
Development of Molecular Tools to Differentiate Sri Lankan Wild Boar (Sus scrofa affinis) Meat from Exotic and Village Pig (Sus scrofa domestica) Meat
Abstract
Reliable labelling of meat products is important in the food industry in order to ensure food safety, prevent fraud adulterations and avoid conflict with socio-religious practices. In Sri Lanka, wild boar meat is known to be substituted with pork to meet the demand. There are many court cases on illegal selling and transportation of wild boar meat. Thus, reliable methods to identify wild boar meat are necessitated. Therefore, the objective of the present study was to differentiate meat of wild boar from exotic and domestic swine using mitochondrial DNA markers. The entire mitochondrial DNA D-loop region was amplified using the forward primer, 5’CCAAGACTCAAGGAAGGAGA3’ and reverse primer, 5’GGCGCGGATACTTGCATGTG3’. From the sequence analysis several repetitive sequences of 5’CGTGCGTACA (10 bp) was observed indicating sequence heteroplasmy in porcine mitochondrial DNA D-loop region. Avoiding these repetitive sequences D-loop exhibited 17 polymorphic sites which enable differentiation of Sri Lankan wild boar from exotic and village pigs. Furthermore, a unique repeat of AAACCACAC (9 bp) was observed within the Sri Lankan wild boar samples analyzed. Targeting two polymorphic sites PCRRFLP analysis was performed, using forward primer 5’GTGCTACGAAAGCAGG3’ and same reverse primer followed by a simple restriction digestion using cost effective Dra 1 enzyme. Upon restriction digestion, wild boar produced two bands of 150 bp and 60 bp differing them from exotic and village pigs. This technique can be routinely applied to verify wild boar meat.
Tropical Agricultural Research Vol. 23 (1): 11-20 (2011)
© 2012 M Samaraweera, SMC Himali, SC Zeng, H Jianlin, P Silva, published by Postgraduate Institute of Agriculture (PGIA)
This work is licensed under the Creative Commons License.