Table I
Distribution of resistance genes Pseudomonas aeruginosa.
| Gene | Target | Amplicon size | Primer Sequences (5’ to 3’) | Prevalence |
|---|---|---|---|---|
| blaCXT-M | Beta lactamase resistance gene (CTX-M) | 550 bp | F: CGCTTTGCGATGTGCAG R: ACCGCGATATCGTTGGT | 10/26 (38.4%) |
| blaSHV | Beta lactamase resistance gene (SHV) | 800 bp | F: TTATCTCCCTGTTAGCCACC R: GATTTGCTGATTTCGCTCGG | 3/26 (11.5%) |
| blaACC-1 | Bet lactamase resistance gene (ACC-1) | 873 bp | F: CACCGAAGCCGTTAGTTGAT R: GACACCGTTGATGACCTGAT | 3/26 (11.5%) |
| qnrB | Quinolone resistance gene | 469 bp | F:GATCGTGAAAGCCAGAAAGG R: ACGATGCCTGGTAGTTGTCC | 3/26 (11.5%) |
Fig. 1.
PCR confirmation of Pseudomonas species.
The 16S rRNA gene amplification product of 670 bp specific for Pseudomonas species and a 956 bp product for P. aeruginosa were run on 1% DNA agarose gel using 1.2 kbp DNA ladder.
Fig. 2.
The rate of antibiotic resistance in 26 Pseudomonas aeruginosa isolates.
Fig. 3.
The distribution of Pseudomonas aeruginosa isolates across surface types in five hospitals. Colors denote different surfaces sampled, with total swab counts displayed above each bar.