Skip to main content
Have a personal or library account? Click to login
First report of Bursaphelenchus antoniae from Pinus strobus in the U.S. Cover

First report of Bursaphelenchus antoniae from Pinus strobus in the U.S.

By:  and    
Open Access
|Dec 2018

Full Article

Juvenile, female and male nematodes were discovered in wood chips of white pine Pinus strobus from Ashley Falls, MA. The white pine specimen was submitted to the University of Massachusetts Nematology Lab to examine for the pine wood nematode (PWN), Bursaphelenchus xylophilus, as required for shipment of pine logs to an Asian trading partner. Initial observations suggested these nematodes might be PWN, but closer morphological and molecular characterization proved otherwise. Comparison of measured features with those in the literature indicated this nematode population had some unique characteristics. Female nematodes having a vulval flap but an acute tail did not agree with PWN B. xylophilus that has a rounded tail. Specimens were characterized microscopically and with four molecular markers to identify this population.

Materials and methods

Individual specimens from white pine trees in Massachusetts, and specimens of B. antoniae from Portugal were mechanically disrupted in 20 µl of extraction buffer (Thomas 2011) then stored in PCR tube at –80oC until needed. Each extract was prepared by incubating the tubes at 60oC for 60 min, followed by 95oC for 15 min to deactivate proteinase K.

PCR amplification: Each 25 µl PCR reaction was prepared with 2 µl of the extract and 23 µl of the PCR master mix containing 0.625U TaKaRa EX Taq (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s protocol. The ribosomal 18S SSU DNA, ribosomal 28S LSU DNA, internal transcribe spacer (ITS) and cytochrome c oxidase I (COI) were amplified by PCR with the primer sets described in Table 1. The PCR condition for the 18S was 95oC for 3 min; 36 cycles of 95oC for 30 sec, 50oC for 40 sec, and 72oC for 70 sec; and final extension at 72oC for 5 min, for the 28S was 95oC for 3 min; 36 cycles of 95oC for 30 sec, 58oC for 45 sec, and 72oC for 70 sec; and final extension at 72oC for 5 min, for the ITS was 95oC for 3 min; 36 cycles of 95oC for 30 sec, 55oC for 60 sec, and 72oC for 105 sec; and final extension at 72oC for 5 min, and for the COI was 1X (94°C for 1 min), 5 X (94°C for 40 sec, 45°C 45 sec, 72°C 1 min), 35 X (94°C for 40 sec, 51°C 45 sec, 72°C 1 min), and final extension 72°C for 5 min. PCR products were visualized with the Lonza FlashGelTM DNA system (VWR International, Radnor, PA) and then treated with ExoSAP-IT reagent (Affymetrix, Inc, Santa Clara, CA) according to the manufacturer’s protocol. Direct DNA sequencing was performed bidirectionally with the primers (Table 1) and an ABI BigDye Terminator v3.1 kit and in an ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA) owned by the USDA Systematic Entomology Lab, Beltsville, MD.

Table 1

Primers used for PCR and sequencing.

PrimersDirectionSequence (5'-3')LociPCRSequencingReference
18S-CL-F3FCTTGTCTCAAAGATTAAGCCATGCAT18SThis study
1912RRTTTACGGTCAGAACTAGGG18S Holterman et al. (2006)
18S-530RRGCGGCTGCTGGCACCACACTT18S Thomas (2011)
530FFAAGTCTGGTGCCAGCAGCCGC18S Thomas (2011)
D2AFACAAGTACCGTGAGGGAAAGTTG28SNunn (1992)
D3BRTCGGAAGGAACCAGCTACTA28SNunn (1992)
D3AFGACCCGTCTTGAAACACGGA28SNunn (1992)
ITS-CL-F2FATTACGTCCCTGCCCTTTGTAITSThis study
VRAIN 2RRTTTCACTCGCCGTTACTAAGGGAATCITS Vrain et al. (1992)
rDNA1.58SRACGAGCCGAGTGATCCACCGITS Cherry et al. (1997)
COI-CL-F8FAGAGAGTTCTAATCATAAAGATATTGGCOIThis study
COI-R2RGTAGCAGCAGTAAAATAAGCACGCOI Kanzaki and Futai (2002)
COI-F2FCCTGTCTTGGCTGGTGCTATTACCOI Kanzaki and Futai (2002)

Phylogenetic analysis was performed with Geneious ver. 7.1.7 (Biomatters, Auckland, NZ), using Clustal W alignment (Thompson et al., 1994) with default parameters and Bayesian likelihood tree constructed with the MRBAYES plugin (Huelsenbeck and Ronquist, 2001). Sequences from GenBank used in phylogenetic trees for 18S rDNA and 28S rDNA are given in Tables 2, 3. Sequences generated were submitted to GenBank under accession numbers (18S: MK160127, MK160128, 28S: MK160125, MK160126, ITS: MK160122, COI MA: MK160123, MK160124, COI Portugal: MK174262, MK174263).

Table 2

Summary of 18S rDNA sequences in Figure 2 tree.

TaxonIsolate/StrainAccessionLength (bp)Locality
Bursaphelenchus n.sp.104F33978MA, USA
Bursaphelenchus abietinus 137AY5080111,706Austria
Bursaphelenchus antoniae AM2797091,650Portugal
Bursaphelenchus borealis 138AY5080121,698Germany
Bursaphelenchus chengi KT5994801,748Taiwan
Bursaphelenchus crenati PL-21KU6837361,676Poland
Bursaphelenchus gerberae 169AY5080241,653Trinidad & Tobago
Bursaphelenchus hellenicus 154AY5080171,706Greece
Bursaphelenchus hylobianum 160AY5080191,709China
Bursaphelenchus niphades NK203AB8494651,564Japan
Bursaphelenchus parantoniae JH-2015KT2230411,748Belgium
Bursaphelenchus paraparvispicularis 38717GQ4214831,642Hong Kong, China
Bursaphelenchus parapinasteri ZhoushanKT8785151,648China
Bursaphelenchus rainulfi Ne27/04AM3970171,687Brazil
Bursaphelenchus rufipennis AM3970171,699Alaska, USA
Bursaphelenchus sakishimanus LC0274611,699Ishigaki Is., JP
Bursaphelenchus sinensis AB2321622,525Japan
Table 3

Summary of 28S rDNA sequences in Figure 3 tree

TaxonIsolate/StrainAccessionLength (bp)Locality
Bursaphelenchus abietinus 137AY508074724Austria
Bursaphelenchus antoniae 104F25F3MA, USA
Bursaphelenchus antoniae AM279710Portugal
Bursaphelenchus chengi HLi104111UGMDEU107359741Taiwan
Bursaphelenchus hellenicus 154AY508083724Greece
Bursaphelenchus hofmanni 155AY508084725Germany
Bursaphelenchus hylobianum Ne-2-98KT806477782China
Bursaphelenchus niphades BnFFPRIAB849479708Japan
Bursaphelenchus parantoniae JH2015KT223042786Belgium
Bursaphelenchus rainulfi BrBRAKF978102785Brazil
Bursaphelenchus rufipennis AB3685301,241Alaska, USA
Figure 1

A. Female body, B. Male body, C. Female Tail, D. Male Tail.

Figure 2

18S, MrBayes tree with posterior probabilities on branches of Bursaphelenchus antoniae and close relatives within the ‘B. hylobianum species group’ (in Clade I of Kanzaki et al., 2015) based on a Clustal W alignment implemented in Geneious ver. 7.1.7 (Biomatters, Auckland, NZ) using the MRBAYES plugin with Chain Length 1,100,000, Burnin 110,000, mean -LnL - 7438.56.

Figure 3

28S MrBayes tree with posterior probabilities on branches of B. antoniae based on a Clustal W alignment implemented in Geneious ver. 7.1.7 (Biomatters, Auckland, NZ) with Chain Length 1,100,000, Burnin 110,000, mean -LnL 3407.0.

Results and discussion

Bursaphelenchus antoniae females (Fig. 1A) and males (Fig. 1B) were found for the first and only time in North America since its species description from Portugal (Penas et al., 2006a). All standard morphometric measurements were within the bounds of the original population from Europe.

Female n = 5: L = 597.5 ± 44.6 (527.5–650.5) µm, body width = 21.6 ± 1.3 (19.8–23.1) µm, pharynx length = 67.8 ± 3.7 (63.2–73.2) µm, tail length = 44.2 ± 2.1 (41.3–46.8) µm, ABD = 11.0 ± 1.6 (8.6–12.3) µm, stylet length= 14.3 ± 0.6 (13.3–14.8) µm, a = 27.7 ± 1.9 (26.4–30.7), b = 8.8 ± 0.6 (7.9–9.6), c = 13.5 ± 0.8 (12.3–14.4), c’ = 4.1 ± 0.5 (3.7–5.0), V = 71 ± 1.1 (69–72)%.

Male n = 5: L = 568 ± 71 463–654) µm, body width = 20.3 0.4 (20.1–20.6) µm, e = 71.4 ± 1.8 (70.2–72.7) µm, tail length = 30.0 ± 3.5 (28.3–36.6) µm, ABD = 17.0 ± 0.0 (17.0–17.0) µm, stylet length = 17 ± 1 (13–15) µm, spicule length = 15± 1.0 (41–21) µm, a = 30.2 ± 2.22 (28.7–31.8), b = 8.6 ± 1.00 (76.5–9.3), c = 16.9 ± 1.75 (15.7–18.2), c’ = 2.3 ± 0.2 (2.11–2.6).

This population is part of a species complex within a clade of other weevil-vectored Bursaphelenchus (Penas et al., 2006a, 2006b, 2007) within the Hylobius species group of Bursaphelenchus species associated with weevil vectors. This group is phylogenetically distinct from the Xylophilus group (Kanzaki et al., 2015).

The female tail tip in B. antoniae was clearly pointed (Penas et al., 2006a) while in this US population the tail tip was mucronate (Fig. 1C) and not acute. The closely related species B. parantoniae (Munawar et al., 2015) had a bluntly rounded tail tip. These female tail tip shapes may represent genetic, epigenetic or environmental polyphenisms (Duncan et al., 2014; Susoy et al., 2015). These possibilities would be clarified if cultures of both populations could be crossed to assess the stability of these phenotypes. In North America, the pathogenic form of Bursaphelenchus xylophilus “r” has a round tail and usually occurs in pine species (Bolla et al., 1986). The generally non-pathogenic form “m” (or mucro) has a pointed tail. However, since this form can be environmentally induced (Tsai et al., 2016), and mucronate, pathogenic populations exist (Gu et al., 2011), tail form is not a very reliable indicator of potential pathogenicity of an isolate. Therefore the stability of these tail variations is important to understand in greater detail.

The 18S sequence was 99.9% similar to the Portuguese population of B. antoniae and 99.7% similar to and B. parantoniae (Fig. 2). The 28S sequence showed 97.8% similarity to B. parantoniae (Fig. 3). The ITS rDNA was 98.3% similar to B. antoniae Portugal. There were 7/834 bp differences and 99.2% similarity between the COI sequences of the US and Portuguese isolates of B. antoniae. The COI sequence was only 88% similar to B. mucronatus. simply because there are very few COI sequence accessions for Bursaphelenchus species in GenBank.

Determining whether a given species is native or introduced is an important question when dealing with an apparently known species occurring on a new continent. Bursaphelenchus luxuriosae described in Japan was identified in Portugal. This was the third member of the xylophilus group in Portugal “It is difficult to ascertain whether B. luxuriosae was introduced, together with its insect vector, or already occurred as a native species (Inácio et al., 2017).” There may be an endemic association of US B. antoniae with another Hylobius in the USA, (Salom, 1997) such as the relatively common pales weevil, H. pales, in eastern North America (www.na.fs.fed.us/spfo/pubs/fidls/pales/fidl-pales.htmPales weevil). Alternatively, the nematode may have been introduced with the regulated ecological counterpart H. abietis, commonly found in Europe (Leather et al., 1999). Many Hylobius spp. have been intercepted at US borders over recent years (USDA-APHIS, AQAS database), and others may have managed to get through yet remain undetected. Beetle-targeted surveys in MA/CT are needed to determine whether the pales weevil actually carries B. antoniae in the USA. If B. antoniae was an introduced species it might conceivably be pathogenic to some US pines.

DOI: https://doi.org/10.21307/jofnem-2018-052 | Journal eISSN: 2640-396X | Journal ISSN: 0022-300X
Language: English
Page range: 473 - 478
Published on: Dec 3, 2018
In partnership with: Paradigm Publishing Services
Publication frequency: 1 issue per year

© 2018 Lynn K. Carta, R. L. Wick, published by Society of Nematologists, Inc.
This work is licensed under the Creative Commons Attribution 4.0 License.