Skip to main content
Have a personal or library account? Click to login
Longitudinal Changes in Selected Gut Microorganisms During Gluten-Free Diet in Pediatric Coeliac Disease Cover

Longitudinal Changes in Selected Gut Microorganisms During Gluten-Free Diet in Pediatric Coeliac Disease

Polish Journal of Microbiology
AHEAD OF PRINT
By: ,   and    
Open Access
|Jun 2026
Figures & tables

Figures & Tables

Fig. 1.

Study workflow illustrating the assignment of DNA samples to study groups and subsequent qPCR analysis.

Fig. 2.

The prevalence of Bifidobacterium spp., Candida tropicalis, Saccharomyces cerevisiae, and Methanobrevibacter smithii in stool samples from pediatric coeliac patients and healthy controls. * – statistically significant differences between the study groups (χ2(4) = 15.34; p = 0.004)

Fig. 3.

Venn diagram illustrating the overlap of detected microorganisms in stool samples from pediatric coeliac disease. Each set represents samples positive for the given microorganism in at least one of the longitudinal sampling time points. Numbers indicate the number of samples harboring individual microorganisms or their combinations.

Fig. 4.

Estimated abundance of selected intestinal microorganisms in stool samples collected from children with coeliac disease before and during adherence to a gluten-free diet and from healthy controls. Microbial abundance was calculated based on qPCR standard curves and expressed as CFU/g of stool. Panels: (A) Bifidobacterium spp., (B) Candida tropicalis, (C) Saccharomyces cerevisiae, (D) Methanobrevibacter smithii. Values represent mean abundance calculated from positive samples. Error bars represent standard deviation calculated from positive samples. a – statistically significant difference between pre-diet and 1-year follow-up (p = 0.038) b – statistically significant difference between 1-year and 2-year follow-up (p = 0.031) c – statistically significant difference between 1-year follow-up and control (p = 0.018)

Fig. 5.

Distribution of Cq values of selected microorganisms across study groups.

Primer and probe sequences for qPCR and corresponding thermal cycling parameters used for detection of the respective microorganisms_

MicroorganismSequence (5’ to 3’)Thermal cycling conditionsReferences
Bifidobacterium
forward primerreverse primerprobeCGCGTCYGGTGTGAAAGCCCCACATCCAGCATCCA6-FAM-AACAGGATTAGATACCC-MGB50°C – 2 min95°C – 10 min95°C−15 s60°C−1 min }45×\left. {\matrix{ {{{95}^^\circ }{\rm{C}} - 15{\rm{s}}} \hfill \cr {{{60}^^\circ }{\rm{C}} - 1{\rm{min}}} \hfill \cr } } \right\}45 \times Delroisse et al. 2008
Candida tropicalis
forward primerreverse primerprobeGCGGTAGGAGAATTGCGTTTCATTATGCCAACATCCTAGGTTTA6-FAM-CGCAGTCCTCAGTCTAGG CTGG-CAG BHQ-150°C – 2 min95°C – 10 min95°C−15 s60°C−1 min }45×\left. {\matrix{ {{{95}^^\circ }{\rm{C}} - 15{\rm{s}}} \hfill \cr {{{60}^^\circ }{\rm{C}} - 1{\rm{min}}} \hfill \cr } } \right\}45 \times Brinkman et al. 2003
Saccharomyces cerevisiae
forward primerreverse primerprobeGAAATGCCACCGTGAATGCCTTTGGTGGTGATCCTCTATGATTG6-FAM-TGGCACCATGAACCCTAGC GTC-GTT-BHQ-195°C – 5 min94°C−30 s50°C−30 s60°C−30 s }45×\left. {\matrix{ {{{94}^^\circ }{\rm{C}} - 30{\rm{s}}} \hfill \cr {{{50}^^\circ }{\rm{C}} - 30{\rm{s}}} \hfill \cr {{{60}^^\circ }{\rm{C}} - 30{\rm{s}}} \hfill \cr } } \right\}45 \times Farmani et al. 2025
Methanobrevibacter smithii
forward primerreverse primerprobeCCGGGTATCTAATCCGGTTCCTCCCAGGGTAGAGGTGAAA6-FAM-CCGTCAGAATCGTTCCAGT CAG-BHQ-195°C – 15 min95°C−30 s60°C−1 min }45×\left. {\matrix{ {{{95}^^\circ }{\rm{C}} - 30{\rm{s}}} \hfill \cr {{{60}^^\circ }{\rm{C}} - 1{\rm{min}}} \hfill \cr } } \right\}45 \times Dridi et al. 2009

Mean microbial load (CFU/g of stool) of selected microorganisms in positive samples determined by qPCR_

MicroorganismGroup
Pre-diet6-month follow-up1-year follow-up2-year follow-uphealthy control
Bifidobacterium spp.* [mean microbial load per gram of stool in positive samples]1.03 × 108 CFU/g (n = 21)2.40 × 1010CFU/g (n = 19)5.71 × 106 CFU/g (n = 22)4.26 × 108 CFU/g (n = 22)4.57 × 107 CFU/g (n = 22)
Candida tropicalis1.01 × 106 CFU/g (n = 4)3.02 × 100 CFU/g (n = 4)8.04 × 102 CFU/g (n = 7)6.74 × 105 CFU/g (n = 13)9.57 × 104 CFU/g (n = 13)
Saccharomyces cerevisiae1.34 × 106 CFU/g (n = 5)8.05 × 107 CFU/g (n = 7)1.74 × 107 CFU/g (n = 10)3.61 × 108 CFU/g (n = 9)1.14 × 108 CFU/g (n = 14)
Methanobrevibacter. smithii4.35 × 101 CFU/g (n = 5)1.36 × 102 CFU/g (n = 5)1.97 × 102 CFU/g (n = 2)1.22 × 102 CFU/g (n = 7)1.02 × 102 CFU/g (n = 8)
DOI: https://doi.org/10.33073/pjm-2026-017 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Journal RSS Feed
Language: English
Submitted on: Feb 12, 2026
Accepted on: Apr 22, 2026
Published on: Jun 29, 2026
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year
Keywords:
gut microbiota,
coeliac disease,
gluten–free diet,
qPCR,
pediatric patients
Related subjects:
Life sciences,
Microbiology and virology

© 2026 Aleksandra Zięba, Kamil Drożdż, Agnieszka Krawczyk, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

AHEAD OF PRINT