Skip to main content
Have a personal or library account? Click to login
Comparative Transcriptome Analysis Reveals the Molecular Mechanisms of Acetic Acid Reduction by Adding NaHSO3 in Actinobacillus succinogenes GXAS137 Cover

Comparative Transcriptome Analysis Reveals the Molecular Mechanisms of Acetic Acid Reduction by Adding NaHSO3 in Actinobacillus succinogenes GXAS137

Open Access
|Dec 2023

Full Article

Introduction

Succinic acid (SA) is a high-value-added bulk chemical widely used in many fields (Jansen and van Gulik 2014; Ferone et al. 2019). At a compound annual growth rate (CAGR) of 27.4%, the global market for SA is expected to reach 1.8 billion USD by 2025 (Chiang et al. 2021). Owing to the aggravation of environmental pollution and the depletion of petrochemical resources, the microbial fermentation of bio-SA has attracted considerable interest (Shen et al. 2018). Actinobacillus succinogenes is one of the most promising strains for SA production due to its advantages of utilizing renewable resources, high production and tolerance concentrations of SA, and fixation of CO2 (Dessie et al. 2018; Omwene et al. 2021). However, the fermentation process produces many by-products, especially acetic acid (AC), which accounts for about one-third of SA, increases the cost of separation and purification of downstream processing, and inhibits the large-scale development of bio-SA (Shen et al. 2014; Almqvist et al. 2016).

Methods for reducing by-products have two main parts: the metabolic modification of genetic engineering and the regulation of the fermentation process (Ahn et al. 2016; Guarnieri et al. 2017). However, due to the lack of adequate genetic modification tools, there are still many challenges to increasing SA production and decreasing by-products through metabolic engineering (Dessie et al. 2018). The synthesis of SA and byproducts in A. succinogenes can be significantly affected by added growth factors and fermentation conditions, such as the addition of neutral red to the medium, change in redox potential, and presence of gaseous CO2 (McKinlay and Vieille 2008; Tan et al. 2018). NaHSO3 is used as a chemical steering agent in glycerol production by Saccharomyces cerevisiae. NaHSO3 forms a complex with acetaldehyde and hinders the reduction of acetaldehyde as an electron acceptor into ethanol, leading to the excessive accumulation of NDAH produced together with acetaldehyde (Freeman and Donald 1957; Taherzadeh et al. 2002). To maintain the redox balance in S. cerevisiae, dihydroxyacetone phosphate acts as an electron acceptor and promotes the reoxidation of NADH (Taherzadeh et al. 1996). In previous experiments, we had shown that NaHSO3 can significantly reduce AC production. However, the reduction mechanism needs clarification, and no related literature exists.

Transcriptomics is a powerful means of studying metabolic pathways, changes, and interaction rules of gene expression information at specific times or environmental states and revealing particular genes’ regulatory mechanisms and networks (Li et al. 2022; Tong et al. 2022). In recent years, RNA-seq is a transcriptome analysis technique commonly used to explore microorganisms’ tolerance mechanism and analyze differentially expressed genes (DEGs) in transcriptomes (Mo et al. 2019). Zhang et al. (2020) revealed the lysozyme tolerance mechanism of Dermacoccus abyssi through RNA-seq, and their results showed that the tolerance mechanism of the strain is related to the gene expression of glutathione biosynthesis and metabolism, ion transport, energy metabolism pathway, and peptidoglycan synthesis. The metabolic rule of Ethanoligenens harbinense in ethanol-type fermentation of anaerobic acidogenesis at different pH was studied by RNA-seq, and the results showed that low initial pH resulted in down-regulated expression of genes related to cell growth and acidification. In contrast, high initial pH resulted in down-regulated expression of genes to H2 evolution and acidification (Li et al. 2020). Komagataeibacter europaeus CGMCC 20445, as the target strain, conducted transcriptome analysis under different acidities during AC fermentation. The results showed that the acid resistance mechanism of K. europaeus CGMCC 20445 was related to the expression of genes related to pentose phosphate, butyrate metabolism, tricarboxylic acid cycle, oxidative phosphorylation, and fatty acid biosynthesis pathways (Wang et al. 2021). The whole-genome sequencing of A. succinogenes GXAS137 has been obtained by Illumina technology and uploaded to Genbank under the accession number NHRD00000000.1 (Zhang et al. 2018). The present study explored the complex mechanisms by which NaHSO3 reduces AC formation based on gene expression changes revealed using the Illumina RNA-seq technology. Function analysis was performed on the DEGs, and the main response mechanism was revealed through enrichment analysis. This study examined the possible mechanism of NaHSO3 in reducing AC on the transcriptome level, broadened the understanding of the physiological and metabolic regulation of A. succinogenes, and provided theoretical guidance for new by-product steering agents.

Experimental

Materials and Methods

Strain and culture conditions

A. succinogenes GXAS137 (China Center for Type Culture Collection accession no. CCTCCM 2011399) is isolated from the bovine rumen, which was preserved in 20% (v/v) glycerol tubes at –80°C in our laboratory (Shen et al. 2016). The strain was inoculated into the seed medium and incubated at 37°C for 20 h to prepare the seed culture; then, the solution of the seed culture was fed into a 100 ml anaerobic flask containing 40 ml fermentation medium at 5% (v/v) inoculum, fermentation was carried out at 37°C for 60 h. The seed medium (per liter) contained 30 g glucose, 10 g yeast extract, 5 g corn steep liquor powder, 2 g NaHCO3, 2 g NaCl, 8.5 g NaH2PO4, and 15.5 g K2HPO4. And the fermentation medium (per liter) contained 60 g glucose, 5 g yeast extract, 10 g corn steep liquor powder, 2 g NaHCO3, 1 g MgCl2 · 6H2O, 0.3 g CaCl2, 0.06 g MnCl2, 0.06 g ZnSO4, 60 g MgCO3. During the fermentation process, MgCO3 was used to replace gaseous CO2 as the sole CO2 donor required for the fermentation of SA.

Adding NaHSO3 decreases acetic acid generation during SA fermentation of A. succinogenes GXAS137

After the strain was cultured in a fermentation medium for 8h, 0.15% (w/v) sterilized NaHSO3 was added (experimental group, EG) or sterilized water was used to replace NaHSO3 (CK), and the content of the metabolites was measured after 60 h. All experiments were done in triplicates.

Determination of organic acid content

Samples were collected after 10 min of centrifugalization at 12,000 rpm. Organic acids (SA, AC, lactic acid, pyruvic acid) and other products in EG and CK were determined by high-performance liquid chromatography (HPLC; Shanghai Wufeng Scientific Instrument Co., Ltd. China) using an Ultimate® LP-C18 ion-chromatography column (Welchmat, China) and an Ultraviolet light detector (Shen et al. 2023). The mobile phase is a 0.05 M Na2HPO4 solution (adjust pH to 1.8 with phosphoric acid) with a flow rate of 1.0 ml/min, the injection volume was 20 μl, and the column temperature is 22°C. The UV detection was performed at 210 nm.

Transcriptomic analysis

Cells in the EG and CK groups after 20 h of fermentation were collected. The total RNA of EG and CK was extracted by TRIzol™ reagent (Invitrogen™, USA), and genomic DNA was removed using DNase I (Takara Biomedical Technology (Beijing) Co., Ltd., China). Majorbio (Shanghai Majorbio Bio-Pharm Technology Co., Ltd., China) accomplished Illumina library construction and sequencing. The process can be briefly outlined as follows: (i) Ribosomal RNA is removed and all mRNA is broken into 200 nt fragments; (ii) Double-stranded cDNA was synthesized; (iii) The synthesized cDNA was subjected to end-repair, phosphorylation, and ‘A’ base addition according to Illumina’s library construction protocol; (iv) A 200 bp cDNA fragment was selected for PCR amplification; (v) Sequencing was performed using the Illumina® NovaSeq™ (Illumina, Inc., USA). All raw data for RNA-seq was uploaded to the National Centre for Biotechnology Information (NCBI) (Accession number: PRJNA901132). Fastp (https://github.com/Open-Gene/fastp) (Chen et al. 2018; Chen 2023) was used to remove low-quality data from the raw data to get clean data. GO pathway enrichment analysis was performed using Goatools software (https://github.com/tanghaibao/GOatools) (Klopfenstein et al. 2018), and KEGG pathway enrichment analysis was performed using KOBAS (http://kobas.cbi.pku.edu.cn/home.do) (Bu et al. 2021) using Fisher’s exact test. p-Values were corrected using four multiple tests (Bonferroni, Holm, BH, and BY), and the gene was considered to be differentially expressed genes (DEGs) when FDR ≤ 0.05.

Quantitative PCR

To verify the reliability of DEGs from the transcriptome sequencing of A. succinogenes GXAS137, 12 genes for qRT-PCR validation with the 16S rRNA as the internal reference gene were selected. Primer Premier 5.0 (Premier Biosoft International, USA) was used to design the primers of 12 selected DEGs (Table I). The RNA samples were reverse-transcribed using StarScript II First-strand cDNA synthesis kit-II. (GenStar, China). Quantitative PCR was performed using BlasTaq™ 2X qPCR MasterMix (Applied Biological Materials Inc., Canada) on a LightCycler® 96 System (Roche, Switzerland). The reaction system consisted of cDNA 1 μl, 10 μM forward PCR primer 0.5 μl, 10 μM reverse PCR primer 0.5 μl, BlasTaq™ 2X qPCR MM1 10 μl, nuclease-free H2O 8 μl, totaling 20 μl. The PCR program was as follows: 95°C for 180 s, 40 cycles of (95°C for 15 s, 60°C for 1 min). A dissolution curve was then generated. The qPCR for each gene was repeated three times, and the average (Ct) was calculated. The relative expression level of each gene was calculated using the 2-ΔΔCt method (Arocho et al. 2006).

Table I

Primer sequences of differentially expressed genes in Actimobacillus succinogenes for qRT-PCR analysis.

Gene IDFunctionPrimer sequence (5’ to 3’)Product size (bp)
CBG46_04720short-chain dehydrogenaseF: GCTAACCAAATCGCTGGCTA173
R: GTAACTCTTCCGGTTTGCCT
CBG46_04260phosphoenolpyruvate carboxykinaseF: TCGAACGCATGAAAGCCTC188
R: ACCCGGTAATGCTTTAGGAA
CBG46_02425bisphosphoglycerate-dependent phosphoglycerate mutaseF: TAAACCTTTTCACCGGCTGGA183
R: GCACCCATAATTGGTCGGAT
CBG46_04200phosphogluconate dehydrogenase (NADP+-dependent decarboxylating)F: GCATCCGAGCAATTCGACT187
R: GCCAATCCGCCATAGCATT
CBG46_04725ATPaseF: TATCACTACATTGGCGGGCTA181
R: AATTTGATTCAGCGTCCAGT
CBG46_02335bifunctional acetaldehyde-alcohol dehydrogenaseF: CCAACACGGCACATTAGCAT191
R: ATATCACGCCAACCGGATCG
CBG46_03325L-threonine dehydrogenaseF: ATCGAAGCCTACGTATCCAC197
R: ATCGCATGAACATAGCCGAGA
CBG46_08215ribose 5-phosphate isomerase BF: GAGCGTGGAATTCTTACCTG160
R: CAATCACACGCTCACCGAA
CBG46_059652-deoxyribose-5-phosphate aldolaseF: CTGCCGCGATTTAAACGTC174
R: GCACCGGCATTAATCATTGCT
CBG46_07640sulfate ABC transporter substrate-binding proteinF: ATAGCAAGATTAACGGCACCC174
R: ACTTTTCATTCACGTCGAAGG
CBG46_00190sulfurtransferase TusEF: CAACAACAGATTGAAACCGA170
R: CCGGCGAAGTTTTGTATTCCT
CBG46_00510pyruvate dehydrogenaseF: CAATCTTACGCCATGTTCGTG191
R: CGGCTTATCGGACATCACT
16S rDNAreference genesF: ACTGGAACTGAGACACGGT187
R: GCTTCTTCTGTGGCTAACGTC

Results and Discussion

Effect of NaHSO3 treatment on reducing the AC content of A. succinogenes GXAS137 during SA fermentation

As shown in Fig. 1, the concentration of AC in EG was 5.48 g/l, which was 25.03% lower than that in CK (7.31 g/l), indicating that the production of AC as a by-product can be significantly decreased after the addition of NaHSO3. However, no significant changes in SA concentration and biomass were observed, indicating that the reduction of AC content after NaHSO3 treatment may have been caused by the AC synthesis pathway and the decreased carbon flow was not directed to the SA synthesis pathway but used in another metabolic process. Moreover, the content of pyruvic acid and pyruvate dimer increased significantly, and the content of pyruvic acid in EG reached 6.97 g/l, which was 34.04% higher than that in CK (5.20 g/l). The increase in pyruvic acid content may be due to the obstruction of the synthesis pathway from pyruvic acid to AC and the subsequent accumulation of carbon flow at pyruvic acid, so the pyruvate dimer content also increased. No significant change in the content of lactic acid was observed. No study on lactic acid production through fermentation by A. succinogenes using glucose as a substrate has been published (Almqvist et al. 2016). By measuring the lactic acid content in the medium before fermentation, a previous study found that it might have come from corn-steep liquor powder. Furthermore, the levels of formic acid and ethanol were not detected in the fermentation broth.

Fig. 1.

Analysis of fermentation products.

A) The comparison of metabolites was determined by HPLC in the experimental group (EG) and control check (CK); 1 – pyruvic acid, 2 – lactic acid, 3 – acetic acid, 4 – pyruvate dimer, 5 – unknown, 6 – citric acid, 7 – succinic acid B) The concentration of organic acid and biomass of EG and CK. Each value is the mean for three replicates, with vertical bars indicating standard errors. The lower-case letters at each time point indicate a significant difference at p ≤ 0.05 by Duncans multiple range tests.

Quality control of sequencing data

Six cDNA libraries constructed through RNA-seq with the Illumina HiSeq platform generated 199.12 million raw reads in double terminal sequencing. A total of 198.17 million clean reads were obtained, and Q20 and Q30 of the base ratio were above 98% and 95%, respectively, showing that the quality and quantity of RNA-seq were high, which provided reliable data for subsequent analysis. The ratio of reads unique mapping to the reference genome was from 95.78% to 97.14% (Table II).

Table II

The quality control data statistic table after filtering.

SampleSample descriptionTotal readsBases (bp)Q20 (%)Q30 (%)Uniq mapped reads
CK_1Control replication 131,227,9584,230,512,86598.4395.2830,230,330 (96.81%)
CK_2Control replication 229,665,4064,045,453,27098.3395.0128,618,805 (96.47%)
CK_3Control replication 333,864,2864,615,803,04398.3695.0832,895,101 (97.14%)
EG_1NaHSO3 treatment replication 135,209,9044,761,438,25698.3795.1033,873,034 (96.2%)
EG_2NaHSO3 treatment replication 232,640,3964,435,226,53998.495.1631,262,811 (95.78%)
EG_3NaHSO3 treatment replication 335,564,7744,849,551,15298.3395.0034,078,998 (95.82%)

Differentially expressed genes response to NaHSO3 treatment

The gene expression distribution showed that the number of genes in EG was higher than that in CK when the gene expression value log10(TPM + 1) was between 2.16 and 2.53 (Fig. S1A). Meanwhile, the correlation coefficient in the three duplicates of EG and CK was above 0.99 (Fig. S1B), and the expression patterns in EG and CK were similar, indicating that the repeatability between samples was excellent. A Venn diagram showed that 2,127 genes were expressed in the EG and CK: 2108 mRNA and 19 sRNA (Fig. S1C).

DESeq2 software (https://bioconductor.org/packages/release/bioc/html/DESeq2.html) (Love et al. 2014) based on the negative binomial distribution was used in selecting significant differentially expressed genes (DEGs) according to specific filter criteria (padj < 0.05 and |log2FC| ≥ 1). A total of 210 DEGs were obtained (83 were up-regulated and 127 were down-regulated; Table SI). According to the Log2FC value, the top 20 up-regulated and 20 down-regulated genes were selected in the DEGs (Table SII). The up-regulated genes included transporters, dehydrogenases, and a variety of enzymes. Three genes were NAD(P)+-dependent dehydrogenases (CBG46_04720, CBG46_06280, and CBG46_03465), which play essential roles in cell NADH regeneration. Two kinds of sugar phosphotransferase system (PTS) transporter genes (CBG46_00530 and CBG46_03170) and maltose ATP-binding cassette (ABC) transporter gene were up-regulated (log2FC ≥ 1.5), which are conducive to the absorption of carbohydrates. ATPase (CBG46_04725) was highly up-regulated (log2FC = 2.46), which is important to the synthesis of ATP in organisms. The down-regulated genes mainly included the hypothetical proteins of unknown function, transporters with different functions, sulphate adenylyltransferase, octanoyl transferase, and various enzymes. For of the genes were sulphate ABC transporters genes (CBG46_07625, CBG46_07630, CBG46_07635, and CBG46_07640) that affect the sulphate intake of bacteria and may account for the tolerance of the thallus to NaHSO3. The gene (CBG46_01765) encoding octanoyl transferase, a key enzyme in lipoic acid synthesis, was significantly down-regulated (log2FC = −2.54). The down-regulated expression of this gene is not conducive to the lipoylation of enzyme proteins in organisms, such as the E2 subunit of the pyruvate dehydrogenase complex.

Functional annotation of DEGs in A. succinogenes

The biological significance of the DEGs were examined through gene annotation with the gene ontology (GO) database (http://www.geneontology.org) (Ashburner et al. 2000; Gene Ontology Consortium et al. 2023). The identification results were divided into three parts: cellular component (CC), molecular function (MF), and biological process (BP). We annotated 169 DEGs to GO terms in the GO database (66 up-DEGs and 103 down-DEGs). Fig. S2 shows that 14 GO terms were significantly enriched 120 DEGs after NaHSO3 treatment. BP enriched 70 DEGs, of which ‘carbohydrate metabolic process’, ‘carbohydrate transport’ and ‘one-carbon metabolic process’ terms indicated that NaHSO3 treatment was closely related to carbon conversion and utilization, also including sulphur metabolism and oxidationreduction process. CC enriched eight DEGs, which were related to the membrane protein complex. MF enriched 42 DEGs, mainly on transmembrane transporter activity, carbohydrate binding, and transferase activity.

The cluster of orthologous groups of proteins (COG) database (http://eggnog.embl.de) (Hernández-Plaza et al. 2023) is a widely recognized tool used for protein function and evolutionary analysis of gene production. Fig. S3 shows that 203 DEGs annotated by COG were allocated to 17 functional categories. ‘Function unknown’ was the most frequently annotated, and 23.15% (47 genes) DEGs were annotated into this functional category. ‘Carbohydrate transport and metabolism’ was the second most commonly annotated, accounting for 21.67% (44 genes) of the DEGs. ‘Inorganic ion transport and metabolism’ was the third frequently annotated functional category, accounting for 10.84% (22 genes). ‘Amino acid transport and metabolism’ was the fourth frequently annotated functional, with 9.34% (19 genes). Moreover, multiple function categories were enriched with more than six DEGs.

Kyoto Encyclopedia of Genes and Genomes (KEGG) is a knowledge base for the systematic analysis of gene function and the linkage between genomic information and functional information. Using the KEGG database, genes in the DEGs can be classified according to the pathway or process they participate in. KEGG enrichment results showed that 94 DEGs were enriched into 86 different pathways. The 20 most significant KEGG pathways (the lowest corrected p-value) for enrichment are displayed in Fig. 2. ‘ABC transporters’ was the pathway term with the most DEGs and the most significantly enriched. Genes involved in ‘sulphate metabolism’ (which is associated with sulfate transporters, assimilatory sulfite reductase, and sulfate adenylyltransferase) were down-regulated, indicating that the strain responded to NaHSO3 stress by inhibiting the expression of genes related to the sulphate intake pathway and reducing the entry of NaHSO3 into cells. Genes involved in ‘phosphotransferase system (PTS)’ (which is associated with mannose-specific PTS proteins ManXYZ), ‘citrate cycle’ (which is associated with phosphoenolpyruvate carboxykinase and malate dehydrogenase), ‘pyruvate metabolism’ (which associated to bifunctional acetaldehyde-alcohol dehydrogenase), ‘alanine, aspartate and glutamate metabolism’ (which is associated with glutamate dehydrogenase, aspartate aminotransferase and aspartate ammonia ligase) and ‘glycolysis’ were up-regulated (which is associated with phosphoglycerate mutase and enolase) were up-regulated.

Fig. 2.

Scatter plot of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment for DEGs between CK and EG. Rich factor refers to the ratio of the number of genes annotated to the pathway in the DEGs to the total number of genes located at the pathway among all annotated.

The expression profiles of 34 DEGs in differential transcription levels involved in ABC transporters and phosphotransferase system (PTS) pathway in EG were compared with those in CK (p < 0.01). According to gene annotation and KEGG orthology (KO) (Kanehisa and Goto 2000; Kanehisa 2019, Kanehisa et al. 2023), the transcription levels of CBG46_07640, CBG46_07635, CBG46_07630, CBG46_07625 involved in ABC transporter pathway decreased by –5.51, –5.07, –4.56 and –4.19 log2FC, respectively, which encoded the four substrate-binding proteins (P, U, W, A) of sulphate/ thiosulphate transport system. Depending on the genes enriched in the ABC transporter pathway, EG slowed the intake of NaHSO3 and improved the resistance of the bacteria to NaHSO3. The transcription levels of six genes (CBG46_00240, CBG46_03905, CBG46_00540, CBG46_03900, CBG46_00530, CBG46_03910) involved in the phosphotransferase system (PTS) pathway increased by 1.03, 1.35, 1.78, 1.36, 1.15 and 1.40 log2FC, respectively, which encoded phosphocarrier protein HPr and the three subunits (EIIC, EIID and EIIA) of PTS mannose transporter. Depending on whether these genes were enriched in the phosphotransferase system (PTS) pathway, EG promoted the uptake of glucose, which is beneficial to growth and energy metabolism, by the thallus.

Carbon and amino acids play important roles in biological processes, and carbon metabolism is also a pathway of SA and AC production. Therefore, the expression levels of carbon metabolism and biosynthesis of amino acid genes in A. succinogenes were analyzed. Based on Pfam’s annotation, the expression level of 34 genes involved in carbon and amino acid metabolism significantly differed between EG and CK. The transcription levels of CBG46_02425 and CBG46_05785 involved in the glycolysis/gluconeogenesis pathway increased by 1.06 and 1.04 log2FC, respectively. The CBG46_02425 and CBG46_05785 encode 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase (EC.5.4.2.11) and enolase (EC.4.2.1.11), respectively. Depending on whether these genes were enriched in the glycolysis pathway, EG converted glucose into phosphoenolpyruvate (PEP), which is an important intermediate used in producing SA and AC. The transcription levels of CBG46_04260 and CBG46_08055 involved in the citrate cycle pathway increased by 1.06 and 1.20 log2FC, respectively. The CBG46_04260 and CBG46_08055 encode phosphoenolpyruvate carboxykinase (EC.4.1.1.49) and malate dehydrogenase (EC.1.1.1.37), respectively. Depending on whether these genes were enriched in the citrate cycle pathway, carbon flux was conducive to the SA synthesis pathway in EG and increased the yield of SA. The transcription level of CBG46_02335 involved in pyruvate metabolism increased by 1.41 log2FC and encoded acetaldehyde-alcohol dehydrogenase (EC.1.2.1.10). Depending on whether this gene was enriched in pyruvate metabolism, acetyl-coenzyme A (acetyl-CoA) was catalyzed to ethanol via an acetaldehyde intermediate. Still, the intermediate acetaldehyde reacted with NaHSO3 to form a complex that blocked the formation of ethanol. This effect facilitated the consumption of acetyl-CoA and led to a reduction in AC production. The transcription levels of three genes (CBG46_08245, CBG46_02820 and CBG46_03465) involved in amino acid metabolism (such as cysteine and methionine metabolism, tyrosine metabolism, alanine and aspartate and glutamate metabolism) increased by 2.20, 1.51 and 1.59 log2FC, respectively, which encoded aspartate aminotransferase (EC.2.6.1.1), aspartateammonia ligase (EC.6.3.1.1) and glutamate dehydrogenase (EC1.4.1.2), respectively. Depending on whether these genes were enriched in the amino acid metabolism pathway, EG promoted the production of L-asparagine, which is potentially conducive to the growth of bacteria and the synthesis of proteins.

Validation of RNA-Seq sequencing

A total of 12 DEGs for RT-qPCR were involved in carbohydrate transport and metabolism, energy production and conversion, inorganic ion transport, and metabolism and nucleotide transport and metabolism of A. succinogenes GXAS137. The results were consistent with the RNA-seq data, indicating the transcriptome analysis’s reliability (Fig. 3).

Fig. 3.

Relative expression levels of 12 DEGs when a reference gene 16S rDNA was used for normalization.

Different lowercase letters in the table show significant differences (p < 0.05).

The possible mechanism of NaHSO3 reducing AC, a by-product of A. succinogenes, based on transcriptomics analysis

The results of HPLC showed that after NaHSO3 treatment, AC content significantly decreased, pyruvic acid content significantly increased, and SA content had no significant change. These results indicated that NaHSO3 affected the metabolic process of A. succinogenes, causing the carbon flow originally directed to AC to accumulate at pyruvic acid. The genes involved in the reduction in AC mechanism were explored using Illumina RNA-seq data from the strain grown in a fermentation medium with or without 0.15% (w/v) NaHSO3. From six sequenced RNA libraries, 210 DEGs were identified: 83 were up-regulated and 127 down-regulated. Through the functional enrichment analysis of GO, COG, and KEGG, DEGs’ role and response mechanism can be understood. These genes were mainly involved in carbohydrate, inorganic ion, amino acid transport, metabolism, and energy production and conversion and had strong responses to NaHSO3 treatment.

In the carbohydrate metabolic pathway of A. succinogenes, PEP was produced by glucose through glycolysis and the oxidative pentose phosphate pathway (OPPP). PEP is considered a critical branch point to the C3 (formate-, acetate-, and ethanol-producing) and C4 pathways (SA-producing) (McKinlay et al. 2007; Nag et al. 2018). As shown in Fig. 4, after NaHSO3 treatment, multiple coding genes in glycolysis were up-regulated. The transcription levels of phosphoglycerate mutase (CBG46_02425, log2FC = 1.06) and enolase (CBG46_05785, log2FC = 1.04) were significantly up-regulated, which mainly catalyzed the synthesis of glycerate-3-phosphate to glycerate-2-phosphate and glycerate-2-phosphate to PEP, respectively. The up-regulated expression of these genes was more conducive to the generation of PEP. In the C4 pathway, SA synthesis consists of one CO2 fixation step and two reduction steps. PEP carboxykinase (PEPCK) is a key enzyme in SA synthesis. Oxaloacetate (OAA) was synthesized from PEP with CO2 under the catalysis of PEP carboxykinase (McKinlay and Vieille 2008). The genes of PEPCK (CBG46_04260, log2FC = 1.06) and malate dehydrogenase (CBG46_08055, log2FC = 1.20) were significantly up-regulated, which are beneficial to the synthesis of SA. However, no significant increase in the production of SA was found in EG compared with CK. The possible reason is the significant up-regulation of the gene encoding aspartate aminotransferase (CBG46_08245, log2FC = 2.20) and the utilization of OAA to synthesize aspartic acid. In the C3 pathway, the gene of pyruvate kinase (CBG46_10295, log2FC = −0.35) was down-regulated but not significantly. The up-regulation of oxaloacetate decarboxylase (CBG46_03825, CBG46_03830, CBG46_03835) can promote the pyruvate production from OAA.

Fig. 4.

Metabolism map of the central metabolic pathway of A. succinogenes, the green arrow represents the C3 pathway. All green arrows represent the C3 pathway, and the green dotted line represents pathway disruption.

Metabolites: G-6-P – glucose-6-phosphate, F-6-P – fructose-6-phosphate, G-3-P – glyceraldehyde-3-phosphate, Glycerate-3-P – glycerate-3-phosphate, Glycerate-2-P – glycerate-2-phosphate, PEP – phosphoenolpyruvate, OAA – oxaloacetic acid, Mal – malic acid, Fum – fumaric acid, SA – succinic acid, Pyr – pyruvic acid, For – formic acid, AcCOA – acetyl-COA, AcP – acetylphosphate, AC – acetic acid, AcAld – acetaldehyde, EtOH – ethanol, BAC – bisulfite-acetaldehyde complex

Enzymes: PGAM – phosphoglycerate mutase, ENO – enolase, PEPCK – PEP carboxykinase, ASPC – aspartate aminotransferase, MDH – malate dehydrogenase, FM – fumarase, FRD – fumarate reductase, OAD – oxaloacetate decarboxylase, PK – pyruvate kinase, PDH – pyruvate dehydrogenase, PFL – pyruvate formate-lyase, FDH – formate dehydrogenase, PTA – phosphate acetyltransferase, ACK – acetate kinase, ADHE – acetaldehyde-alcohol dehydrogenase. LipB – lipoyl-transferase, LipA – lipoyl-synthase

In A. succinogenes, pyruvate dehydrogenase complex (PDHc) and pyruvate formate-lyase (PFL) were the two enzymes that convert pyruvate to acetyl-CoA (Joshi et al. 2014; Pateraki et al. 2021). The structure of PDHc consists of three enzymes (E1, E2, and E3), and the E1 and E3 are flexibly tethered to the E2 core at a distance of 11 nm (Murphy and Jensen 2005). The process of PDHc catalyzing pyruvate to produce acetyl-CoA could be divided into three steps. First, under the catalysis of E1 part, pyruvate was converted into CO2, and the remaining hydroxyethyl was transferred to thiamine pyrophosphate, which was bound with the enzyme. Then, the acetyl group was transferred to COA in E2 to form acetyl-CoA. Finally, E3 oxidized the remaining dihydrolipoate to form NADH (Eikmanns and Blombach 2014; Patel et al. 2014; Škerlová et al. 2021). As a cofactor, lipoic acid catalyzes the production and transfer of acetyl groups. A deficiency in lipoic acid seriously inhibits the activity of the complex. Lipoic acid biosynthesis has two pathways: the branch of fatty acid synthesis and de novo lipoic acid synthesis (Danson et al. 1981; Mayr et al. 2014). The de novo lipoic acid synthesis is based on octyl-ACP as substrate, synthesizes lipoic acid and completes thioctyl modification. LipB and LipA are the key enzymes in this process (Solmonson and DeBerardinis 2018). Catalyzed by LipB, an octyl group is transferred to the lipoic acid domain of the α-ketoate dehydrogenase E2 subunit. Then LipA is catalysed by the linking of two sulphur atoms between the 6 and 8 carbon atoms of the octyl group. Finally, a sulphur-octyl protein subunit is formed (Christensen and Cronan 2010). The transcription levels of LipB (CBG46_01765, log2FC = −2.54) and LipA (CBG46_01760, log2FC = -2.22) were significantly down-regulated, indicating that the octyl modification of E2 protein was inhibited, the activity of PDHc was decreased and the consumption of pyruvate was decreased while acetyl-CoA content was decreased. However, the pyruvate formate-lyase gene (CBG46_04330, log2FC = 0.62) was up-regulated, and thus pyruvate was converted into acetyl-CoA. In A. succinogenes, the synthesis of AC by acetyl-CoA involves two steps. First, acetyl-CoA and phosphate are catalyzed by phosphate acetyltransferase to generate acetyl-phosphate and reduce COA. Then, acetylphosphate transfers a phosphate group to ADP under the catalysis of acetate kinase to generate AC, and ATP is generated (Bradfield and Nicol 2016; Kim et al. 2020). The transcription levels of phosphate acetyltrans ferase (CBG46_07795, log2FC = 0.73) and acetate kinase (CBG46_07800, log2FC = 0.47) were up-regulated, which facilitated the synthesis of AC. However, the results of AC content determination by HPLC showed that the AC production was significantly decreased after the addition of NaHSO3 compared with that in CK. The possible reason is the significant up-regulation of the bifunctional acetaldehyde-alcohol dehydrogenase gene (CBG46_02335, log2FC = 1.41). Acetaldehyde-alcohol dehydrogenase (AdhE) can catalyze acetyl-CoA conversion into ethanol through acetaldehyde intermediates (Leonardo et al. 1993). This enzyme has two catalytic domains: N-terminal coenzyme A-acylating acetaldehyde dehydrogenase (ALDH), which is responsible for the conversion of acetyl-CoA into acetaldehyde, and C-terminal iron-dependent alcohol dehydrogenase (ADH), which catalyzes the conversion of acetaldehyde into ethanol (Pavlova et al. 2013; Tsuji et al. 2016). The up-regulated expression of the AdhE-encoding gene can promote the conversion of acetyl-CoA into ethanol, and acetyl-CoA initially used for AC synthesis is utilized in ethanol synthesis. Thus, the content of AC decreases. The reduction of acetaldehyde to ethanol was prevented by adding NaHSO3, which reacted with acetaldehyde intermediates to form a bisulphiteacetaldehyde complex. Therefore, after the addition of NaHSO3, a part of the carbon flow decreased by AC accumulated in pyruvic acid, and the other part was directed to the bisulphite-acetaldehyde complex.

NaHSO3 controls microbial growth and prevents browning and food spoilage (Chang et al. 1997). Irwin et al. (2017) showed that when the added NaHSO3 exceeded 9.6 mmol/l, four strains of gut probiotics, including the Lactobacillus casei, Lactobacillus plantarum, Lactobacillus rhamnosus, and Streptococcus thermophilus, basically failed to grow. However, in the present study, adding 0.15% (w/v, 14.4 mmol/l) NaHSO3 did not result in a significant change in cell number (calculated according to OD600 value) after fermentation for 60 h (p > 0.05). This result indicated that A. succinogenes GXAS137 had a certain tolerance to NaHSO3. Among the COG annotation results, 22 DEGs were enriched into ion transport and metabolism (“P” category), the third most enriched category of genes. Genes related to sulphate/thiosulphate transport system protein were significantly down-regulated. This feature might be one of the reasons that A. succinogenes tolerates NaHSO3. Sulphate/thiosulphate transport system belongs to the ABC superfamily and is responsible for transporting inorganic sulphate to cells as a way for bacteria to take sulphur out of the environment (Kertesz 2001). By downregulating the expression of genes related to this system, the concentration of NaHSO3 in cells was decreased, and the damage of NaHSO3 to cells was mitigated.

In addition, this view was partially supported by the significant down-regulation of the genes associated with the assimilation sulphate reduction pathway in A. succinogenes. As critical nutrients in cell growth and metabolism, amino acids are essential to synthesizing proteins, fatty acids, nucleic acids, vitamins, and other macromolecules. An increase in amino acid content (aspartic acid, lysine, arginine, etc.) in bacteria is conducive to coping with environmental stress (acid stress, high-temperature stress) (Wang et al. 2020; Isogai and Takagi 2021). In the aspartate metabolism pathway (map00250), aspartate aminotransferase (CBG46_02820, log2FC = 2.20) and asparagine synthetase (CBG46_08245, log2FC = 1.51) were significantly up-regulated, which facilitates the synthesis of asparagine. Aspartate transaminase acts on the synthesis of L-tyrosine, L-phenylalanine and L-tryptophan. In addition, the expression of related genes in the arginine and lysine synthesis pathways was up-regulated. To resist environmental stress, microorganisms provide more energy and coenzymes for biochemical reactions by improving energy metabolism and the synthesis of important products, such as ATP, NADH and NADPH (Lu and Holmgren 2014; Brzostek et al. 2021; Zhuang et al. 2021). In the oxidative phosphorylation pathway (map00190), the expression of related genes encoding ATPase components was up-regulated but less than two times. The transcription levels of enolase and phosphoenolpyruvate carboxykinase (PEPCK) were significantly up-regulated, which promotes ATP synthesis. The pentose phosphate pathway (PPP) is the main NADPH synthesis pathway in microorganisms, providing reducing agents for various cellular synthesis reactions, such as the synthesis of fatty acids. Glucose-6-phosphate dehydrogenase (G-6-PD) and 6-phosphogluconate dehydrogenase (6-PGDH) are the rate-limiting enzymes of this pathway and key enzymes in NADPH synthesis (Mohd Kamal et al. 2022). The two genes were up-regulated, and the transcription level of 6-PGDH was more than two times, which promoted NADPH synthesis. Glutamate dehydrogenase can catalyze the conversion of glutamate to α-ketoglutaric acid and produce NADPH (Mara et al. 2018). The significantly up-regulated expression of this coding gene can promote the production of NADPH. Owing to the lack of a complete TCA cycle in the metabolism of A. succinogenes, SA was synthesized through the reduction branch of TCA, and NADH was consumed (Valadi et al. 2004). The synthesis of NADH was mainly produced by glycolysis (McKinlay et al. 2005). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a key enzyme in the glycolysis pathway and catalyzes the conversion of glyceraldehyde 3-phosphate to glycerate 1,3-diphosphate, with accompanying NADH production (Valadi et al. 2004). The gene of GAPDH (CBG46_00060, log2FC = 0.95) was up-regulated, which was beneficial for NADH formation. Pyruvate dehydrogenase can catalyze the generation of pyruvate to acetyl-CoA and produce NADH. Still, the addition of NaHSO3 blocks the synthesis of lipoic acid and thus cannot produce NADH through this pathway. Formate dehydrogenase can catalyze the conversion of formic acid to CO2 and produce NADH simultaneously (Sirover 2014)). Several genes encoding formate dehydrogenase components were significantly up-regulated, which can promote the regeneration of NADH.

Conclusions

The results of HPLC showed that the AC content of A. succinogenes was significantly decreased after the addition of NaHSO3, and the content of SA was not significantly changed. In this study, the transcriptional profiles of the strain were compared through Illumina RNA-seq to identify differentially expressed genes (DEGs). A total of 210 DEGs were identified by expression analysis: 83 and 127 genes up-regulated and downregulated, respectively, in response to NaHSO3 treatment. The functional annotation analysis of DEGs showed that the genes were mainly involved in carbohydrates, inorganic ions, amino acid transport and metabolism, and energy production and conversion. The possible mechanisms of AC reduction might be related to two aspects: (i) the lipoic acid synthesis pathway (LipA, LipB) was significantly down-regulated, which blocked the pathway catalyzed by pyruvate dehydrogenase complex to synthesize acetyl-coenzyme A (acetyl-CoA) from pyruvate; (ii) the expression level of the gene encoding bifunctional acetaldehydealcohol dehydrogenase was significantly up-regulated, and this effect facilitated the synthesis of ethanol from acetyl-CoA. However, the reaction of NaHSO3 with the intermediate metabolite acetaldehyde blocked the production of ethanol and consumed acetyl-CoA, thereby decreasing AC production. Thus, the present study revealed for the first time the mechanism by which NaHSO3 reduces AC in A. succinogenes and provides theoretical guidance for the subsequent development of novel by-product steering agents.

Acknowledgments

This research was funded by the Science and Technology Major Project of Guangxi Province (funding code: AB21196019, AB21220020), Natural Science Foundation of China (funding code: 31660022, 32060020), The Scientific Research Project for Introducing High-Level Talents of Guangxi Minzu University (funding code: 2018KJQD17), and the Innovation Group of Xiangsihu Youth Scholar of Guangxi Minzu University.

Notes

[1] Conflicts of interest Conflict of interest

The authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication.

Notes

Supplementary materials are available on the journal's website.

DOI: https://doi.org/10.33073/pjm-2023-036 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 399 - 411
Submitted on: Jul 23, 2023
Accepted on: Aug 28, 2023
Published on: Dec 16, 2023
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Shiyong Li, Chaodong Song, Hongyan Zhang, Yan Qin, Mingguo Jiang, Naikun Shen, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.