Have a personal or library account? Click to login
Cloning, Heterologous Expression, and Characterization of a Neutral Uricase from Arthrobacter sp. CSAJ-16 in Cangshan Mountain Cover

Cloning, Heterologous Expression, and Characterization of a Neutral Uricase from Arthrobacter sp. CSAJ-16 in Cangshan Mountain

Open Access
|Sep 2023

Figures & Tables

Fig. 1.

Growth and uric acid degradation curve of Arthrobacter sp. CSAJ-16.
Growth and uric acid degradation curve of Arthrobacter sp. CSAJ-16.

Fig. 2.

The phylogenetic tree of Arthrobacter sp. CSAJ-16 base on the 16S rRNA sequences.
The phylogenetic tree of Arthrobacter sp. CSAJ-16 base on the 16S rRNA sequences.

Fig. 3.

SDS-PAGE analysis of the expression of ArUOX in the recombinant strain UOX-CSAJ-16.M – Molecular weight standard, Lane 1 – crude enzyme, Lane 2 – purified ArUOX
SDS-PAGE analysis of the expression of ArUOX in the recombinant strain UOX-CSAJ-16.M – Molecular weight standard, Lane 1 – crude enzyme, Lane 2 – purified ArUOX

Fig. 4.

Effects of temperature (A) and pH (B) on the activity of ArUOX.
Effects of temperature (A) and pH (B) on the activity of ArUOX.

Fig. 5.

Effects of temperature (A) and pH (B) on the stability of ArUOX.
Effects of temperature (A) and pH (B) on the stability of ArUOX.

PCR primers_ Underlined sequences represent the homologous recombinant fragment with the pET28a(+)_

Primer typePrimer nameSequences (5′–3′)
Universal primers27FAGAGTTTGATCCTGGCTCAG
1492RGGTTACCTTGTTACGACTT
Amplification primersI1-Arthrobacter saudimassiliensis-Uox-FATGACCGCAACAGAACAGGCG
1-Arthrobacter saudimassiliensis-Uox-RTCAGCAGAACCCCGCGATGGT
2-Arthrobacter globiformis-Uox-FATGAGCAACAAGATCGTCCTCG
2-Arthrobacter globiformis-Uox-RCTAGCAGAAGCCGGCGATGC
3-Arthrobacter liuii-Uox-FATGAGCAGCAAGATCATCCT
3-Arthrobacter liuii-Uox-RTTAGCAGAAGCCGGCGATGC
4-Arthrobacter ulcerisalmonis-Uox-FATGAGCAGCAAGATCATCCTC
4-Arthrobacter ulcerisalmonis-Uox-RTCAGCAGAATCCGGCGATGC
5-Arthrobacter rhombi-Uox-FATGACTACCACCGCTTCTCAG
5-Arthrobacter rhombi-Uox-RTTAGCAGAAGCCTGCGGCAT
6-Arthrobacter crystallopoietes-Uox-FATGACCGCCACCGTGGAATC
6-Arthrobacter crystallopoietes-Uox-RGCAGAATCCGGGGATATTTG
7-Arthrobacter arilaitensis-Uox-FATGACTATCGAAACCACCGCC
7-Arthrobacter arilaitensis-Uox-RGGCAAATGCCGGGATATTGGA
8-Arthrobacter dokdonellae-Uox-FATCATCCTGGGCGCCAACC
8-Arthrobacter dokdonellae-Uox-RGCAGAAGCCTGCGACGCCG
Amplification primersIITFH-3- Arthrobacter liuii-Uox-FCAAATGGGTCGCGGATCCGAAATGAGCAGCAAGATCATCCT
TFH-3- Arthrobacter liuii-Uox-RGTGCTCGAGTGCGGCCGCAAGTTAGCAGAAGCCGGCGATGC

Effect of different ions and chemical reagents on enzyme activity_

ChemicalsFinal concentrationResidual activity (%)
Blank10 mM100.0
K+10 mM250.72 ± 2.90
Mg2+10 mM279.71 ± 3.34
Fe2+10 mM43.48 ± 0.35
Ca2+10 mM204.35 ± 4.35
Ni2+10 mM181.16 ± 2.90
Co2+10 mM17.39 ± 0.33
Ba2+10 mM256.52 ± 2.45
Mn2+10 mM23.19 ± 0.65
Pb2+10 mM256.52 ± 4.35
Zn2+10 mM0
EDTA10%26.09 ± 0.34
SDS10%0
PSMF10%53.62 ± 0.79
DOI: https://doi.org/10.33073/pjm-2023-027 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 277 - 283
Submitted on: Apr 10, 2023
|
Accepted on: Jun 9, 2023
|
Published on: Sep 20, 2023
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Xin Yan, Wei Hu, Yun-Guo Zhu, Qing-Qing Liu, Shuai Wang, Hong-Yan Liu, Dan Zhu, Zhi-Hua Lv, Lin-Hua Li, Yi-Rui Yin, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.