Comparative Transcriptome Analysis Reveals the Molecular Mechanisms of Acetic Acid Reduction by Adding NaHSO3 in Actinobacillus succinogenes GXAS137

Shiyong Li; Chaodong Song; Hongyan Zhang; Yan Qin; Mingguo Jiang; Naikun Shen

doi:10.33073/pjm-2023-036

Figures & Tables

Analysis of fermentation products.
A) The comparison of metabolites was determined by HPLC in the experimental group (EG) and control check (CK); 1 – pyruvic acid, 2 – lactic acid, 3 – acetic acid, 4 – pyruvate dimer, 5 – unknown, 6 – citric acid, 7 – succinic acid B) The concentration of organic acid and biomass of EG and CK. Each value is the mean for three replicates, with vertical bars indicating standard errors. The lower-case letters at each time point indicate a significant difference at p ≤ 0.05 by Duncans multiple range tests. — Analysis of fermentation products. A) The comparison of metabolites was determined by HPLC in the experimental group (EG) and control check (CK); 1 – pyruvic acid, 2 – lactic acid, 3 – acetic acid, 4 – pyruvate dimer, 5 – unknown, 6 – citric acid, 7 – succinic acid B) The concentration of organic acid and biomass of EG and CK. Each value is the mean for three replicates, with vertical bars indicating standard errors. The lower-case letters at each time point indicate a significant difference at p ≤ 0.05 by Duncans multiple range tests.

Scatter plot of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment for DEGs between CK and EG. Rich factor refers to the ratio of the number of genes annotated to the pathway in the DEGs to the total number of genes located at the pathway among all annotated.

Relative expression levels of 12 DEGs when a reference gene 16S rDNA was used for normalization.
Different lowercase letters in the table show significant differences (p < 0.05). — Relative expression levels of 12 DEGs when a reference gene 16S rDNA was used for normalization. Different lowercase letters in the table show significant differences (p < 0.05).

Metabolism map of the central metabolic pathway of A. succinogenes, the green arrow represents the C3 pathway. All green arrows represent the C3 pathway, and the green dotted line represents pathway disruption.
Metabolites: G-6-P – glucose-6-phosphate, F-6-P – fructose-6-phosphate, G-3-P – glyceraldehyde-3-phosphate, Glycerate-3-P – glycerate-3-phosphate, Glycerate-2-P – glycerate-2-phosphate, PEP – phosphoenolpyruvate, OAA – oxaloacetic acid, Mal – malic acid, Fum – fumaric acid, SA – succinic acid, Pyr – pyruvic acid, For – formic acid, AcCOA – acetyl-COA, AcP – acetylphosphate, AC – acetic acid, AcAld – acetaldehyde, EtOH – ethanol, BAC – bisulfite-acetaldehyde complex
Enzymes: PGAM – phosphoglycerate mutase, ENO – enolase, PEPCK – PEP carboxykinase, ASPC – aspartate aminotransferase, MDH – malate dehydrogenase, FM – fumarase, FRD – fumarate reductase, OAD – oxaloacetate decarboxylase, PK – pyruvate kinase, PDH – pyruvate dehydrogenase, PFL – pyruvate formate-lyase, FDH – formate dehydrogenase, PTA – phosphate acetyltransferase, ACK – acetate kinase, ADHE – acetaldehyde-alcohol dehydrogenase. LipB – lipoyl-transferase, LipA – lipoyl-synthase — Metabolism map of the central metabolic pathway of A. succinogenes, the green arrow represents the C3 pathway. All green arrows represent the C3 pathway, and the green dotted line represents pathway disruption. Metabolites: G-6-P – glucose-6-phosphate, F-6-P – fructose-6-phosphate, G-3-P – glyceraldehyde-3-phosphate, Glycerate-3-P – glycerate-3-phosphate, Glycerate-2-P – glycerate-2-phosphate, PEP – phosphoenolpyruvate, OAA – oxaloacetic acid, Mal – malic acid, Fum – fumaric acid, SA – succinic acid, Pyr – pyruvic acid, For – formic acid, AcCOA – acetyl-COA, AcP – acetylphosphate, AC – acetic acid, AcAld – acetaldehyde, EtOH – ethanol, BAC – bisulfite-acetaldehyde complex Enzymes: PGAM – phosphoglycerate mutase, ENO – enolase, PEPCK – PEP carboxykinase, ASPC – aspartate aminotransferase, MDH – malate dehydrogenase, FM – fumarase, FRD – fumarate reductase, OAD – oxaloacetate decarboxylase, PK – pyruvate kinase, PDH – pyruvate dehydrogenase, PFL – pyruvate formate-lyase, FDH – formate dehydrogenase, PTA – phosphate acetyltransferase, ACK – acetate kinase, ADHE – acetaldehyde-alcohol dehydrogenase. LipB – lipoyl-transferase, LipA – lipoyl-synthase

Primer sequences of differentially expressed genes in Actimobacillus succinogenes for qRT-PCR analysis_

Gene ID	Function	Primer sequence (5’ to 3’)	Product size (bp)
CBG46_04720	short-chain dehydrogenase	F: GCTAACCAAATCGCTGGCTA	173
CBG46_04720	short-chain dehydrogenase	R: GTAACTCTTCCGGTTTGCCT	173
CBG46_04260	phosphoenolpyruvate carboxykinase	F: TCGAACGCATGAAAGCCTC	188
CBG46_04260	phosphoenolpyruvate carboxykinase	R: ACCCGGTAATGCTTTAGGAA	188
CBG46_02425	bisphosphoglycerate-dependent phosphoglycerate mutase	F: TAAACCTTTTCACCGGCTGGA	183
CBG46_02425	bisphosphoglycerate-dependent phosphoglycerate mutase	R: GCACCCATAATTGGTCGGAT	183
CBG46_04200	phosphogluconate dehydrogenase (NADP⁺-dependent decarboxylating)	F: GCATCCGAGCAATTCGACT	187
CBG46_04200		R: GCCAATCCGCCATAGCATT	187
CBG46_04725	ATPase	F: TATCACTACATTGGCGGGCTA	181
CBG46_04725	ATPase	R: AATTTGATTCAGCGTCCAGT	181
CBG46_02335	bifunctional acetaldehyde-alcohol dehydrogenase	F: CCAACACGGCACATTAGCAT	191
CBG46_02335	bifunctional acetaldehyde-alcohol dehydrogenase	R: ATATCACGCCAACCGGATCG	191
CBG46_03325	L-threonine dehydrogenase	F: ATCGAAGCCTACGTATCCAC	197
CBG46_03325	L-threonine dehydrogenase	R: ATCGCATGAACATAGCCGAGA	197
CBG46_08215	ribose 5-phosphate isomerase B	F: GAGCGTGGAATTCTTACCTG	160
CBG46_08215	ribose 5-phosphate isomerase B	R: CAATCACACGCTCACCGAA	160
CBG46_05965	2-deoxyribose-5-phosphate aldolase	F: CTGCCGCGATTTAAACGTC	174
CBG46_05965	2-deoxyribose-5-phosphate aldolase	R: GCACCGGCATTAATCATTGCT	174
CBG46_07640	sulfate ABC transporter substrate-binding protein	F: ATAGCAAGATTAACGGCACCC	174
CBG46_07640	sulfate ABC transporter substrate-binding protein	R: ACTTTTCATTCACGTCGAAGG	174
CBG46_00190	sulfurtransferase TusE	F: CAACAACAGATTGAAACCGA	170
CBG46_00190	sulfurtransferase TusE	R: CCGGCGAAGTTTTGTATTCCT	170
CBG46_00510	pyruvate dehydrogenase	F: CAATCTTACGCCATGTTCGTG	191
CBG46_00510	pyruvate dehydrogenase	R: CGGCTTATCGGACATCACT	191
16S rDNA	reference genes	F: ACTGGAACTGAGACACGGT	187
16S rDNA	reference genes	R: GCTTCTTCTGTGGCTAACGTC	187

The quality control data statistic table after filtering_

Sample	Sample description	Total reads	Bases (bp)	Q20 (%)	Q30 (%)	Uniq mapped reads
CK_1	Control replication 1	31,227,958	4,230,512,865	98.43	95.28	30,230,330 (96.81%)
CK_2	Control replication 2	29,665,406	4,045,453,270	98.33	95.01	28,618,805 (96.47%)
CK_3	Control replication 3	33,864,286	4,615,803,043	98.36	95.08	32,895,101 (97.14%)
EG_1	NaHSO₃ treatment replication 1	35,209,904	4,761,438,256	98.37	95.10	33,873,034 (96.2%)
EG_2	NaHSO₃ treatment replication 2	32,640,396	4,435,226,539	98.4	95.16	31,262,811 (95.78%)
EG_3	NaHSO₃ treatment replication 3	35,564,774	4,849,551,152	98.33	95.00	34,078,998 (95.82%)

Comparative Transcriptome Analysis Reveals the Molecular Mechanisms of Acetic Acid Reduction by Adding NaHSO3 in Actinobacillus succinogenes GXAS137

Figures & Tables

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Primer sequences of differentially expressed genes in Actimobacillus succinogenes for qRT-PCR analysis_

The quality control data statistic table after filtering_

Paradigm

My account