Skip to main content
Have a personal or library account? Click to login
Establishment of a Nucleic Acid Detection Method for Norovirus GII.2 Genotype Based on RT-RPA and CRISPR/Cas12a-LFS Cover

Establishment of a Nucleic Acid Detection Method for Norovirus GII.2 Genotype Based on RT-RPA and CRISPR/Cas12a-LFS

Open Access
|Jun 2024

Figures & Tables

Fig. 1.

Screening of the optimal primer pair for RT-RPA for detection of norovirus GII.2. a) The amplification efficiency of RT-RPA with various primer combinations was assessed using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer combinations was evaluated using LFS, driven by the cleavage activity mediated by the complex of Cas12a and the target amplified product. M – DL2000 marker; F1R1 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R1; F1R2 – primer pairs of NoV-GII.2-F1/NoV-GII.2-R2; F2R1 – Primer pairs of NoV-GII.2-F2/NoV-GII.2-R1; F2R2 – primer pairs of NoV-GII.2-F2/NoV-GII.2-R2; F12R12 – primer pairs of NoV-GII.2-F1/NoV-GII.2-F2 and NoV-GII.2-R1/NoV-GII.2-R2; NC – negative control. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 2.

Screening of the optimal concentration of the primer pair for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different primer concentrations was examined using gel electrophoresis; b) the amplification efficiency of RT-RPA with various primer concentrations was assessed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 3.

Screening of the optimal reaction time of RT-RPA for RT-RPA-Cas12a-LFS to detect norovirus GII.2. a) The amplification efficiency of RT-RPA with different reaction times was determined using gel electrophoresis; b) The amplification efficiency of RT-RPA with different reaction times was analyzed using LFS, facilitated by the cleavage activity mediated by the complex of Cas12a and the target amplified product. In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 4.

The specificity analysis of RT-RPA-Cas12a-LFS with various viral genome samples was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 5.

The sensitivity analysis of RT-RPA-Cas12a-LFS for detection of norovirus GII.2. The sensitivity analysis of RT-RPA-Cas12a-LFS with various concentrations of standard RNA was assessed using gel electrophoresis (a) and LFS (b). In the context of LFS, T denotes the testing line, while C represents the quality control line.

Fig. 6.

The specificity and sensitivity analysis of qRT-PCR for detection of norovirus GII.2. The specificity analysis of qRT-PCR was conducted with various viral genome samples (a), while the sensitivity analysis of qRT-PCR was performed with different concentrations of standard RNA (b), and the results were evaluated based on the fluorescence curve. NoV – norovirus GII.2 subtype, RV – human rotavirus, AdV – adenovirus, AstV – astrovirus, CV – coxsackievirus, SaV – sapovirus, BoV – bocavirus, NC – ddH2O.

Fig. 7.

The performance analysis of RT-RPA-Cas12a-LFS for detecting norovirus GII.2, compared with qRT-PCR, was evaluated using simulated clinical samples. 30 representative results out of 60 samples are displayed.

Statistical analysis of simulated samples using both the RT-RPA-Cas12a-LFS and qRT-PCR methods_

qRT-PCRCR
PositiveNegativeTotal
RT-RPA-Cas12a-LFSPositive3803898.33%
Negative12122
Total392160

The oligonucleotide sequences for the primer, crRNA, and ssDNA reporter_

Name Sequence (5’-3’)NoV-GII.2-F1 AGGTGCYAATGCAATAAATCAGAGGGCAGA
NoV-GII.2-F2CAATGGGCTYAGTTCAYTRATYAATGCAGG
NoV-GII.2-R1CACCTCTGGCTGCATCAGCRGGGGAAAAGC
NoV-GII.2-R2TGTTTTATAGCCATCATRTCTGCCTGCAGC
Pre-NoV-GII.2-crRNA-FGAAATTAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATAATCATGATAAGGAGATGTT
Pre-NoV-GII.2-crRNA-RAACATCTCCTTATCATGATTATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC
ssDNA reporter6-FAM-TTATTATT-Biotin
NoV-GII.2-qPCR-FGAGGGCAGAATTTGATTTTAATC
NoV-GII.2-qPCR-RCCTTGTTTTATAGCCATCATG
NoV-GII.2-qPCR-PFAM-TTGCCTGAATCTGAGCCTGC-BHQ1
DOI: https://doi.org/10.33073/pjm-2024-023 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 253 - 262
Submitted on: Mar 9, 2024
Accepted on: May 9, 2024
Published on: Jun 20, 2024
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2024 Ting Wang, Hao Zeng, Jie Kang, Lanlan Lei, Jing Liu, Yuhong Zheng, Weidong Qian, Cheng Fan, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.