Skip to main content
Have a personal or library account? Click to login
Cloning, Heterologous Expression, and Characterization of a Neutral Uricase from Arthrobacter sp. CSAJ-16 in Cangshan Mountain Cover

Cloning, Heterologous Expression, and Characterization of a Neutral Uricase from Arthrobacter sp. CSAJ-16 in Cangshan Mountain

Open Access
|Sep 2023

Full Article

Introduction

Uricase (Urate Oxidase, EC 1.7.3.4) is a crucial enzyme in the metabolism of purines in living organisms. Urate oxidase breaks down uric acid into allantoin, which is 5–10 times more soluble than uric acid and is more easily eliminated from the body (Schumacher et al. 2006). Functional genes for uricase are found in a wide range of organisms, including plants, animals, and microorganisms, such as pigs, frogs, rats, bovines, termites, and in most protozoa (Vogels and Van der Drift 1976). During the ancient ice age, about 15 million years ago, in some primates (apes), including human ancestors, uricase genes mutated into a pseudogene to build up energy in the harsh environment, causing uric acid to become the end product of purine metabolism. However, the long-term accumulation of uric acid in the blood can lead to diseases such as hyperuricemia and gout (Vogels and Van der Drift 1976; Schumacher et al. 2006; Bodofsky et al. 2020).

In recent years, the prevalence of gout has increased as people's diets have changed. Recent studies suggest that the prevalence of gout is 1–4% worldwide, with an incidence of 0.1–0.3% (Bodofsky et al. 2020; McCormick et al. 2020). The recurrent attacks of this disease can cause hypertension, hyperlipidemia, atherosclerosis, chronic kidney disease, osteoporosis, atrial fibrillation, and venous thromboembolism (Grassi et al. 2013; Singh and Gaffo 2020; Hansildaar et al. 2021). The three main drugs currently available to lower uric acid for gout treatment are xanthine oxidase inhibitors, pro-uric acid-excretory drugs, and uricase drugs (Grassi et al. 2013). Xanthine oxidase inhibitors can cause fever, drug rash, liver damage, and renal impairment in humans, and about 5% of people are intolerant to allopurinol. Uric acid-excretory drugs, which promote uric acid excretion mainly by inhibiting uric acid reabsorption in the renal tubules, are not effective in patients with moderate to severe renal function and can cause mitochondrial dysfunction and hepatotoxicity (Sherman et al. 2008; Reinders et al. 2010; Felten et al. 2020). Compared to other uric acid-lowering drugs, uricase generally presents low activity for mass production, unstable enzyme properties, and high antigenicity (Sherman et al. 2021). Therefore, searching for highly active and stable uricases has become a research hotspot.

Urate oxidase was first identified in bovine kidneys (Vogels and Van der Drift 1976). Since then, people have gradually discovered various sources of urate oxidase. As the microorganism has many species, rich resources, rapid reproduction, and vigorous metabolism (Li et al. 2006), urate oxidase extracted from the microorganism to reduce the uric acid concentration in the human body has become the leading research direction. To date, uricases have been discovered in Candida sp. (Koyama et al. 1996), Bacillus sp. (Bongaerts et al. 1978), Arthrobacter sp. (Suzuki et al. 2004), Bacillus subtilis (Khaleghi and Asad 2021), Aspergillus flavus (Li et al. 2006; Khaleghi and Asad 2021), Pseudomonas sp. (Abdel-Fattah et al. 2005), Amycolatopsis sp. (Hu et al. 2004), Rhodococcus sp. (Mcleod et al. 2006), and other microorganisms. Therefore, the use of microbial urate oxidase to reduce uric acid concentration has become a significant research area. However, due to its low yield, complex purification, and high cost, natural uricase is challenging to be produced in large quantities in the industry (Sherman et al. 2008). The heterologous expression of uricase gene in Escherichia coli or Pichia pastoris has become a hot topic.

The Cang Shan National Nature Reserve is located in the western part of Yunnan Province, China, the southern end of the Hengduan Mountains, and is situated on a low-latitude plateau with a subtropical plateau monsoon climate. Here, a uric acid degrading strain was screened from the soil of Cangshan mountain in Dali and was identified by the 16S rRNA gene sequencing. The annotated gene coded a uricase was cloned from the strain and heterologously expressed in E. coli. The enzymatic properties of the enzyme-producing strain and its functional gene were investigated to provide strain resources and enzyme reserves for developing drugs for treating hyperuricemia and gout.

Experimental

Materials and Methods

Strain, plasmid, and culture medium

E. coli DH5α was used for gene cloning, and E. coli BL21 (DE3) was used as the host for protein expression. The recombinant plasmid was constructed using the pET28a(+) vector. The primary media were uric acid basal medium, uricase-producing fermentation medium, and Luria-Bertani (LB) medium.

Sample collection and screening of the uricase-producing strain

The soil sample was collected from Cang Shan, Dali City, Yunnan Province, China (coordinates: latitude 24.95002°N, longitude 98.43729°E, altitude 2214.35 m). The strains were collected and stored in a refrigerator at 4°C. 10 g of sample was transferred to 250 ml of sterile water containing 2 g/l uric acid, shaken at 25°C, 180 r/min. After shaking for 12 h, the supernatant of the enriched samples was serially diluted (10−1, 10−2, 10−3, 10−4, and 10−5) on uric acid screening medium plates and incubated at 25°C until colonies grew.

Single colonies from the initial screening plate were repeated by plate streaking. Purified colonies were conserved and inoculated on uric acid screening medium plates to observe the hyaline circle. The ability of the strain to produce uricase was preliminarily determined based on the hyaline circle diameter ratio (hyaline circle diameter ratio = d (mm)/colony diameter D (mm)). The strain was then incubated in the uricase-producing fermentation medium. The optimal fermentation time was determined based on the growth of the strain and the amount of uric acid degradation.

Molecular identification of the strain

Single colonies were selected and placed into PCR tubes, mixed with 1 × TE buffer at 98°C for 45 min. After cooling at 12°C, the supernatant was taken as a template for the 16S rRNA gene amplification using universal primers and Taq DNA polymerase (Sangon Biotech, China). PCR parameters were pre-denaturation at 94°C for 4 min, and the main cycle: denaturation at 94°C for 30 s, annealing at 55°C for 35 s, extension at 72°C extension for 1.5 min, 32 cycles, 10 min extension at 72°C, and holding at 12°C. Colony PCR products were analyzed to determine band size by agarose gel electrophoresis, and the gel-recovered products were sent to the Tsingke Biotechnology Co. (Beijing, China) for sequencing. Sequencing results were compared by BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and submitted to GenBank (http://www.ncbi.nlm.nih.gov/genbank). The phylogenetic tree was constructed using MEGA 7 software package (Kumar et al. 2016).

Amplification of the uricase gene and construction of vector

DNA extraction kit (Sangon Biotech, China) was used to extract DNA from the screened strains. Amplification primers were designed according to GenBank's sequence of the uricase gene, as shown in Table I. The PCR amplification products were run on gel electrophoresis, and the correct bands were recovered. The recovered products were ligated to the pET28a(+) vector by double digestion (EcoR I and Hind III) using the pEASY-Uni Seamless Clone Assembly Kit (TransGen Biotech, China) to obtain the recombinant expression plasmid pET28a-UOXAJ16.

Table I

PCR primers. Underlined sequences represent the homologous recombinant fragment with the pET28a(+).

Primer typePrimer nameSequences (5′–3′)
Universal primers27FAGAGTTTGATCCTGGCTCAG
1492RGGTTACCTTGTTACGACTT
Amplification primersI1-Arthrobacter saudimassiliensis-Uox-FATGACCGCAACAGAACAGGCG
1-Arthrobacter saudimassiliensis-Uox-RTCAGCAGAACCCCGCGATGGT
2-Arthrobacter globiformis-Uox-FATGAGCAACAAGATCGTCCTCG
2-Arthrobacter globiformis-Uox-RCTAGCAGAAGCCGGCGATGC
3-Arthrobacter liuii-Uox-FATGAGCAGCAAGATCATCCT
3-Arthrobacter liuii-Uox-RTTAGCAGAAGCCGGCGATGC
4-Arthrobacter ulcerisalmonis-Uox-FATGAGCAGCAAGATCATCCTC
4-Arthrobacter ulcerisalmonis-Uox-RTCAGCAGAATCCGGCGATGC
5-Arthrobacter rhombi-Uox-FATGACTACCACCGCTTCTCAG
5-Arthrobacter rhombi-Uox-RTTAGCAGAAGCCTGCGGCAT
6-Arthrobacter crystallopoietes-Uox-FATGACCGCCACCGTGGAATC
6-Arthrobacter crystallopoietes-Uox-RGCAGAATCCGGGGATATTTG
7-Arthrobacter arilaitensis-Uox-FATGACTATCGAAACCACCGCC
7-Arthrobacter arilaitensis-Uox-RGGCAAATGCCGGGATATTGGA
8-Arthrobacter dokdonellae-Uox-FATCATCCTGGGCGCCAACC
8-Arthrobacter dokdonellae-Uox-RGCAGAAGCCTGCGACGCCG
Amplification primersIITFH-3- Arthrobacter liuii-Uox-FCAAATGGGTCGCGGATCCGAAATGAGCAGCAAGATCATCCT
TFH-3- Arthrobacter liuii-Uox-RGTGCTCGAGTGCGGCCGCAAGTTAGCAGAAGCCGGCGATGC

Expression and purification of exogenous protein

The recombinant plasmid was transferred into E. coli BL21 (DE3) receptor cells by heat excitation, seeded on kanamycin plates and cultured overnight at 37°C. The single colonies were verified by PCR, and the positive clones with correct bands were picked for the IPTG (isopropyl β-D-1-thiogalactopyranoside) induced fermentation. Colonies were resuspended in PBS and sonicated in the ice bath. The supernatant was centrifuged and turned into crude enzyme after crushing. The crude enzyme was purified by Ni-column affinity chromatography (Liu et al. 2010). The target protein concentration was determined by the Bradford method (Waterborg 2009) with bovine serum albumin as the standard and the absorbance value was measured at 595 nm. The exogenously expressed proteins and the purified proteins, were determined by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Enzymatic properties of uricase

Uric acid has a specific absorbance value of 290 nm. Uricase can oxidize uric acid to allantoin, so that the residual uric acid content can be detected, and the enzyme activity can be determined based on the reduction of uric acid per unit of time. The determination of uric acid enzyme activity is based on the kinetic assay of uric acid enzyme activity by reference to the National Institutes for Food and Drug Control (Beijing, China):

Enzymeactivity(Uml)=ΔA×VT×df12.6×VE×t
ΔA is the reduction of optical density at 290 nm per minute; VT (ml) is the total volume of the reaction solution, df is the dilution multiple, 12.6 is the micromolar extinction coefficient at 290 nm wavelength, VE (ml) is the volume of enzyme liquid added, t is the reaction time (min).

Using 10% uric acid reserve solution (0.01% uric acid, 1 mmol/l EDTA, 0.001% Triton X-100 50 mmol/l boric acid buffer, pH 8.5, frozen in a brown bottle) as the substrate, the collected and purified enzyme solution reacted with the substrate at pH 8.0 and different temperatures (0–60°C), respectively. Unless otherwise stated, all assays were triplicated, and the average was used in all analyses. The optimum temperature was determined by calculating the relative enzyme activity according to the residual uric acid content shown by the UV spectrophotometer.

At optimum temperature, the enzyme solution was placed in different pH buffers (sodium citrate buffer (pH 3.0–8.0), glycine sodium hydroxide buffer (pH 9.0–10.0)) reacting with uric acid substrate. In pH tolerance experiments, the enzyme solutions were incubated in different pH environments for 12 h and 24 h and then incubated with the substrate to determine the effect of pH on enzyme stability. The enzyme solution was placed in a water bath and reacted with the substrate every 20 min at different temperatures (15°C, 20°C, 25°C, and 37°C) to determine the effect of temperature on enzyme stability. All reactions were performed three times to calculate relative enzyme activity.

To determine the effect of different ions on enzyme activity, different metal ions and chemical reagents were added individually to the reaction system. Control conditions were tested using the same process described above without any additives to the reaction mixture.

Results and Discussion

Screening and molecular identification of the uricase-producing strain

After enrichment and purification of Cang Shan soil, a strain named CSAJ-16 had a diameter ratio of 2.60, which was found to have a larger hyaline circle than other strains. Based on the growth curve of CSAJ-16, the growth of the strain at 36 h was still in the logarithmic growth phase, while the uric acid degradation curve started to stabilize (Fig. 1). The highest intra- and extracellular activity was observed at 36 h (Fig. S1). Therefore, the optimal fermentation time for this strain was 36 h (Fig. 1). The 16S rRNA nucleotide sequence of CSAJ-16 was 1,430 bp based on the analysis of the sequencing results on Blast and showed 98% similarity to Arthrobacter sp. (accession number: MW867036). Based on the evolutionary tree in Fig. 2, CSAJ-16 was identified as belonging to the genus Arthrobacter and named Arthrobacter sp. CSAJ-16 (accession number: ON351056).

Fig. 1.

Growth and uric acid degradation curve of Arthrobacter sp. CSAJ-16.

Fig. 2.

The phylogenetic tree of Arthrobacter sp. CSAJ-16 base on the 16S rRNA sequences.

Cloning and expression of the urease gene

The primers designed for the uricase gene successfully amplified the uricase open reading frame (ORF) of strain CSAJ-16, and a band of approximately 900 bp in length was obtained by agarose gel electrophoresis, which was consistent with the theoretical results. The positive clone was verified by PCR and showed a clear band near 1,000 bp, which was consistent with the sequencing results, proving that the uricase gene had been successfully ligated into the expression vector. The recombinant bacterium UOX-CSAJ-16 was introduced into receptor cells, and the fermentation broth and intracellular fluid were assayed, and the expressed ArUOX was found to be an intracellular enzyme. The expression mechanism was consistent with that of the pET-28a-sUOX uricase-engineered bacteria constructed by Tang et al. (2018), IPTG as an inducer could largely enhance the production of the target protein during the fermentation process.

The expression product was examined by SDS-PAGE and the results were shown in Fig. 3, with a distinct band at 32 kDa. It was in agreement with the relative molecular masses of amino acids calculated from gene sequences on the ExPASy (https://web.expasy.org/compute_pi), and with those of the Arthrobacter sp. (Suzuki et al. 2004), but smaller than those of Bacillus sp. sources (Li et al. 2006), suggesting that the molecular weights of urease from various sources also differed. As the expressed ArUOX bored a His tag, the purification efficiency was improved by Ni-column affinity chromatography purification under PBS elution containing 200 mM mimetic file. The relative enzyme activity of the purified ArUOX reached 0.088 U/mg. The absorbance of the purified recombinant ArUOX was measured at OD 595 nm, and the protein concentration was 129 μg/ml. Based on the Lineweaver-Burk method, the Mi equation can be obtained as follows: 1/V = 1.181 1/S + 24.136. The Km and Vmax of ArUOX were 0.048 mM and 0.041 μmol/mg/min, respectively.

Fig. 3.

SDS-PAGE analysis of the expression of ArUOX in the recombinant strain UOX-CSAJ-16.

M – Molecular weight standard, Lane 1 – crude enzyme, Lane 2 – purified ArUOX

The enzymatic properties of uricase

The optimum temperature and pH of ArUOX were consistent with those of the natural urate oxidase produced by Arthrobacter sp. CSAJ-16 (Fig. S2). The optimum reaction temperature and pH curves for ArUOX are shown in Fig. 4, with the temperature increasing from 0°C to 60°C. ArUOX maintained maximum activity at 20°C, the optimum reaction temperature. ArUOX preserved more than 50% activity at 37°C, and lost activity when the temperature reached 60°C. In the pH range of 3.0 to 7.0, the relative enzyme activity was 100% at pH 7.0 and decreased to 50% at pH less than 6.0 or greater than 8.6. Previously reported optimum temperatures for microbial-derived uricases ranged from 30 to 65°C and pH between 8 and 10 (Li et al. 2006; Liu et al. 2010; Chiu et al. 2021a). In contrast, the optimum reaction temperature of ArUOX was closer to room temperature, and the optimum pH was closer to human plasma pH.

Fig. 4.

Effects of temperature (A) and pH (B) on the activity of ArUOX.

In the degree tolerance experiment, as shown in Fig. 5A, the relative enzyme activity of ArUOX remained above 50% for 100 min of incubation at 15°C, 20°C, 25°C, and 37°C. ArUOX remained at more than 45% of its relative activity for 140 min at the human physiological temperature of 37°C. The pH tolerance results are shown in Fig. 5B, where the enzyme activity was essentially unchanged at 24 h incubation at each pH compared to 12 h, in general agreement with the results of Chiu et al. (2021b). ArUOX incubation for 24 h in pH close to neutral resulted in > 70% relative enzyme activity, demonstrating that the enzyme is well preserved in pH neutral environment.

Fig. 5.

Effects of temperature (A) and pH (B) on the stability of ArUOX.

The effect of metal ions and inhibitors on enzyme activity was investigated, and the results are shown in Table II. K+, Mg2+, Ca2+, Ba2+, and Pb2+ significantly promoted ArUOX and the relative enzyme activity increased to 200%. Fe2+, Co2+, Mn2+, and Zn2+ had an inhibiting effect on enzyme activity, and the relative enzyme activity decreased to below 50%. ArUOX, in agreement with the results of the Arthrobacter sp. source studied by Suzuki et al. (2004), also showed strong inhibition of the metal ion Zn2+. However, the effect regarding Mg2+ was again specific, with an apparent activation effect. The chemical reagents such as EDTA, SDS, and PSM all had an inhibitory effect on ArUOX. It was completely deactivated by Zn2+ and SDS.

Table II

Effect of different ions and chemical reagents on enzyme activity.

ChemicalsFinal concentrationResidual activity (%)
Blank10 mM100.0
K+10 mM250.72 ± 2.90
Mg2+10 mM279.71 ± 3.34
Fe2+10 mM43.48 ± 0.35
Ca2+10 mM204.35 ± 4.35
Ni2+10 mM181.16 ± 2.90
Co2+10 mM17.39 ± 0.33
Ba2+10 mM256.52 ± 2.45
Mn2+10 mM23.19 ± 0.65
Pb2+10 mM256.52 ± 4.35
Zn2+10 mM0
EDTA10%26.09 ± 0.34
SDS10%0
PSMF10%53.62 ± 0.79

Conclusions

In summary, a uricase-producing strain Arthrobacter sp. CSAJ-16 was isolated from the soil sample from Cangshan Mountain, Yunnan Province, China. Based on the gene sequence alignment, the uricase gene (named aruox) of Arthrobacter sp. CSAJ-16 was amplified and heterologously expressed. The optimal pH and temperature of ArUOX were pH 7.0 and 20°C, respectively. The ArUOX remained above 50% relative activity after incubation at 37°C for 100 min or at pH 6.0–8.6 for 24 h. Moreover, metal ions such as K+, Mg2+, Ca2+, Ba2+ and Pb2+ could significantly enhance the activity of ArUOX (> 200%). These enzymatic properties indicate that ArUOX has potential applications in pharmaceutical enzymes and uric acid detection kits.

Acknowledgments

This research was supported by the Yunnan Applied Basic Research Project (Grant No. 202101AU070138), Kunming medical joint special project (Grant No. 2019FE001-304), Cangshan Comprehensive Scientific Investigation in Dali (Phase II) (Grant No. KY2126109940), Basic research plan of Yunnan provincial science and technology department (Grant No. 202101AY070001-130).

Notes

[1] Contributed by Author contributions

Y.R.Y. and L.H.L. conceived the study. X.Y. and W.H. were responsible for the isolation of the uricase-producing strain. Y.G.Z. amplified the uricase gene. Q.Q.L. and S.W. were responsible for the cloning and heterologous expression of functional genes. H.Y.L. purified the recombinant protein. D.Z. and Z.H.L. measured enzymatic activity. X.Y. and L.H.L. performed data analysis. X.Y., L.H.L., Y.R.Y., and W.H. wrote the manuscript. All authors discussed the results and commented on the manuscript. All authors read and approved the final manuscript.

[2] Conflicts of interest Conflict of interest

The authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication.

Supplementary materials are available on the journal's website.

DOI: https://doi.org/10.33073/pjm-2023-027 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 277 - 283
Submitted on: Apr 10, 2023
Accepted on: Jun 9, 2023
Published on: Sep 20, 2023
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 Xin Yan, Wei Hu, Yun-Guo Zhu, Qing-Qing Liu, Shuai Wang, Hong-Yan Liu, Dan Zhu, Zhi-Hua Lv, Lin-Hua Li, Yi-Rui Yin, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.