Table I
PCR primers. Underlined sequences represent the homologous recombinant fragment with the pET28a(+).
| Primer type | Primer name | Sequences (5′–3′) |
|---|---|---|
| Universal primers | 27F | AGAGTTTGATCCTGGCTCAG |
| 1492R | GGTTACCTTGTTACGACTT | |
| Amplification primersI | 1-Arthrobacter saudimassiliensis-Uox-F | ATGACCGCAACAGAACAGGCG |
| 1-Arthrobacter saudimassiliensis-Uox-R | TCAGCAGAACCCCGCGATGGT | |
| 2-Arthrobacter globiformis-Uox-F | ATGAGCAACAAGATCGTCCTCG | |
| 2-Arthrobacter globiformis-Uox-R | CTAGCAGAAGCCGGCGATGC | |
| 3-Arthrobacter liuii-Uox-F | ATGAGCAGCAAGATCATCCT | |
| 3-Arthrobacter liuii-Uox-R | TTAGCAGAAGCCGGCGATGC | |
| 4-Arthrobacter ulcerisalmonis-Uox-F | ATGAGCAGCAAGATCATCCTC | |
| 4-Arthrobacter ulcerisalmonis-Uox-R | TCAGCAGAATCCGGCGATGC | |
| 5-Arthrobacter rhombi-Uox-F | ATGACTACCACCGCTTCTCAG | |
| 5-Arthrobacter rhombi-Uox-R | TTAGCAGAAGCCTGCGGCAT | |
| 6-Arthrobacter crystallopoietes-Uox-F | ATGACCGCCACCGTGGAATC | |
| 6-Arthrobacter crystallopoietes-Uox-R | GCAGAATCCGGGGATATTTG | |
| 7-Arthrobacter arilaitensis-Uox-F | ATGACTATCGAAACCACCGCC | |
| 7-Arthrobacter arilaitensis-Uox-R | GGCAAATGCCGGGATATTGGA | |
| 8-Arthrobacter dokdonellae-Uox-F | ATCATCCTGGGCGCCAACC | |
| 8-Arthrobacter dokdonellae-Uox-R | GCAGAAGCCTGCGACGCCG | |
| Amplification primersII | TFH-3- Arthrobacter liuii-Uox-F | CAAATGGGTCGCGGATCCGAAATGAGCAGCAAGATCATCCT |
| TFH-3- Arthrobacter liuii-Uox-R | GTGCTCGAGTGCGGCCGCAAGTTAGCAGAAGCCGGCGATGC |
Fig. 1.
Growth and uric acid degradation curve of Arthrobacter sp. CSAJ-16.
Fig. 2.
The phylogenetic tree of Arthrobacter sp. CSAJ-16 base on the 16S rRNA sequences.
Fig. 3.
SDS-PAGE analysis of the expression of ArUOX in the recombinant strain UOX-CSAJ-16.
M – Molecular weight standard, Lane 1 – crude enzyme, Lane 2 – purified ArUOX
Fig. 4.
Effects of temperature (A) and pH (B) on the activity of ArUOX.
Fig. 5.
Effects of temperature (A) and pH (B) on the stability of ArUOX.
Table II
Effect of different ions and chemical reagents on enzyme activity.
| Chemicals | Final concentration | Residual activity (%) |
|---|---|---|
| Blank | 10 mM | 100.0 |
| K+ | 10 mM | 250.72 ± 2.90 |
| Mg2+ | 10 mM | 279.71 ± 3.34 |
| Fe2+ | 10 mM | 43.48 ± 0.35 |
| Ca2+ | 10 mM | 204.35 ± 4.35 |
| Ni2+ | 10 mM | 181.16 ± 2.90 |
| Co2+ | 10 mM | 17.39 ± 0.33 |
| Ba2+ | 10 mM | 256.52 ± 2.45 |
| Mn2+ | 10 mM | 23.19 ± 0.65 |
| Pb2+ | 10 mM | 256.52 ± 4.35 |
| Zn2+ | 10 mM | 0 |
| EDTA | 10% | 26.09 ± 0.34 |
| SDS | 10% | 0 |
| PSMF | 10% | 53.62 ± 0.79 |