Skip to main content
Have a personal or library account? Click to login
Whole Genome Shotgun Sequencing-Based Insights into the Benzene and Xylene Degrading Potentials of Bacteria Cover

Whole Genome Shotgun Sequencing-Based Insights into the Benzene and Xylene Degrading Potentials of Bacteria

Open Access
|Jun 2025

Full Article

Introduction

Benzene is declared carcinogenic by the International Agency for Research on Cancer (IARC) and the Environmental Protection Agency (EPA) of the USA (Li et al. 2021; Matheson et al. 2023). Xylene is non-carcinogenic with risk class 3 (moderate risk), but when it is found in the form of benzene, toluene, ethylbenzene, and xylene (BTEX), it proves hazardous (Li et al. 2025). These two pollutants adversely affect nervous, respiratory, reproductive, endocrine, urinary and cardiovascular systems (Caron-Beaudoin et al. 2022).

Given the ubiquitous nature, persistence, carcinogenicity, and other associated health hazards, extended range of transport, highly volatile nature, high emission rate, and internal resistance to degradation, benzene and xylene are the significant concerns today. Multiple approaches, including catalytic oxidation, soil vapor extraction, photocatalysis, and thermal incineration, have been employed (Tabakova 2024). However, as per the previously documented research, these conventional methods are not eco-friendly due to high carbon footprint and are highly expensive (Unegg et al. 2023; Sornaly et al. 2024; Kaur and Sood 2025). In comparison, bioremediation using microbes is found to be more significant due to being economically profitable, eco-friendly, capable of degrading the pollutants in dilute amounts, simple operation, least energy consumption, low carbon footprint, and reduced formation of secondary pollutants (Kuppan et al. 2024). Literature documents various case studies that successfully bio-remediated the water and soil contaminated with oil, polycyclic aromatic hydrocarbons (PHCs) and polychlorinated biphenyls (PCBs) (You et al. 2014; Schad 2016). Hence, bioremediation is capable of diluting the pollutants in environmental resources even without the use of conventional techniques. However, this will require optimizing the bioremediation process, selecting the right microorganism, adaptive management, and sufficient ongoing monitoring. In contrast, physicochemical and mechanical methods cannot completely remove pollutants when employed without bioremediation (Sales da Silva et al. 2020). However, a strategic combination of conventional and biological methods improves the outcome synergistically (Aparicio et al. 2022; Kumar et al. 2022; Nagda et al. 2022; Sornaly et al. 2024; Ha and Tan 2025).

Bacteria, adaptable to various environmental conditions and nutritionally versatile, are the most suitable candidates for bioremediation. The biodegradable potential of bacteria is reflected in their genomes. Whole Genome Sequencing (WGS) could provide a holistic view of the genes of these environmentally competent bacteria concerning bioremediation. In addition, it is also helpful in tracking the changes that occur in microbial communities during the biodegradation process, thus providing insights into its effectiveness and possible ways of optimizing the technique (Chettri et al. 2024).

Ortega-González et al. (2013) documented the genes toluene 1,2-dioxygenase (todC1), and xylene monooxygenase (xylM) in a bacterial sample comprising Cellulomonas hominis, Ralstonia insidiosa, Serratia marcescens, and Burkholderia kururiensis from a contaminated area in Southern Mexico. In another investigation, bacteria from m-, o- and p-xylene degrading enrichments, from BTEX contaminated soil in Hungary, were found to exhibit catechol 2,3-dioxygenase (C23O) encoding genes. Prominent genera of the bacterial sample were Pseudomonas, Acidovorax, and Hydrogenophaga (Banerjee et al. 2022a). Another study also documented the same C23O gene in related bacteria (Táncsics et al. 2020). The same gene was also identified via Illumina sequencing in microaerobic enrichment dominated by Rhodoferax, Pseudomonas, and Acidovorax (Bedics et al. 2022). A bacterial sample from petrochemical contaminated water, predominated by Proteobacteria, was found to exhibit toluene 2-monooxygenase (dmpK), glutaryl-CoA dehydrogenase (gcd), and benzoyl-CoA reductase (bamB) genes. These genes were detected using metagenome-assembled genome (MAG) and contig-based genome (Zhang et al. 2024). Other bacteria explored so far include Pseudomonas aromaticivorans sp. nov., Hydrogenophaga, (Banerjee et al. 2022b). Metagenome analysis based functional annotation of a bacterial sample unraveled the presence of enzymes toluene methyl monooxygenase, benzoate/toluate 1,2-dioxygenase, aryl alcohol dehydrogenase, benzaldehyde dehydrogenase, dihydroxycyclohexadiene carboxylate dehydrogenase, catechol 2,3-dioxygenase, catechol 1,2-dioxygenase, muconolactone D-isomerase, muconate cycloisomerase, 3-oxoadipate enol-lactonase, 2-hydroxymuconate-6-semialdehyde dehydrogenase, 2-hydroxymuconate semialdehyde hydrolase, 4-oxalocrotonate tautomerase, 2-keto-4-pentenoate hydratase, 2-oxo-3-hexenedioate decarboxylase, toluene 4-monooxygenase (T4MO), 4-hydroxy-2-oxovalerate aldolase, 3-methylcatechol 2,3-dioxygenase, acetaldehyde dehydrogenase, 2-hydroxy-6-oxo-octa-2,4-dienoate hydrolase and 2,3-dihydroxyethylbenzene 1,2-dioxygenase in addition to toluene, benzene, ethylbenzene, and xylene mono- and dioxygenases (Eze 2021).

The current study has targeted the genomes of eleven bacteria, which were identified in two separate projects. One project isolated benzene, and another project targeted the xylene-degrading bacteria. Ten of these eleven isolates belonged to the genus Bacillus and were Gram-positive.

Although we can find many benzene and xylene-metabolizing bacteria in previously published data, among these, only the pathways of Gram-negative bacteria are well characterized, while Gram-positive, particularly genus Bacillus, is the least understood in this regard (Wongbunmak et al. 2020). In addition, Bacillus species explored so far have not been optimized for factors affecting bioremediation like temperature, pH, and concentration of contaminants (Mohammadpour et al. 2020). This is uncommon among Gram-positive bacteria reported so far to metabolize benzene and xylene under anaerobic conditions as compared to Gram-negative microbes (Weelink et al. 2010; Banerjee et al. 2022a). Previously reported Gram-positive bacteria associated with degradation of these two pollutants have been documented as more susceptible to environmental constraints like the presence of toxins, including hydrogen sulfide, low temperature, and electron acceptors like sulfate and nitrate (Kaur et al. 2023; 2025).

Bacillus species explored so far exhibited a narrow substrate range and poor degradation efficiencies (Handayani et al. 2019). Lastly, degradation of these pollutants has never been explored in the native area of Multan, Pakistan. These limitations have been a big hurdle in optimizing the degradation potentials of bacteria isolated and characterized.

So, considering these constraints of earlier reported bacteria, we initiated a current research project hypothesizing that we might identify unusual and novel pathways and associated genes in benzene and xylene metabolizing bacteria isolated from the tannery industry of Multan.

Experimental
Materials and Methods
Isolation and characterization of bacteria

Ingredients of minimal salt medium (MSM) employed for isolation of benzene metabolizing bacteria included KH2PO4 (1 g/l), Na2HPO4 (1.25 g/l), (NH4)2SO4 (0.5 g/l), MgSO4 (0.5 g/l), CaCl2 (0.5 g/l), FeSO4 (0.005 g/l), and benzene 80 μl/100ml (Dairawan and Shetty 2020). MSM used for isolation of xylene degrading bacteria composed of KH2PO4 (1 g/l), K2HPO4 (1 g/l), NH4NO3 (1 g/l), MgSO4 (0.2 g/l), CaCl2 (0.02 g/l), FeCl3 0.5M (2 drops/l) and xylene 1 ml/100ml (Doley and Barthakur 2022). Following this, 16S rRNA gene sequencing analysis was performed to determine the genus and species of bacteria (Schumann and Pukall 2013). For amplification of the gene, forward (5′AGAGTTTGATCCT-GGTCAGAAC3′ and Tm = 70.4°C) and reverse (5′CGTACGGCTACCTTGTTACGACTTCACCCC3′ and Tm = 74.8°C) primers were used. Growth phases were predicted based on measuring the optical density at 600nm (OD600) spectrophotometrically at different time intervals (0, 3, 6, 24, 27, 30, 46, 49, 51, and 54 hours) of isolates cultures incubated at 37°C and 150 rpm (Brewster 2003). To biochemically characterize the benzene and xylene metabolizing isolates, the Remel RapID NF PLUS System and the Remel RapID STR (Thermo Scientific, Thermo Fisher Scientific, Inc., USA) system were used, respectively (Evangelista et al. 2001; Mayz et al. 2013). The degradation of organic compounds was confirmed via removal assays and gas chromatography-mass spectrometry (GC-MS) analysis (Mohamed et al. 2017; Raju and Kumar 2020).

A benzene removal assay was performed by preparing benzene stock solutions of known concentrations ranging between 5–30 mg/l. The OD180 of these solutions was estimated to plot the standard curve. To find out linearity, linear regression analysis was performed. Bacteria were cultured in MSM containing benzene (40 mg/l) as the only carbon supplement until log phase. Benzene concentration in supernatant was determined by measuring OD180 followed by its comparison with the standard curve (Hussain et al. 2025).

A stock solution of known concentrations of xylene, ranging between 100–900 mg/l, was prepared to perform the xylene removal assay. The OD265 of solutions was spectrophotometrically measured, and a standard curve was plotted. Correlation coefficient (R2) was calculated. Xylene-degrading bacteria were cultured in MSM, which contained xylene as the only supplemental carbon source. Bacteria were harvested at log phase. Residual xylene in the supernatant of each isolate was determined by measuring OD265 and comparing it with the standard curve (data is submitted somewhere else for publication).

Next generation sequencing. DNA sample preparation

Cultures of individual bacteria, harvested at the end of the log phase, were pelleted out via centrifugation (6,000 × g, 4°C, and 20 minutes). Pellet was processed for DNA extraction by an organic method based on phenol : chloroform : isoamyl alcohol (PCI). Initially, the pellet was thoroughly suspended in lysozyme (100 μl) and TE lysis buffer (500 μl) and incubated at 37°C for 2–3 hours. Afterwards, the pellet was treated with sodium dodecyl sulfate (SDS) (30 μl) and proteinase K (5 μl) and again incubated for 2 hours at 37°C. This incubation was followed by centrifugation at 14,000 × g and 4°C for 20 minutes. This resulted in the formation of three layers. The topmost aqueous layer contained DNA collected carefully into a separate Eppendorf. The remaining organic and interface layers were discarded. Sodium acetate (70 μl) and chilled PCI (400 μl) were added to the aqueous layer. The tube was incubated at -20°C for 24 hours. Following this incubation, centrifugation (14,000 × g and 4°C) for 10 minutes was carried out to pellet out the DNA. Pellet was washed 2–3 times with 70% ethanol via centrifugation. After washing, the pellet was dried by placing the Eppendorf in an inverted position on tissue paper. Dried DNA was suspended in low TE buffer (pH = 8.0).

Quality estimation by agarose gel electrophoresis

A qualified DNA sample for library construction was selected by running the sample on agarose gel electrophoresis. The 1% agarose gel was prepared by dissolving 0.5 g agarose powder in 50 ml of 1× TAE buffer with pH = 8.0. Heated the mixture for 1 minute and poured it into a gel casting tray containing a comb to create wells. Ethidium bromide was added to the gel mixture as a DNA intercalator. Following solidification, the gel was suspended in 1× TAE buffer contained in the electrophoresis tank. The 5 μl DNA to be tested was mixed with tracking dye bromophenol blue (1 μl) and loaded into wells. The gel was run for 45 minutes at 90 volts. It was followed by visualization of the gel using the Gel Documentation System, and bands were visible under UV light. A good-quality DNA sample was processed for library construction.

Library construction

Nextera® XT DNA Library Preparation Kit (Illumina, Inc., USA) was used to prepare the libraries. The library protocol used was Nextera®XT DNA Library Prep Kit Reference Guide (15031942 v03). Genomic DNA (1 ng) was fragmented and tagged with an adapter. After tagmentation, the Nextera®indexed primer was used to attach indexes with PCR. Finally, qPCR was used to quantify the purified product as per the qPCR quantification protocol guide (KAPA Library Quantification Kits for Illumina Sequencing platforms) and was qualified using the TapeStation D5000 ScreenTape (Agilent Technologies, Inc., USA). Following this, sequencing was performed using HiSeq (Illumina, Inc., USA).

Raw data

Illumina sequencer generated raw images using sequencing control software for system control and base calling through integrated primary analysis software called Real Time Analysis (RTA). The base call (BCL) binary files were converted into FASTq files using bcl2fastq, an Illumina-provided package. Adaptors were not trimmed away from reads. FASTq files were submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) to get the accession number assigned.

Raw data comprised the date of total number of bases sequenced, total number of reads, for paired end sequencing it is the sum of read 1 and read 2, ratio of GC content (GC %), ratio of AT content (AT %), ratio of bases that have phred quality score of over Q20 (%) and ratio of bases that have phred quality score of over Q30 (%).

Metagenome assembly

WGS reads were assembled into contigs/scaffolds using a new versatile metagenomic assembler, metaSPAdes (Nurk et al. 2017). It is part of SPAdes (St. Petersburg genome assembler), an assembly toolkit containing various assembly pipelines. The metagenomic contigs generated by the metaSPAdes assembler were distributed in ‘bins’ using the MetaBAT2 program (Kang et al. 2019). MetaBAT2 is a robust statistical framework for reconstructing genomes from metagenomic data. It is an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies.

QUAST quality analysis

Quality Assessment for Genome Assemblies was done by the Quast program (Gurevich et al. 2013). Parameters considered included contigs with several contigs greater than > 10,000 bp, more than or equal to 5,000, 10,000, 25,000, and 50,000 bp. Number of largest contigs. Total length of contigs. Total length of contigs with more than or equal to 1,000, 5,000, 10,000, and 25,000 bp. Low-quality reads were removed using Trimmomatic v.0.39 (Bolger et al. 2014). Sequences obtained were assessed and subjected to taxonomic and functional profiling.

Annotation of metagenomic contigs for taxonomic and functional profiling

For taxonomic profiling, annotation of metagenomic contigs was done by the Kraken program. Kraken is an ultrafast and highly accurate program for assigning taxonomic labels to metagenomic DNA sequences (Wood and Salzberg 2014).

After concatenating qualified reads, the binning approaches MaxBin2 and MetaBAT2 algorithms were employed to reconstruct the good-quality draft genome. By default, values of minimum completion (70%) and contamination (10%) were considered. For functional profiling, metagenomic contigs of each bin were analyzed by Prokka v.1.14.6 (Seemann 2014; Neely et al. 2020). KofamScan v.1.3.0 (Aramaki et al. 2020) was used to annotate Kyoto Encyclopedia of Genes and Genomes (KEGG).

Sequence deposition

The FASTq files are submitted in Sequence Read Archives, SRA NCBI database, under the accession number PRJNA976120.

Results
Isolation and characterization of isolates

Among the total bacteria characterized in the current study, six were benzene-metabolizing and five were xylene-degrading. These were identified as belonging to Paracoccus aestuarii (01), Bacillus tropicus (01), Bacillus albus (01), Bacillus subtilis (01), Bacillus thuringiensis (02), Bacillus cereus (04), and Bacillus mycoides (01). NCBI accession numbers assigned to these isolates are, OR272055, OR272056, OR272059, OR272058, OR272061, OR272060, OR272064, OR272063, OR272072, OR272071, and OR272073. Biochemical profiling exposed presence of enzymes arginine dihydrolase (ADH), ornithine decarboxylase test (ODC), lysine decarboxylase test (LDC), aliphatic thiol utilization test (TET), lipase detection test (LIP), sugar aldehyde utilization test (KSF), sorbitol fermentation test (SBL), β-glucuronidase test (GUR), γ-glutamyl-β-naphthylamide hydrolysis test (GGT), adonitol fermentation test (ADON), aliphatic diol test (TRD), triglyceride test (EST), urea test (URE), glucose test (GLU), proline-β-naphthylamide test (PRO), pyrrolidonyl-β-naphthylamide (PYR) and sodium nitrate test (NO3). Benzene and xylene removal efficiencies. Benzene degradation efficiency measured between 30 m g/l per 23 hours and 32 m g/l per 47 hours. Xylene metabolizing potential was estimated, ranging between 30 m g/l per 48 hours and 65 m g/l per 48 hours (Table SI).

GC-MS based profiling identified the metabolic intermediates of multiple previously documented benzene degradation pathways. i.e., benzene methylation pathway, benzene degradation via benzaldehyde and via carboxylation, meta and ortho-cleavage pathways and benzene degradation via phenol. The intermediates were toluene, benzyl alcohol, benzaldehyde, benzoate, catechol, cis-1,6-dihydroxy-2,4-cyclohexadiene-1-carboxylic acid, phenol, cis, cis-muconate, 3-oxoadipate enol lactone, 3-oxoadipate, palmitate, chlorobenzene, p- and o-xylene, cyclopentasiloxane, decamethyl and dodecamethyl, 1,1,3,3,5,5,7,7,9,9,11,11,13,13,15,15-hexadecamethy-loctasiloxane,6-fluoroindole, TMS derivative, methyltris (trimethylsiloxy) silane, 1,1,1,3,5,5,5-heptamethyltrisiloxane, 1,1,3,3,5,5,7,7,9,9,11,11-dodecamethylhexasiloxane,1,1,3,3,5,5,7,7,9,9,11,11,13,13,15,15-hexadecamethyloctasiloxane, 1,4-benzenedicarboxylic acid, bis(2-ethylhexyl) ester, mercaptoacetic acid, 2TMS derivative, hexasiloxane, tetradecamethyl, 1,1,1,5,7,7,7-heptamethyl-3,3-bis(trimethylsiloxy) tetrasiloxane, oxaze-pam, 2TMS derivative, N-benzyl-N-ethyl-p-isopropylbenzamide, cyclononasiloxane, octadecamethyl, bis(2-ethylhexyl) phthalate, cyclononasiloxane, octadecamethyl, cyclononasiloxane, octadecamethyl, octadecanoic acid and n-hexadecanoic acid etc.

In xylene degrading bacteria, metabolic intermediates of earlier documented pathways., i.e., xylene degradation via benzoate formation and anaerobic oxidation pathway, were identified. Like, methylbenzyl alcohol, methyl benzaldehyde, methyl benzoate, 1,2-dihydroxy-methyl-cyclohexa-3,5-diene carboxylate, p-methylbenzyl alcohol, p-toluic acid, p-tolualdehyde, 4-methylcatechol, 4-methylcyclohexa-3,5-dion-1,2-diol-carboxylic acid, 3-methyl-cis, cis-muconate, 4-methyl muconolactone, 3-methylmuconolactone, 4-methyl-3-oxoadipate, oleic acid, 1,3,5-cycloheptatriene, cis-vaccenic acid, n-hexadecanoic acid, toluene, bis(2-ethylhexyl) phthalate, cis-octadecenoic acid, octadecenoic acid, glycerol 1-palmitate, hexadecanoic acid, 2-hydroxy-1(hydroxymethyl) ethyl ester, octadecenoic acid, 2,3-dihydroxypropyl ester, octadecenoic acid, 2,3-dihydroxypropyl ester, octadecenoic acid, 2-hydroxy-1-(hydroxymethyl)ethyl ester, glycerol 1-palmitate, 7-chloro-1,3,4,10-tetrahydro-1-[[3-[[2-hydroethyl]amino]propylimino]-3-[4-(trifluromethyl)phenyl], ethanone, 2-(2-benzothiazolylthio)-1-(3,5-dimethylpyrazolyl), N-(3-methoxyphenyl)-4-piperidinamine-N′-trimethylsily, 1,2-cyclohexanedicarboxylic acid, methoxyacetic acid, heptadecyl ester, tributyl-octadecyl-stannane, 7-chloro-3-[2,4-dichlorophenyl]-3,4-dihydro-10-hydroxy-1,9(2H,10H)-acridinedione, 1-(N,N-dimethyl) hydrazone, 1,2-cyclohexanedicarboxylic acid, heptyl nonyl ester, 1,3-benzenedicarboxylic acid, bis(2-ethylhexyl) ester, beta-alanine, N-(1-naphthoyl)-decyl ester, 2-bromo-4,5-dimethoxycinnamic acid, 2-(pyridin-2-ylformamido)acetic acid, 2TMS, 9-iodo-8-methyl-3-oxo-2-oxabicyclo(4.4.0) dec-4-ene-6,8-carbolactone, 1H-imidazole-2-methanol, 1-decyl, 2-bromo-4,5-dimethoxycinnamic acid, 2-methyl-7-phenylindole, 2-Bromo-4,5-dimethoxycinnamic acid, and 4,4′-Methylenedi-2,6-xylenol, bis(tert-butyldimethylsilyl) ether.

Next generation sequencing. Quality control analysis of a sample

The quality control analysis of the sample was performed by the 260/280 ratio and agarose gel electrophoresis. The 260/280 ratio was estimated as 1.338. DNA sample resolved on agarose gel is shown in Fig. S1.

Raw data statistics

In the present study, 14,782,932 reads were produced in the bacterial DNA sample, and total read bases were 2.2 GBp. The GC, AT, Q20, and Q30 contents were estimated as 54.9, 45.1, 93.9, and 86.2 (Table SI and Fig. 1).

Fig. 1.

Total bases, GC and AT contents, and Q20 and Q30 ratios of total reads calculated during WGS analysis.

QUAST quality assessment parameters calculated by metaSPAdes program

The QUAST quality parameters and their values calculated via metaSPAdes program are shown in detail in Table II.

Taxonomic profiling

Assigning taxonomic labels to metagenomic contigs showed that 75% of contigs belonged to the genus Bacillus, 13–15% to genus Pseudomonas and 3–5% to genus to Ochrobactrum. Moreover, 49% of sequences matched with B. cereus, 20% with B. thuringiensis, 13% with Pseudomonas stutzeri, and 3% with Ochrobactrum anthropi (and 8% unclassified sequences) (Fig. 2).

Fig. 2.

Krona image of taxonomic assignments to metagenomic contigs by Kraken.

Functional annotation of aromatic compounds degrading genes

Gene annotation by the Prokka program revealed 4,992 metagenomic contigs with 27,559,880 bases and 27,021 protein-coding regions. Functional annotation of benzene and xylene degradation genes retrieved from the KEGG database is described in Table III. The genes were found to involve in xylene, benzene, toluene, benzoate, aminobenzoate, and fluorobenzoate.

Among the total genes identified in the current bacterial community, a maximum number of genes were identified to be associated with benzoate and xylene metabolism. i.e., 28 and 14%, respectively. Followed this, genes found were associated with metabolism of xenobiotics by cytochrome P450 (6%), aminobenzoate (6%), chloroalkane and chloroalkene (6%), styrene (6%), dioxin (6%), caprolactum (5%), fluorobenzoate (4%), toluene (4%), steroid (4%), chlorocyclohexane and chlorobenzene (3%), atrazine (3%), naphthalene (3%) and polycyclic aromatic hydrocarbon (2%) (Fig. 3). Stoichiometry of the reactions of pathways associated with the degradation of benzene, o-, m-, p-xylene and toluene is given in detail in Table I.

Fig. 3.

Pathways associated with aromatic compound metabolism, with their respective abundances, explored in a bacterial consortium using whole genome sequencing.

BD – benzoate degradation, ABD – aminobenzoate degradation, FBD – fluorobenzoate degradation, CLAD – chloroalkane and chloroalkene degradation, CLHD – chlorocyclohexane and chlorobenzene degradation, TD – toluene degradation, XD – xylene degradation, SD – styrene degradation, AD – atrazine degradation, CD – caprolactam degradation, DD – dioxin degradation, ND – naphthalene degradation, PAHD – polycyclic aromatic hydrocarbon degradation, SD – steroid degradation, MP450 – metabolism of xenobiotics by cytochrome P450

Table I

Stoichiometry of reactions involved in benzene, xylene and toluene degradation identified in the current study bacteria based on WGS.

No. of reactionStoichiometry of reactions
ReactantsProducts
Benzene degradation pathway
IC6H6 + H2 + CO2 benzeneC7H8O + [O-]benzyl alcohol
IIC7H8OC7H6O + H2benzaldehyde
IIIC7H6O + [O-]C7H6O2benzoate
IVC7H6O2 + [O-] + H2OC7H8O4cis-1,2-dihydroxycyclohexa-3,5-diene-1-carboxylate
VC7H8O4C6H6O2catechol
VIC6H6O2 + 2 [H+]C6H5O4- + 3 [H+]cis, cis-muconate
VIIC6H5O4-C6H6O4muconolactone
VIIIC6H6O4C6H5O4+ [H+]3-oxoadipate enol lactone
IXC6H5O4C6H5O52-3-oxoadipate
XC6H5O52- + [H+] + C21H36N7O16P3SC27H42N7O20P3S + [O]3-oxoadipyl-CoA
XIC27H42N7O20P3S + 5H2OC23H38N7O17P3S + 4CO2+ 7H2Oacetyl-CoA
p-Xylene degradation pathway
IC8H10 + [O-] p-xyleneC8H10O4-methylbenzyl alcohol
IIC8H10O + CO2C9H10O2 + [O-]p-methylbenzoate
IIIC9H10O2 + 2O2C8H9O4 + CO2 + [H+]cis-1-2-dihydroxy-4-methylcyclohexa-3,5-diene-1-carboxylate
IVC8H9O4C7H8O2 + CO2 + [H+]4-methylcatechol
VC7H8O2 + O2C7H8O42-hydroxyl-5-methyl-cis, cis-muconic semialdehyde
VIC7H8O4 + [O]C7H8O52-hydroxyl-5-methyl-cis, cis-muconate
VIIC7H8O5C7H8O52-oxo-5-methyl-cis-muconate
VIIIC7H8O5C6H8O3 + CO22-hydroxyl-cis-hexa-2,4-dienoate
IXC6H8O3 + H2OC6H10O44-hydroxyl-2-oxohexanoate
XC6H10O4 + 2O2 + H2O3CO2+ C3H3O3- + H2Opyruvate
m-Xylene degradation pathway
IC8H10+ [O] m-xyleneC8H10O3-methylbenzyl alcohol
IIC8H10OC8H8O + H23-methylbenzaldehyde
IIIC8H8O + CO2+ H2C9H10O2 + H2Om-methylbenzoate
IVC9H10O2 + CO2C8H8O4 + H21,2-dihydroxy-3-methylcyclohexa-3,5-dienecarboxylate
o-Xylene degradation pathway
IC8H10 + [O-] o-xyleneC8H10O2-methylbenzyl alcohol
IIC8H10OC8H8O + H22-methylbenzaldehyde
IIIC8H8O + CO2 + H2C9H10O2 + [O]o-methylbenzoate
IVC9H10O + CO2C8H10O41,2-dihydroxy-6-methylcyclohexa-3,5-dienecarboxylate
VC8H10O4C7H8O2 + CO2 + H23-methylcatechol
VIC7H8O2 + O2C7H8O4cis, cis-2-hydroxyl-6-oxohept-2,4-dienoate
VIIC7H8O4 + [O-]C5H6O3 + 2CO2 + H2cis-2-hydroxy penta-2,4-dienoate
VIIIC5H6O3 + H2OC5H7O4- + [H+]4-hydroxyl-2-oxopentanoate
IXC5H7O4- + [O-]C3H3O3- + 2CO2 + 2H2 pyruvate
Toluene degradation pathway
IC6H5CH3 + [O] tolueneC6H5CH2OHbenzyl alcohol
IIC6H5CH2OH benzyl alcoholC6H5CHO + H2benzaldehyde
IIIC6H5CHO + [O] benzaldehydeC7H5O2 + [H]benzoate
Table II

Statistics of contigs produced by the metaSPAdes program.

No.Quast quality parametersStatistics (bp)
1Contigs > 10,000 bp4,992
2Contigs ≥ 5,000 bp940
3Contigs ≥ 10,000 bp431
4Contigs ≥ 25,000 bp169
5Contigs ≥ 50,000 bp76
6Largest contig469,435
7Total length30,570,959
8Total length ≥ 1,000 bp27,559,880
9Total length ≥ 5,000 bp19,294,370
10Total length ≥ 10,000 bp15,759,083
11Total length ≥ 25,000 bp11,859,173
12Total length ≥ 50,000 bp8,511,336
13N5010,938
Table III

Functional annotation of genes associated with aromatic compound degradation via the KEGG database.

No.Associated biochemical pathwayGenes identified
1Xylene degradation pathwaytoluene methyl-monooxygenase [EC:1.14.15.26],aryl-alcohol dehydrogenase [EC:1.1.1.90],benzaldehyde dehydrogenase (NAD) [EC:1.2.1.28],benzoate/toluate 1,2-dioxygenase subunit α [EC:1.14.12.-],dihydroxycyclohexadiene carboxylate dehydrogenase [EC:1.3.1.-, 1.3.1.67, 1.3.1.68],catechol 2,3-dioxygenase [EC:1.13.11.2],2-hydroxymuconate-semialdehyde hydrolase [EC:3.7.1.9],2-oxopent-4-enoate/cis-2-oxohex-4-enoate hydratase [EC:4.2.1.80, 4.2.1.132],4-hydroxy-2-oxovalerate/4-hydroxy-2-oxohexanoate aldolase [EC:4.1.3.39 4.1.3.43],acetaldehyde/propanal dehydrogenase [EC:1.2.1.10, 1.2.1.87],aminomuconate-semialdehyde/2-hydroxymuconate-6-semialdehydedehydrogenase [EC:1.2.1.32 1.2.1.85],4-oxalocrotonate tautomerase [EC:5.3.2.6],2-oxo-3-hexenedioate decarboxylase [EC:4.1.1.77],2-keto-4-pentenoate hydratase [EC:4.2.1.80],4-hydroxy 2-oxovalerate aldolase [EC:4.1.3.39],acetaldehyde dehydrogenase [EC:1.2.1.10]
2Toluene degradation pathwaytoluene methyl-monooxygenase [EC:1.14.15.26],aryl-alcohol dehydrogenase [EC:1.1.1.90],benzaldehyde dehydrogenase (NAD) [EC:1.2.1.28]
3Benzenebenzoate/toluate 1,2-dioxygenase subunit alpha [EC:1.14.12.10], dihydroxycyclohexadiene carboxylate dehydrogenase [EC:1.3.1.25],catechol 1,2-dioxygenase [EC:1.13.11.1],muconate cycloisomerase [EC:5.5.1.1],muconolactone D-isomerase [EC:5.3.3.4],3-oxoadipate enol-lactonase [EC:3.1.1.24],3-oxoadipate CoA-transferase, alpha subunit [EC:2.8.3.6],acetyl-CoA acyltransferase [EC:2.3.1.16],3-oxoadipyl-CoA thiolase [EC:2.3.1.174],catechol 2,3-dioxygenase [EC:1.13.11.2],2-hydroxymuconate-semialdehyde hydrolase [EC:3.7.1.9],2-keto-4-pentenoate hydratase [EC:4.2.1.80],4-hydroxy 2-oxovalerate aldolase [EC:4.1.3.39],acetaldehyde dehydrogenase [EC:1.2.1.10],protocatechuate 3,4-dioxygenase, alpha subunit [EC:1.13.11.3],3-carboxy-cis, cis-muconate cycloisomerase [EC:5.5.1.2],4-carboxymuconolactone decarboxylase [EC:4.1.1.44],3-hydroxybenzoate 6-monooxygenase [EC:1.14.13.24]
3Aminobenzoate degradation pathwaybenzaldehyde dehydrogenase (NAD) [EC:1.2.1.28],amidase [EC:3.5.1.4],4-hydroxybenzoate decarboxylase subunit C [EC:4.1.1.61]
4Fluorobenzoate degradation pathwaybenzoate/toluate 1,2-dioxygenase subunit alpha [EC:1.14.12.10],dihydroxycyclohexadiene carboxylate dehydrogenase [EC:1.3.1.25],catechol 1,2-dioxygenase [EC:1.13.11.1],muconate cycloisomerase [EC:5.5.1.1]
Discussion

WGS strategies are proving a source of insights into the biodegradation capabilities of bacteria (Oyewusi et al. 2021). It decodes both the uncultivable and cultivable microbes. The current study attempts to decode the underlying benzene and xylene-metabolizing genes and pathways of cultivable bacterial species. Ten out of eleven bacteria analyzed belonged to the genus Bacillus.

Taxonomic profiling revealed 49% B. cereus species and 20% B. thuringiensis. This is a validation of our previously performed 16S rRNA sequencing according to which most of the bacterial community was comprised of Bacillus species. This finding is also consistent with earlier literature reporting different species of the genus Bacillus as associated with benzene and xylene metabolism. i.e., B. thuringiensis, B. cereus, Bacillus amyloliquefaciens, Bacillus infantis, Bacillus pumilus (Dou et al. 2010; Undugoda et al. 2018; Wongbunmak et al. 2020; Kesavan et al. 2021; Kaur et al. 2023; 2025; Wu et al. 2023; Jin et al. 2025;). Our findings are not in line with some of the literature because species belonging to Pseudomonas, Sphingobium, Azoarcus, Cupriavidus, Hydrogenophaga, and Rhodococcus, have also been documented as benzene and xylene metabolizing bacteria (Lee et al. 2012; You et al. 2018; Devanadera et al. 2019; Lopez et al. 2022; Sathesh-Prabu et al. 2023). All of these bacteria except Rhodococcus are Gram-negative while those documented in current study are Gram-positive. According to literature, as compared to Gram-positive bacteria, Gram-negative bacteria exhibit greater efficiency of benzene and xylene metabolism (Mazzeo et al. 2010; Chicca et al. 2020; Bacosa et al. 2021). Dominance of Gram-positive isolates in the current project is justified as per the literature finding that Gram-positive bacteria dominate tannery industry soils due to their high adaptability to the heavy metals and organic compounds found in tannery waste (Albokari et al. 2018; Oruko et al. 2019; Abate et al. 2021). This adaptability is contributed by thick cell walls containing peptidoglycan.

WGS analysis revealed the enzymes involved in o-, m- and p-xylene catabolism, 3-aminobenzenesulfonate, toluene and 2-, 3- and 4-fluorobenzoate. Based on the identification of enzymes, the xylene degradation pathways suggested in a bacterial sample of the current study are shown in Fig. 4.

Fig. 4.

Reconstruction of ortho, meta and para-xylene degradation pathways based on whole genome shotgun functional annotation.

The o-xylene degradation pathway starts with its oxidation into 2-methylbenzyl alcohol in the presence of toluene methylmonooxygenase, which is oxidized by arylalcohol dehydrogenase into 2-methylbenzaldehyde. After this, 2-methylbenzaldehyde is oxidized in the presence of benzaldehyde dehydrogenase into o-methylbenzoate, which is transformed into 1,2-dihydroxy-6-methylcyclohexa-3,5-dienecarboxylate by benzoate 1,2-dioxygenase subunit alpha.

Following this, 3-methylcatechol is produced, which is oxidized into cis, cis-2-hydroxyl-6-oxohept-2,4-dienoate in the presence of catechol 2,3-dioxygenase. The cis-2-hydroxyl-6-oxohept-2,4-dienoate is then converted into cis-2-hydroxypenta-2,4-dienoate, which is acted upon by enzyme 2-oxopent-4-enoate hydratase, and 4-hydroxy-2-oxopentanoate is produced. This compound is then transformed into pyruvate and acetaldehyde in 4-hydroxyl-2-oxovalerate aldolase. Pyruvate enters glycolysis, and acetaldehyde is oxidized into acetyl-CoA by acetaldehyde dehydrogenase. Acetyl-CoA then enters the Krebs cycle. Enzymes involved in all these steps were identified in the current study.

The m-xylene degradation pathway comprises the initial oxidation of m-xylene into 3-methylbenzyl alcohol by the enzyme toluene methyl monooxygenase. It is followed by forming 3-methyl benzaldehyde in the presence of aryl-alcohol dehydrogenase, benzoate 1,2-dioxygenase subunit alpha. Then, benzaldehyde dehydrogenase oxidizes 3-methyl benzaldehyde into m-methyl benzoate, which is further oxidized into 1,2-dihydroxy-3-methylcyclohexa-3,5-dienecarboxylate by benzoate 1,2-dioxygenase subunit alpha, which is then transformed into 3-methylcatechol in the presence of dihydroxycyclohexadiene carboxylate dehydrogenase. Further degradation of 3-methylcatechol follows the exact mechanism as documented in o-xylene. All enzymes of this pathway were identified in the current study bacterial sample.

During degradation of p-xylene, it is first oxidized into 4-methylbenzyl alcohol by toluene methyl monooxygenase.

Following this, benzaldehyde dehydrogenase performs oxidation and forms p-methylbenzoate, which is transformed into cis-1,2-dihydroxy-4-methylcyclohexa-3,5-diene-1-carboxylate in the presence of benzoate/toluate 1,2-dioxygenase subunit alpha. Afterwards, dihydroxy cyclohexadiene carboxylate dehydrogenase catalyzes the formation of 4-methylcatechol, which is acted upon by catechol 2,3-dioxygenase and 2-hydroxyl-5-methyl-cis, cis-muconic semialdehyde is formed. In a subsequent step, 2-hydroxyl-5-methyl-cis, cis-muconic semialdehyde is transformed into 2-hydroxyl-5-methyl-cis, cis-muconate in the presence of hydroxymuconate 6-semialdehyde dehydrogenase. Following this, tautomerization by 4-oxalocrotonate tautomerase results in the formation of 2-oxo-5-methyl cis-muconate. This is decarboxylated by 2-oxo-3-hexenedioate decarboxylase into 2-hydroxyl-cis-hexa-2,4-dienoate. Following this, cis-2-oxohexa-4-enoate hydratase catalyzes the formation of 4-hydroxyl-2-oxohexanoate, which is then converted into pyruvate and propanol in the presence of enzyme 4-hydroxyl-2-oxohexanoate aldolase. Pyruvate enters the Krebs cycle, and propanol enters propanoate metabolism through conversion into propanoyl-CoA in the presence of propanol dehydrogenase. All the enzymes of this pathway except hydroxymuconate-6-semialdehyde dehydrogenase, 4-oxalocrotonate tautomerase, cis-2-oxohexa-4-enoate hydratase, and 4-hydroxyl-2-oxohexanoate aldolase were identified in the current study bacterial DNA sample. These pathways of xylene degradation are consistent with earlier reported pathways in BTEX-degrading B. amyloliquefaciens subsp. plantarum W1 (Lee et al. 2019; Wongbunmak et al. 2020).

Pathways identified in the current bacteria involved in benzene, 3-aminobenzene sulfonate, toluene, and 2-, 3-, and 4-fluorobenzoate are shown in Fig. 5. In benzene degradation pathways, benzene is first converted into benzyl alcohol by benzyl alcohol dehydrogenase. Then, benzyl alcohol is converted into benzaldehyde, which is transformed into benzoate by benzaldehyde dehydrogenase. Benzoate is oxidized by benzoate/toluate 1,2-dioxygenase subunit alpha into cis-1,2-dihydroxycyclohexa-3,5-diene-1-carboxylate, which is transformed into catechol in the presence of dihydroxycyclohexadiene carboxylate dehydrogenase. Catechol is oxidized into cis, cis-muconate by catechol 1,2-dioxygenase. The cis, cis-muconate is isomerized into muconolactone by muconate cycloisomerase. This is followed by forming 3-oxoadipate-enol lactone in the presence of muconolactone D-isomerase. Afterwards, 3-oxoadipate enol lactonase catalyzes the formation of 3-oxoadipate, which is then transformed into 3-oxoadipyl-CoA in the presence of enzyme 3-oxoadipate CoA-transferase alpha subunit. The 3-oxoadipyl-CoA is then converted into acetyl-CoA and succinyl-CoA by acetyl-CoA acyltransferase and 3-oxoadipyl-CoA thiolase, respectively. Succinyl-CoA then enters the Krebs cycle. All the enzymes of this pathway, except benzylalcohol dehydrogenase and benzaldehyde dehydrogenase, were identified in the current study. This pathway has been documented in literature in Burkholderia sp. strain NK8 (Francisco et al. 2001).

Fig. 5.

Reconstruction of benzene, 3-aminobenzene sulfonate, toluene and 2-, 3- and 4-fluorobenzoate degradation pathways based on whole genome shotgun functional annotation.

During degradation of 3-aminobenzene sulfonate, it is first converted into 3-sulfocatechol in the presence of 2-aminobenzene sulfonate 2,3-dioxygenase. Following this, oxidation occurs by catechol 2,3-dioxygenase and 2-hydroxymuconate is formed. Then, 2-hydroxymuconate tautomerizes into gamma-oxalocrotonate by 2-hydroxymuconate tautomerase. Afterwards, decarboxylation occurs in the presence of 2-oxo-3-hexenedioate decarboxylase, and 2-oxopent-4-enoate is formed, which undergoes hydration to form 4-hydroxy-2-oxopentanoate. The hydration reaction is catalyzed by 2-keto-4-pentenoate hydratase. The 4-hydroxy-2-oxopentanoate is further cleaved into acetaldehyde and pyruvate in 4-hydroxyl-2-oxovalerate aldolase. All the enzymes involved in this pathway, except 2-aminobenzene sulfonate 2,3-dioxygenase, 2-hydroxymuconate tautomerase, and 2-oxo-3-hexenedioate decarboxylase, were identified in the current bacteria.

During toluene degradation, it is initially oxidized by toluene methyl monooxygenase into benzyl alcohol, which is then oxidized into benzaldehyde in the presence of arylalcohol dehydrogenase. Following this, benzaldehyde is converted into benzoate by benzaldehyde dehydrogenase. All three enzymes involved in these steps were identified in the bacteria in the current study. This pathway is consistent with earlier reported toluene degradation pathways in BTEX-degrading B. amyloliquefaciens subsp. plantarum W1 (Lee et al. 2019; Wongbunmak et al. 2020).

Enzyme benzoate 1,2-dioxygenase subunit alpha that catalyzes the transformation of 2-, 3-, and 4-fluorobenzoate into 6-, 3-, 5-, and 4-fluorocyclohexadiene-cis, cis-1,2-diol-1-carboxylate, respectively, has been identified in the current study bacteria. Among these compounds, 6- and 3-fluorocyclohexadiene-cis, cis-1,2-diol-1-carboxylate are converted into 3-fluorocatechol by enoate reductase and dihydroxycyclohexadiene carboxylate dehydrogenase, respectively. On the other hand, 5- and 4-fluorocyclohexadiene-cis, cis-1,2-diol-1-carboxylate are transformed into 4-fluorocatechol in the presence of dihydroxycyclohexadiene carboxylate dehydrogenase. Then, 3- and 4-fluorocatechols are converted into 2- and 3-fluoro-cis, cis-muconate by enzyme catechol 1,2-dioxygenase. All the enzymes of these pathways except enoate reductase were identified in the current study. These pathways are consistent with the literature and have been documented in Sphingomonas sp. HB-1 and in a microbial sample comprising Marinobacter, Vibrio natriegens, Gramella sp., and Methyloceanibacter (Hidde Boersma et al. 2004; Kannan et al. 2023).

In addition to enzymes associated with the above pathways, some additional enzymes were also identified in bacteria, including amidase, 3-hydroxybenzoate monooxygenase, 4-hydroxybenzoate decarboxylase subunit c, 3-carboxy-cis, cis-muconate cycloisomerase, procatechuate-3,4-dioxygenase alpha subunit, 2-hydroxymuconate-6-semialdehyde dehydrogenase, 2-keto-4-pentenoate hydratase, and 4-carboxymuconolactone decarboxylase. Reactions catalyzed by these bacteria are shown in Fig. 6.

Fig. 6.

Reactions of benzene and xylene metabolism catalyzed by bacterial enzymes identified in the current study using whole genome shotgun functional annotation.

Enzymes identified in the current study are in accordance with previous literature, as a study focused on WGS of twenty-six different strains of bacteria reported the enzymes associated with benzene, xylene, benzoate, naphthalene, and toluene (Révész et al. 2020; Eze 2021; Bedics et al. 2022; Hossain et al. 2024). Another study reported xylene degrading enzyme catechol 2,3-dioxygenase in a Pseudomonas strain (Miri et al. 2022).

The current project documenting the Gram-positive hydrocarbonoclastic Bacillus bacteria is a novel addition to the current state of knowledge because the benzene degradation pathway identified in current study have been reported in Gram-negative bacteria in literature but not in any Gram-positive Bacilli except B. cereus which was isolated from petroleum contaminated soil (Hussain et al. 2025). Fluorobenzoate degradation pathways identified in the current bacteria have never been documented in any Gram-positive bacteria. However, they are reported in Gram-negative isolates. Toluene and xylene degrading bacteria documented in the current study have been identified earlier either in Gram-negative bacteria or in B. amyloliquefaciens subsp. plantarum W1 (Wongbunmak et al. 2020). No other Bacillus species have been reported to exhibit this xylene degradation pathway. However, the toluene degradation pathway is also reported in another Bacillus. i.e., B. pumilus MVSV3 (Surendra et al. 2017).

In addition, these isolates exhibit the coexistence of metabolic pathways for diverse substrates. i.e., benzene, toluene, o-, m- and p-xylene, 3-aminobenzene-sulfonate and 2-, 3- and 4-fluorobenzoates.

Despite these facts, current data have significance because they document Gram-positive bacteria, which can be more potent bioremediating agents than previously reported Gram-negative bacteria. Due to the unique characteristics of Gram-positive bacterial cell walls, including the absence of an outer membrane, they have a greater tendency to uptake organic pollutants and bind with and accumulate heavy metals from external sources (Liaqat and Sabri 2008). These features render them more potent bioremediation candidates than Gram-negative bacteria (Ganesh and Lin 2009; Nanda et al. 2019). In Gram-negative bacteria, efflux pumps are present, which confer them tolerance against various pollutants like organic solvents, heavy metals, dyes, and antibiotics. Hence, they contribute to the survivability of bacteria in the highly polluted environment. According to the literature, the efflux pumps contribute to the bioremediation potentials of bacteria by allowing them to persist in contaminated environments (Blair et al. 2014).

However, bioremediation is considered an eco-friendly mode of pollutant degradation. A bacterium possessing pumps that confer antibiotics and other multi-drug resistance can be a source of spread of multi-drug resistance (MDR) (Cunningham et al. 2020). According to this fact, we cannot use such bacteria as whole cells for eco-friendly bioremediation. Hence, Gram-positive bacteria can be more potent and sustainable bioremediating agents because they can accumulate large concentrations of pollutants in their cells and have the least chance of developing MDR due to the absence of efflux pumps (Biswas et al. 2021).

DOI: https://doi.org/10.33073/pjm-2025-020 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 244 - 261
Submitted on: Apr 7, 2025
Accepted on: May 11, 2025
Published on: Jun 18, 2025
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2025 FATIMA MUCCEE, FARHAN MOHIUDDIN, AANSA SHAHAB, ALI ALMAJWAL, TAYYABA AFSAR, HOUDA AMOR, SUHAIL RAZAK, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.