Seroprevalence of Bovine Brucellosis in Cattle in District Bannu, Khyber Pakhtunkhwa, Pakistan

Yasif Nawaz; Muhammad Shahid Mahmood; Inamullah Wazir; Aamir Khan; Qudrat Ullah; Azhar Rafique; Muhammad Shahid; Khalid J. Alzahrani; Khalaf F. Alsharif; Saqib Nawaz

doi:10.33073/pjm-2025-024

Figures & Tables

Demonstration of Brucella abortus species in the cattle samples. The results of the B. abortus AMOS polymerase chain reaction. In a sample taken from cattle in the province of Bannu, Khyber Pakhtunkhwa, Pakistan, the amplification product of the IS711 gene showed a band size of 498 bp, with a M = 100 bp DNA ladder indicating positive samples S1 and S2.

The AMOS polymerase chain reaction results for Brucella abortus. The amplification product of the IS711 gene depicted a band size of 498bp in a sample collected from cattle in district Bannu, Khyber Pakhtunkhwa, Pakistan, M = 100 bp DNA ladder, S2 showing positive samples.

The seroprevalence of brucellosis in cattle using i-ELISA and relationship with different disease-related risk factors in district Bannu, KPK, Pakistan_

Variables	Category	N	i-ELISA (positive)	i-ELISA (negative)	p-value	OR	Confidence interval
Variables	Category	N	i-ELISA (positive)	i-ELISA (negative)	p-value	OR	L.L	U.L
Breed	Local	179	11 (6.1%)	168 (93.9%)	0.245
	Cross bred	72	06 (8.3%)	66 (91.7%)
	Exotic	33	0 (0%)	33 (100%)
Age	< 5 years	47	3 (6.4%)	44 (93.6%)	0.453
	> 5 years	222	12 (5.4%)	210 (94.6%)
	> 10 years	15	02 (13.3%)	13 (86.7%)
Sex	Male	54	05 (09.3%)	49 (90.7%)	0.26	1.854	0.624	5.504
Sex	Female	230	12 (5.2%)	218 (94.8%)	0.26	1.854	0.624	5.504
Purpose	Dairy	229	12 (5.2%)	217 (94.8%)	0.28	0.553	0.186	1.641
Purpose	Beef	55	05 (9.1%)	50 (90.9%)	0.28	0.553	0.186	1.641
Grazing	Open grazing	256	10 (3.9%)	246(96.1%)	0.001*	0.122	0.042	0.353
Grazing	Confined grazing	28	07 (25%)	21 (75%)	0.001*	0.122	0.042	0.353
Breeding protocol	AI	180	04 (2.2%)	176(97.8%)	0.0001*	0.119	0.034	0.415
Breeding protocol	Natural mating	50	08 (16%)	42 (84%)	0.0001*	0.119	0.034	0.415
Immunized against brucellosis	Yes	0	0	0
Immunized against brucellosis	No	284	17 (6%)	267 (94%)
Other vaccination	Yes	257	14 (05.4%)	24 3(94.6%)	0.238	0.461	0.124	1.718
Other vaccination	No	27	03 (11.1%)	24 (88.9%)	0.238	0.461	0.124	1.718
Health status	Healthy	244	17 (07%)	227 (93%)	0.085	1.176	1.118	1.237
Health status	Emaciated	40	0	40 (100%)	0.085	1.176	1.118	1.237
Retained placenta	Yes	58	03 (5.2%)	55 (94.8%)	0.986	0.988	0.258	3.78
Retained placenta	No	172	09 (5.2%)	163 (94.8%)	0.986	0.988	0.258	3.78
Abortion history	Yes	31	09 (29%)	22 (71%)	0.0001*	26.727	6.731	106.128
Abortion history	No	199	03 (1.5%)	196 (98.5%)	0.0001*	26.727	6.731	106.128
Pregnancy status	Pregnant	78	03 (3.8%)	75 (96.2%)	0.503	0.636	0.167	2.418
Pregnancy status	Non-pregnant	152	09 (5.9%)	143(94.1%)	0.503	0.636	0.167	2.418
Repeat breeding	Yes	70	09 (12.9%) 03 (1.9%)	61 (87.1%)	0.001*	7.721	2.022	29.479
Repeat breeding	No	160	0	157 (98.1%)	0.001*	7.721	2.022	29.479
Previous calving	Normal	204	12 (5.9%)	192 (94.1%)	0.204	1.135	1.081	1.192
Previous calving	Dystocia	26	0	26 (100%)	0.204	1.135	1.081	1.192

Primer used for detection of brucellosis_

Primer Name	Sequence (5′–3′)	Amplicon (bp)
Brucella abortus IS711	F: GACGAACGCAATTTTTCCAATCCCR: TGCCGATCACTTAAGGGCCTTCAT	498
Brucella melitensis IS711	F: AAATCGCGTCCTTGCTGGTCTGAR: TGCCGATCACTTAAGGGCCTTCAT	731
Brucella ovis IS711	F: CGGGTTCTGGCACCATCGTCGR: TGCCGATCACTTAAGGGCCTTCAT	976
Brucella suis IS711	F: GCGCGGTTTTCTGAAGGTGGTTCGGGR: TGCCGATCACTTAAGGGCCTTCAT	285

Overall seroprevalence of brucellosis in cattle through RBPT, i-ELISA in district Bannu, Khyber Pakhtunkhwa, Pakistan_

Animals type	Total number of samples	Serological examination		Molecular identification
Cattle	384	RBPT	i-ELISA	(AMOS-PCR)
Cattle	384	72 (18.75%)	31 (8%)	4 (1.04%)

Seroprevalence of brucellosis in cattle through RBPT and relationship with different disease-related risk factors_

Variables	Category	N	RBPT (positive)	RBPT (negative)	p-value	OR	Confidence interval
Variables	Category	N	RBPT (positive)	RBPT (negative)	p-value	OR	L.L	U.L
Breed	Local	179	29 (16.2%)	150 (83.8%)	0.162
	Cross bred	72	15 (20.8%)	57 (79.2%)
	Exotic	33	02 (6.1%)	31 (93.9%)
Age	< 5years	47	4 (8.5%)	43 (91.5%)	0.070
	> 5 years	222	37 (16.7%)	185 (83.3%)
	> 10 years	15	05 (33.3%)	10 (66.7%)
Sex	Male	54	11 (20.4%)	43 (79.6%)	0.355	1.425	0.671	3.028
Sex	Female	230	35 (15.2%)	195 (84.8%)	0.355	1.425	0.671	3.028
Purpose	Dairy	229	35 (15.3%)	194 (84.7%)	0.394	0.722	0.340	1.531
Purpose	Beef	55	11 (20%)	44 (80%)	0.394	0.722	0.340	1.531
Grazing	Open grazing	256	36 (14.1%)	220 (85.9%)	0.003*	0.295	0.126	0.689
Grazing	Confined grazing	28	10 (35.7%)	18 (64.3%)	0.003*	0.295	0.126	0.689
Breeding protocol	A.I	180	15 (8.3%)	165(91.7%)	0.0001*	0.136	0.063	0.296
Breeding protocol	Natural mating	50	20 (40%)	30 (60%)	0.0001*	0.136	0.063	0.296
Immunized against brucellosis	Yes	0	0	0
Immunized against brucellosis	No	284	46(16.2%)	238(83.8%)
Other vaccination	Yes	257	42 (16.3%)	215 (83.7%)	0.838	1.123	0.369	3.415
Other vaccination	No	27	4 (14.8%)	23 (85.2%)	0.838	1.123	0.369	3.415
Health status	Healthy	244	42 (17.2%)	202 (82.8%)	0.251	1.871	0.632	5.539
Health status	Emaciated	40	04 (10%)	36 (90%)	0.251	1.871	0.632	5.539
Retained placenta	Yes	58	15 (25.9%)	43 (74.1%)	0.009*	2.651	1.252	5.614
Retained placenta	No	172	20 (11.6%)	152 (88.4%)	0.009*	2.651	1.252	5.614
Abortion history	Yes	31	16(51.6%)	15 (48.4%)	0.0 001*	10.105	4.326	23.604
Abortion history	No	199	19 (9.5%)	180(90.5%)	0.0 001*	10.105	4.326	23.604
Pregnancy status	Pregnant	78	7 (9%)	71 (91%)	0.059	0.437	0.181	1.051
Pregnancy status	Non-pregnant	152	28 (18.4%)	124 (81.6%)	0.059	0.437	0.181	1.051
Repeat breeding	Yes	70	20 (28.6%)	50 (71.4%)	0.0001*	3.867	1.840	8.126
Repeat breeding	No	160	15 (9.4%)	145 (90.6%)	0.0001*	3.867	1.840	8.126
Previous calving	Normal	204	33 (16.2%)	171 (83.8%)	0.257	2.316	0.522	10.274
Previous calving	Dystocia	26	2 (7.7%)	24 (92.3%)	0.257	2.316	0.522	10.274

Seroprevalence of Bovine Brucellosis in Cattle in District Bannu, Khyber Pakhtunkhwa, Pakistan

Figures & Tables

Fig. 1.

Fig. 2.

The seroprevalence of brucellosis in cattle using i-ELISA and relationship with different disease-related risk factors in district Bannu, KPK, Pakistan_

Primer used for detection of brucellosis_

Overall seroprevalence of brucellosis in cattle through RBPT, i-ELISA in district Bannu, Khyber Pakhtunkhwa, Pakistan_

Seroprevalence of brucellosis in cattle through RBPT and relationship with different disease-related risk factors_

Paradigm

My account