Have a personal or library account? Click to login
Distribution and Molecular Characterization of Antibiotic-Resistant Pseudomonas aeruginosa in Hospital Settings of Sulaymaniyah, Iraq Cover

Distribution and Molecular Characterization of Antibiotic-Resistant Pseudomonas aeruginosa in Hospital Settings of Sulaymaniyah, Iraq

Open Access
|Oct 2024

Figures & Tables

Fig. 1.

PCR confirmation of Pseudomonas species.
The 16S rRNA gene amplification product of 670 bp specific for Pseudomonas species and a 956 bp product for P. aeruginosa were run on 1% DNA agarose gel using 1.2 kbp DNA ladder.
PCR confirmation of Pseudomonas species. The 16S rRNA gene amplification product of 670 bp specific for Pseudomonas species and a 956 bp product for P. aeruginosa were run on 1% DNA agarose gel using 1.2 kbp DNA ladder.

Fig. 2.

The rate of antibiotic resistance in 26 Pseudomonas aeruginosa isolates.
The rate of antibiotic resistance in 26 Pseudomonas aeruginosa isolates.

Fig. 3.

The distribution of Pseudomonas aeruginosa isolates across surface types in five hospitals. Colors denote different surfaces sampled, with total swab counts displayed above each bar.
The distribution of Pseudomonas aeruginosa isolates across surface types in five hospitals. Colors denote different surfaces sampled, with total swab counts displayed above each bar.

Distribution of resistance genes Pseudomonas aeruginosa_

GeneTargetAmplicon sizePrimer Sequences (5’ to 3’)Prevalence
blaCXT-MBeta lactamase resistance gene (CTX-M)550 bpF: CGCTTTGCGATGTGCAGR: ACCGCGATATCGTTGGT10/26 (38.4%)
blaSHVBeta lactamase resistance gene (SHV)800 bpF: TTATCTCCCTGTTAGCCACCR: GATTTGCTGATTTCGCTCGG3/26 (11.5%)
blaACC-1Bet lactamase resistance gene (ACC-1)873 bpF: CACCGAAGCCGTTAGTTGATR: GACACCGTTGATGACCTGAT3/26 (11.5%)
qnrBQuinolone resistance gene469 bpF:GATCGTGAAAGCCAGAAAGG R: ACGATGCCTGGTAGTTGTCC3/26 (11.5%)
DOI: https://doi.org/10.33073/pjm-2024-037 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 467 - 473
Submitted on: Jul 6, 2024
|
Accepted on: Sep 8, 2024
|
Published on: Oct 28, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2024 Seenaa Muhammed Ali, Taib Ahmed Hama Soor, Gashin Awat Ahmed, Glena Aziz Mhdin, Gulabakh Ali Othman, Sarkhel Mhamad Faiq, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.