | Accession | Length (bp) | Locality |
|---|---|---|---|---|
| Bursaphelenchus n.sp. | 104F33 | 978 | MA, USA | |
| Bursaphelenchus abietinus | 137 | AY508011 | 1,706 | Austria |
| Bursaphelenchus antoniae | – | AM279709 | 1,650 | Portugal |
| Bursaphelenchus borealis | 138 | AY508012 | 1,698 | Germany |
| Bursaphelenchus chengi | – | KT599480 | 1,748 | Taiwan |
| Bursaphelenchus crenati | PL-21 | KU683736 | 1,676 | Poland |
| Bursaphelenchus gerberae | 169 | AY508024 | 1,653 | Trinidad & Tobago |
| Bursaphelenchus hellenicus | 154 | AY508017 | 1,706 | Greece |
| Bursaphelenchus hylobianum | 160 | AY508019 | 1,709 | China |
| Bursaphelenchus niphades | NK203 | AB849465 | 1,564 | Japan |
| Bursaphelenchus parantoniae | JH-2015 | KT223041 | 1,748 | Belgium |
| Bursaphelenchus paraparvispicularis | 38717 | GQ421483 | 1,642 | Hong Kong, China |
| Bursaphelenchus parapinasteri | Zhoushan | KT878515 | 1,648 | China |
| Bursaphelenchus rainulfi | Ne27/04 | AM397017 | 1,687 | Brazil |
| Bursaphelenchus rufipennis | – | AM397017 | 1,699 | Alaska, USA |
| Bursaphelenchus sakishimanus | – | LC027461 | 1,699 | Ishigaki Is., JP |
| Bursaphelenchus sinensis | – | AB232162 | 2,525 | Japan |