Skip to main content
Have a personal or library account? Click to login
Prevalence and Biological Characteristics of Listeria Species Isolated from Livestock and Poultry Meat in Gansu Province, China Cover

Prevalence and Biological Characteristics of Listeria Species Isolated from Livestock and Poultry Meat in Gansu Province, China

Open Access
|Mar 2023

Full Article

Introduction

Listeria is sporeless, facultative, and Gram-positive bacteria, widely distributed in the environment and ubiquitously found in decaying vegetation, sewage, and soil (Jadhav et al. 2012). According to the genome sequence, pathogenicity traits, and catabolism characteristics, the genus Listeria can be divided into thirteen species, of which L. monocytogenes, L. innocua, L. ivanovii, L. seeligeri, L. welshimeri, and L. grayi are most prevalent (Schmid et al. 2005). It should be highlighted that L. monocytogenes is a zoonotic pathogen that has been ranked among the four foodborne pathogens deemed the greatest threat to public health by the World Health Organization (WHO) in the early 1980s (Chlebicz and Slizewska 2018). Moreover, diseases caused by L. monocytogenes mainly occur in immunocompromised individuals and manifest as encephalitis, meningoencephalitis, and septicemia. The consequences of the pregnant woman and newborn infection are extremely severe, including abortion, premature birth, and pneumonia (Doumith et al. 2004; Indrawattana et al. 2011).

Recently, different studies have reported several food contamination events caused by L. monocytogenes worldwide. For example, the prevalence of L. monocytogenes in raw milk and milk products in the Samson Province of Turkey was 3.7% (Terzi Gulel et al. 2020). The prevalence of L. monocytogenes in sliced cheese and ham in the retail market in southern Brazil was 9.4% (Maia et al. 2019), but in the poultry production chain in Italy was higher and equal to 26.7% (Iannetti et al. 2020). The prevalence of L. monocytogenes in slaughterhouses and supermarkets in three neighboring provinces (Chongqing, Shanxi, and Yunnan) of China was 5.5%, and the bacterium was found in 4.0% of foods from Beijing (Fang et al. 2018). Astonishing was that L. monocytogenes contamination rates in food from the Sichuan province of China reached 46.9% (Fang et al. 2018; Li et al. 2018a). L. innocua, a non-pathogenic bacterium, is widely distributed in meat and meat products. L. innocua often accompanies L. monocytogenes and is regarded as the indicator bacteria of the latter (den Bakker et al. 2010; Yıldırım et al. 2016). L. welshimeri is also a non-pathogenic microorganism and does not have virulence genes, including aadA, strA, strB, and penA (Davis and Jackson 2009). Although L. welshimeri lacks virulence genes for intracellular survival, similar to L. innocua, it is more closely related to L. monocytogenes than other Listeria species (Hain et al. 2007). Davis and Jackson (2009) found that L. welshimeri had the broadest resistance range compared to L. monocytogenes and L. innocua. Therefore, the potential for L. welshimeri exists to serve as a reservoir of transferable resistance genes (Davis and Jackson 2009).

Foodborne listeriosis outbreaks have been linked to various meat products (Matle et al. 2020). The first laboratory-confirmed invasive case of listeriosis associated with meat products was in 1988 after consuming contaminated turkey franks (Schwartz et al. 1989). In 1987–2018, worldwide listeriosis outbreaks or sporadic cases comprised of 2,087 cases related to meat products, including processed, vacuum-packaged meat products (Jensen et al. 2016; Chen et al. 2017), and polonies (Smith et al. 2019). These cases were mostly reported in the United Kingdom, Australia, France, the United States, Denmark, and South Africa. Poor hygienic practices and lack of effective monitoring during meat processing are conducive to the growth and survival of L. monocytogenes.

Currently, there is no report on the contamination by Listeria species in livestock and poultry meat in the Gansu Province, northwest China. In this study, we investigated the prevalence of Listeria spp. in livestock and poultry meat from the slaughterhouses and markets of the Gansu province. We conducted a preliminary study of the biological characteristics of isolated bacteria; further studies are warranted to develop effective prevention and control measures.

Experimental

Materials and Methods

Sample. From July 2020 to October 2020, 1,387 samples were randomly collected from raw pork, chicken, beef, and mutton from slaughterhouses and markets in five cities of the Gansu province (Fig. 1). Forty-one swabs were mainly derived from chopping boards, knives, and instruments from the market environment. The sampling information on 45 Listeria spp. isolates was shown in Table SI. The sampling followed the national criteria of meat and meat products-sampling GB/T 9695.19-2008 (2008) with moderate modifications. The meat and the environment surfaces were smeared using cotton swabs soaked in sterile saline solution for sampling, and the collected cotton swabs were put into a tube with 5 ml sterilized phosphate buffer solution (PBS). Samples were placed in the sampling box with the freezer bags and stored at 4°C after delivery to the laboratory.

Fig. 1.

Distribution diagram of sampling points in Gansu province, China. The geographic locations of samples from slaughterhouses and markets. The five-pointed stars of red represent the different sampling sites.

Isolation and identification of Listeria species. Listeria strains were isolated according to the microbiology of food testing for L. monocytogenes GB 4789.30-2016 (2016) method of China with moderate modifications. The collected cotton swabs were placed into 225 ml Luria-Bertani liquid medium (LB1) (Solarbio, China) and incubated at 30°C for 36 h. Then, 0.1 ml of enrichment broth was transferred into 10 ml LB2 for the second-step enrichment at 30°C for 48 h. The isolates were inoculated on PALCAM agar (Huankai Microbial, China) and cultured at 37°C for 36 h. Afterward, 2–3 colonies revealing the characteristic small, round, and grayish-green appearance on PALCAM agar were picked and subcultured on the selected medium for Listeria at 37°C for 48 h. Two or three smooth bluegreen colonies were then randomly selected for purification and cultured on the solid medium of Brain Heart Infusion (BHI) (Solarbio, China) at 37°C for 8 h. Then, the bacteria were stained according to the Gram procedure. After the above operation, Listeria spp. were preliminarily identified. The PCR method that targets specific genes of different Listeria species was applied for further verification (Tao et al. 2017). Bacterial DNA was extracted from 3 ml of the above bacterial cultures using the TIANamp Bacterial DNA kit (Tiangen, China) and used as the template to identify the Listeria genus-specific prs gene by PCR. The positive isolates for the prs gene fragments were further identified using the primers for the L. monocytogenes-specific lmo2234 gene. Then, the negative isolates were identified using the primer for the L. innocua-specific lin0464 gene. After amplification, the purified PCR products were sent to the GENEWIZ Technology Co., Ltd., (China) for Sanger sequencing. The sequencing results were analyzed by BLAST in the NCBI database. The PCR primers used in this paper refer to the study of Luo et al. (2017). All the primers used in this study are listed in Table I.

Table I

Primer information.

Gene targetPrimer sequence (5’-3’)Product size
(bp)
Application
prs-FGCTGAAGAGATTGCGAAAGAAG370Listeria species-specific primers
prs-RCAAAGAAACCTTGGATTTGCGG
Lmo2234-FTGTCCAGTTCCATTTTTAACT420Listeria monocytogenes specific primers
Lmo2234-RTTGTTGTTCTGCTGTACGA
Lin0464-FCGCATTTATCGCCAAAACTC749Listeria innocua specific primers
Lin0464-RTCGTGACATAGACGCGATTG
lmo0737-FAGGGCTTCAAGGACTTACCC691For the identification of Listeria monocytogenes serogroup
lmo0737-RACGATTTCTGCTTGCCATTC
lmo1118-FAGGGGTCTTAAATCCTGGAA909For the identification of Listeria monocytogenes serogroup
lmo1118-RCGGCTTGTTCGGCATACTTA
ORF2819-FAGCAAAATGCCAAAACTCGT471For the identification of Listeria monocytogenes serogroup
ORF2819-RCATCACTAAAGCCTCCCATTG
ORF2110-FAGTGGACAATTGATTGGTGAA597For the identification of Listeria monocytogenes serogroup
ORF2110-RCATCCATCCCTTACTTTGGAC
16S rRNA-27FAGAGTTTGATCCTGGCTCAG1,500Used for cluster analysis
16S rRNA-1492RGGTTACCTTGTTACGACTT

L. monocytogenes serogroups. The bacterial wall-breaking treatment and multiplex PCR method were used to differentiate the major serogroups of L. monocytogenes. The multiplex PCR primers (Doumith et al. 2004) were shown in Table I. PCR products were detected by agarose gel electrophoresis, and serogroups of the isolates were determined by analyzing the electrophoresis bands (Doumith et al. 2004). The 16S rRNA sequencing results of the different serogroup isolates were analyzed by BLAST (Basic Local Alignment Search Tool) determine the isolates’ clusters further.

Antimicrobial susceptibility test. The Kirby-Bauer disk diffusion test was used to evaluate the susceptibility of Listeria species to ten antibiotics, including penicillin, ofloxacin, cefoxitin, sulfamethoxazole, tetracycline, gentamicin, streptomycin, erythromycin, acetylspiramycin, and fosfomycin. Finally, the diameters of the antimicrobial zone of each antimicrobial susceptibility disc were measured. Results were judged according to Reis et al. (2011).

Measurement of the growth curve. Four L. monocytogenes isolates of different serotypes, the reference strain ATCC® 19111, three L. innocua isolates, and three L. welshimeri isolates were selected for the growth curve determination. Listeria isolates were aseptically inoculated on BHI agar plates and incubated overnight at 37°C. The single colonies were inoculated in 20 ml of BHI liquid culture at 37°C 180 × g. Three parallel tests were set for each sample, and one BHI medium was selected as blank control. The growth curve of the isolates was drawn by measuring the OD600 value of the bacterial suspension at different times. The multi-mode microplate reader with model number SpectraMax i3x (Molecular Devices Corporation, USA) was utilized for these studies.

Biofilm formation assay. The method of Hu et al. (2010) for the capacity of bacterial biofilm formation was modified. All Listeria isolates were aseptically inoculated on BHI agar plates and incubated overnight at 37°C. The colonies were selected and cultured in 5 ml of BHI liquid medium at 37°C 180 ×g for 14 h. After overnight incubation, the bacterial broth was transferred to BHI at a ratio of 1:100 and incubated until the OD562 value reached 0.2. The bacterial solution was diluted again at a ratio of 1:100; then the bacteria diluent was transferred 200 μl of each well into a 96-well plate and incubated at 37°C for 46 h. After incubation, the suspension was discarded, and each well was washed with 200 μl sterilized saline three times to remove the planktonic bacteria. Then, the bacteria were fixed with 200 μl methanol for 30 min. After drying, 200 μl of 1% ammonium oxalate crystal violet solution was added for 30 min. Finally, 200 μl of 95% ethanol solution was added and vibrated for 20. The OD562 values were measured with a multi-mode microplate reader. Three replicates for each bacterial isolate were measured.

Cluster analysis. The cluster analysis of the Listeria genus based on 16S rRNA (Soni and Dubey 2014) was performed using MEGA 5.05 cluster analysis software (Tamura al. 2011). Thirty-three sequences were selected to analyze the Listeria spp. cluster relationship, including 14 sequences of L. monocytogenes, one sequence of L. innocua, one sequence of L. welshimeri from this study, and 17 sequences of other Listeria species from the National Center for Biotechnology Information (NCBI, www.ncbi.nlm.nih.gov) database. The 16S rRNA sequencing data used in the experiment have been submitted to the NCBI database, and the accession numbers of all sequencing data have been collated in Table SII. Gaps were treated as missing data, with equal weightings for transitions and transversions.

Statistical analysis. SPSS 22 software (SPSS, Inc., USA) was used for statistical analyses. All experimental data were calculated by the one-way analysis of variance. Results were considered statistically significant at the p-value < 0.05 level. p-Value < 0.05 was regarded as significantly different, while p-value <0.01 was regarded as highly significantly different. Error bars represent the standard deviation.

Results

Prevalence of L. monocytogenes, L. innocua and L. welshimeri in livestock and poultry meat. The prevalence of Listeria species in different samples and different regions of the province has been summarized in Table II. Specific genes of the Listeria species were confirmed by agarose gel electrophoresis, including prs (370 bp), lmo2234 (420 bp), and lin0464 (749 bp). In total, 12.6% (174/1,387) of samples were positive for Listeria spp. Among these, L. innocua was the most prevalent species, accounting for 86.2% (150/174) of the isolates, whereas L. monocytogenes accounted for 8.1% (14/174), and L. welshimeri for 5.7% (10/174). Among the meat samples of different categories, the prevalence rate of Listeria spp. ranged from 12.2–13.4%. The prevalence rate of Listeria spp. in beef and mutton (13.4%) was highly significantly different than in pork (12.3%), chicken (12.5%), and environment samples (12.2%). However, the difference in the Listeria spp. prevalence in pork (12.3%) and environment samples (12.2%) was not statistically significant (p-value > 0.05). The prevalence rate of L. monocytogenes in chicken (1.14%) was highly significantly different than in the other meat sample (1.0%), including pork, beef, and mutton (p-value < 0.01). The prevalence rate of L. welshimeri in pork (0.9%) was highly significantly different when compared with that in beef (0.7%) or chicken (0.4%) (p-value < 0.01). In addition, the prevalence rate of L. innocua in environment samples (12.2%) was highly significantly different than in pork (10.3%), beef (11.7%), and chicken (11.0%) (p-value <0.01). Furthermore, the incidence rate of Listeria spp. varied from 1.5% to 38.2% among different cities. The occurrence of Listeria spp. in Qingyang city was significantly different (p-value < 0.01) compared to that in other cities. The incidence of L. monocytogenes was highly significantly different (p-value < 0.01) in the cities of Lanzhou (2.4%), Qingyang (2.2%), and Jiuquan (1.0%).

Table II

Statistic of data on the prevalence of Listeria spp. according to regions and sample categories.

Number of samplesListeria monocytogenes positive samples (%)Listeria innocua positive samples (%)Listeria welshimeri positive samples (%)Listeria spp. positive samples (%)
Different regions
Lanzhou City2987 (2.4a)30 (10.1b)2 (0.7b)39 (13.1b)
Qingyang City2756 (2.2b)95 (34.6a)4 (1.5a)105 (38.2a)
Jiuquan City1291 (0.8c)2 (1.6d)0 (0c)3 (2.3d)
Dingxi City4000 (0d)6 (1.5d)0 (0c)6 (1.5e)
Zhangye City2850 (0d)17 (6.0c)4 (1.4a)21 (7.4c)
Total            1,38714 (1.0)150 (10.8)10 (0.7)174 (12.6)
Different categories of samples
Pork7848 (1.0b)81 (10.3d)7 (0.9a)96 (12.3c)
Beef and mutton2983 (1.0b)35 (11.7b)2 (0.7b)40 (13.4a)
Chicken2643 (1.14a)29 (11.0c)1 (0.4c)33 (12.5b)
Environment samples410 (0b)5 (12.2a)0 (0d)5 (12.2c)
Total            1,38714 (1.0)150 (10.8)10 (0.7)174 (12.6)

1a-e – Different superscript lowercase letters indicate that the two sets of data in this column are highly significantly different (p-value < 0.01), and the same superscript lowercase letters indicate not significantly different values (p-value > 0.05). With the increase of a to d, the differences between groups are also gradually expanding.

L. monocytogenes serogroups. The serogroups of L. monocytogenes isolates were identified by multiplex PCR (Fig. 2). L. monocytogenes isolates were divided into 1/2c (42.9%), 1/2a (35.7%), 1/2b (14.3%), and 4b (7.1%) serogroups. The 1/2c serogroup included two serotypes, 1/2c and 3c. The 1/2a serogroup included 1/2a and 3a serotypes. The 1/2b serogroup was composed of the 3b and 7 serotypes. The 4b serogroup primarily consisted of 4b and 4e serotypes. Combined with the results of multiple PCR and 16s rRNA sequencing analyzed by BLAST, the clusters of the isolates could be identified.

Fig. 2.

Serogroups by multiplex-PCR of L. monocytogenes isolates.

M – DL 2000 DNA Maker, 1 – ATCC® 19115 (serogroup 4b), 2 – ATCC® 19111 (serogroup 1/2a), 3 – NCTC10890 (serogroup 1/2b), 4 – ATCC® 19112 (serogroup 1/2c), 5–18 – the strains isolated in this study, 19 – L. innocua (negative control)

Antimicrobial susceptibility. The antimicrobial susceptibility tests were performed to examine the resistance of isolates (Table III). The results showed that all L. monocytogenes isolates were resistant to tetracycline and cefoxitin and sensitive to ofloxacin. Moreover, 92.9% of L. monocytogenes isolates indicated a high resistance to penicillin, acetylspiramycin, and erythromycin, and 78.6% were resistant to sulfamethoxazole. The resistance rate of 50.0% of L. monocytogenes isolates to fosfomycin was also observed. L. innocua isolates were sensitive to penicillin and gentamicin, whereas they were resistant to fosfomycin (81.8%) and tetracycline (63.6%). The resistance rate for fosfomycin, tetracycline, and sulfamethoxazole in L. welshimeri isolates was noteworthy, with a primary resistance rate of 40.0%. In addition, only 10% of L. welshimeri isolates were resistant to gentamicin and streptomycin. Overall, the rate of antibiotic resistance of L. monocytogenes isolates was higher compared to L. welshimeri and L. innocua isolates.

Table III

Result of drug susceptibility of Listeria spp. isolates.

AntibioticsListeria monocytogenesListeria innocuaListeria welshimeri
Resistant isolatesIntermediate isolatesSensitive isolatesResistance rates (%)Resistant isolatesIntermediate isolatesSensitive isolatesResistance rates (%)Resistant isolatesIntermediate isolatesSensitive isolatesResistance rates (%)
Penicillin13  0  1  92.9  2  020    9.1  3  0  7  30.0
Ofloxacin  1  211    7.1  113  8    4.6  2  0  8  20.0
Cefoxitin14  0  0100    0  022  0  2  0  8  20.0
Sulfamethoxazole11  0  3  78.610  111  45.5  4  0  6  40.0
Tetracycline14  0  0100  14  0  8  63.6  4  0  6  40.0
Gentamicin  3  011  21.4  0  022  0  1  0  9  10.0
Streptomycin  2  111  14.3  5  017  23.7  1  0  9  10.0
Erythromycin13  1  0  92.9  4  414  18.2  3  1  6  30.0
Acetylspiramycin13  0  1  92.9  5  017  22.7  3  0  7  30.0
Fosfomycin  7  7  0  50.018  0  4  81.8  4  2  4  40.0

Measurement of the growth curve. Four L. monocytogenes isolates of different serogroups entered the logarithmic growth phase after 3 h of culture. Serotypes 1/2a and 4b reached the plateau after 20 h, while serotypes 1/2b and 1/2c reached the plateau after 7 h. They apparently showed a faster growth rate compared to serotypes 1/2a and 4b. The L. monocytogenes reference strain ATCC® 19111 (1/2a) entered the logarithmic phase after 8 h incubation and entered the plateau phase after 15 h. The growth rate of the reference strain was significantly slower than that of the four isolates (Fig. 3a). L. innocua entered the logarithmic phase between 4 and 10 h and the growth rate began to slow down after 10 to 31 h of culture, and entered the growth plateau phase after 31 h (Fig. 3b). L. welshimeri entered the logarithmic phase after 6 h of culture, which lasted until 12 h, entered the slow growth phase from 12 h to 14 h, and then the plateau phase after 14 h (Fig. 3c).

Fig. 3.

The growth curves of the Listeria monocytogenes isolates. Each data point is the average of triplicates, and the standard deviations are indicated as error bars.

a) The growth curves for four serogroups of L. monocytogenes and one reference strain ATCC® 19111, b) the growth curves for three isolates of L. innocua, c) the growth curves for three isolates of L. welshimeri.

Biofilm formation assay. The results showed that all Listeria isolates of could form a biofilm (Fig. 4). Among L. monocytogenes isolates, LM7 formed the highest biofilm while LM14 – was the lowest. The average OD562 values for serotypes 1/2c, 1/2a, 4b, and 1/2b were 0.134 ± 0.016, 0.151 ± 0.037, 0.1302 ± 0.017, 0.104 ± 0.011, respectively. Thus, significant differences (p-value < 0.05) between different serotypes of L. monocytogenes were observed. Analysis of the biofilm formation ability of L. innocua isolates showed that LI22 exhibited the highest biofilm-forming ability, whereas LI19 showed the weakest biofilm formation. The average OD562 value for L. innocua was 0.09198 ± 0.01281. A highly significant difference (p-value < 0.01) was observed between LI22 and other L. innocua isolates. For the L. welshimeri isolates, LW8 was the strongest biofilm-forming isolate, and LW5 was the weakest. The average OD562 value of L. welshimeri was 0.09963 ± 0.01257. The significant differences (p-value < 0.05) between different L. welshimeri isolates were demonstrated. L. monocytogenes isolates formed stronger biofilm than the other two Listeria species.

Fig. 4.

Biofilm formation by Listeria spp. isolates. The absorbance at 562 nm was measured for 22 L. innocua, 10 L. welshimeri, and 14 L. monocytogenes biofilms.

Cluster analysis. Cluster analysis was performed on 16S rRNA sequences of 17 reference strains of Listeria spp. downloaded from NCBI and 16 isolates in this study (Fig. 5). The cluster analysis showed that all isolates exhibited a high level of similarity. The 16S rRNA sequence indicated that 33 strains included in genus Listeria were comprised of two closely related but distinct clades. The first of the clade included L. floridensis, L. aquatic, L. grayi, and L. fleischmannii, the remaining species (including L. monocytogenes, L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) constituted the second clade.

Fig. 5.

Cluster analysis of Listeria spp. isolates based on the sequences of the 16S rRNA genes. The tree was calculated using the Neighbor-Joining method. Isolates isolated in this study are indicated with circles (L. monocytogenes), boxes (L. innocua), and triangles (L. welshimeri). The scale bar represents 0.005 nucleotide substitutions per character. The numbers in the tree indicate the significance (percent of outcomes) of the branches (bootstrap analysis).

Nevertheless, the L. grayi strain formed a subline distinct from the other highly interrelated species, especially from L. innocua and L. welshimeri. Fourteen species of L. monocytogenes isolated in this study were very similar to the L. monocytogenes EGD-e and L. monocytogenes strain ATCC® 19115. According to the cluster analysis, all three species of Listeria spp. isolated in this study belonged to the same cluster as the corresponding reference strains selected from NCBI.

Discussion

Several reports have shown that Listeria spp. is prevalent and distributed in food processing environments in China (Du et al. 2017; Wang et al. 2017). However, the prevalence and distribution of Listeria spp. from livestock and poultry meat have been rarely reported in China.

In this study, we collected 1,387 samples from different areas in Gansu province. L. monocytogenes isolates were mainly present in pork samples in the market environment, and the prevalence of L. monocytogenes was 1.0% (14/1,387). This result differs from other provinces of China (Yan et al. 2016; Chen et al. 2020; Wang et al. 2021). The differences stem from the bacteria’s isolation rate and the drug-resistant percentage. Differences may be caused by the distribution of microorganisms, sample sources, sampling methods, storage conditions, and hygiene conditions of retailers. We also isolated ten isolates of L. welshimeri (0.7%, 10/1,387) and 150 isolates of L. innocua (10.8%, 150/1,387) from the collected samples. The prevalence rate of L. innocua was much higher than that of L. monocytogenes and L. welshimeri. This finding is consistent with that of Locatelli et al. (2017). Although L. innocua and L. welshimeri are non-pathogenic, the presence of these two species affects the laboratory results on the distribution of L. monocytogenes in the natural environment. It is related to the dominant growth of different Listeria species in the selective culture medium. Samples with multiple Listeria species coexisting during the enrichment step will inhibit L. monocytogenes growth (Besse et al. 2010).

Since the first strain of antibiotic-resistant L. monocytogenes was isolated in 1988, antibiotic resistance has become more and more serious (Heger et al. 1997). L. monocytogenes have special proteins on their cell membranes that can bind penicillin but cannot bind cephalosporins, so they are resistant to cephalosporins (Krawczyk-Balska et al. 2014), which was also confirmed by the results of this study. Meanwhile, all Listeria isolated in this study can form biofilms, which warrant bacterial persistence in the environment and antibiotic resistance development. Compared to the antibiotic resistance of L. monocytogenes from other places (Li et al. 2016; Fang et al. 2018; Wang et al. 2021), the isolates in this study were resistant to more than five antibiotics, indicating that they were multidrug-resistant isolates. Resistance to penicillin, tetracycline, erythromycin, and cefoxitin appears to be particularly higher in these isolates, illustrating regional variability in the use of antibiotics.

The 14 isolates of L. monocytogenes isolated in this study included four serotypes: 1/2a, 1/2b, 1/2c, and 4b. We combined the results of multiplex PCR and analysis of 16S rRNA sequencing on BLAST to distinguish different isolates. Among the isolated isolates, there were 11 isolates of serotypes 1/2a and 1/2c, the main serotypes of L. monocytogenes. Li et al. reported that strains of serotype 4b mainly exist in patients infected with listeriosis. However, this serotype was also detected in animal-derived food in this study, indicating that this serotype is widely distributed (Li et al. 2016). Among the different samples, the chicken meat was the most contaminated with L. monocytogenes serotype 1/2a. Most human diseases related to listeriosis, including septicemia, meningitis, and abortion were caused by only three serotypes, 1/2a, 1/2b, and 4b (Datta and Burall 2018). In China, 253 invasive listeriosis cases were reported in 19 provinces from 2011 to 2016, with a fatality rate of 25.7% (Li et al. 2018b).

The 16S rRNA gene is considered a molecular marker in bacterial molecular classification. Orsi and Wiedmann (2016) divided Listeria into two groups based on their genetic relationship. One group included L. monocytogenes, L. innocua, L. ivanovii, L. seeligeri, and L. welshimeri. Another group included L. grayi and some other newly discovered species of Listeria (Orsi and Wiedmann 2016). This result is the same as that obtained from our previous study. However, some scholars believe that except for L. grayi, the 16S rRNA sequences of other members have a high similarity and thus are not suitable as a genetic marker gene in Listeria (Czajka et al. 1993). As a result, the 23S rRNA, iap, ldh, prs and vclB were also used as potential genetic markers to illustrate the phylogenetic relationship of Listeria (Schmid et al. 2005). With the evolution of the Listeria virulence gene cluster, some of the Listeria species have lost their pathogenic ability, such as L. innocua and L. welshimeri. The location of the L. innocua and L. welshimeri virulence gene cluster breakpoints is also consistent with this view.

Conclusions

This research investigates the prevalence of Listeria spp. in livestock and poultry meat in Gansu province for the first time. This study provides strong evidence for the prevalence of Listeria species in slaughterhouses and markets. Although the isolation rate of L. monocytogenes is low, four serogroups were identified with high multidrug resistance and biofilm-forming ability. The above phenomena bring great difficulty in controlling L. monocytogenes contamination in this area. Therefore, it is necessary to strengthen and standardize the management of processing, transportation, sales of products, rationally use antibiotics, and regular monitor the bacteria to reduce the threat of listeriosis. In addition, ecological symbiosis and phenotypic similarity existed among the three Listeria species. L. innocua and L. welshimeri can be used to predict the physiological behavior and contamination level of L. monocytogenes. Our study provides the scientific basis for preventing and controlling listeriosis in higher-risk groups and susceptible animals.

Notes

[2] Ethical statement: All experiments were approved by the College of Veterinary Medical, Gansu Agricultural University, China.

[3] Conflicts of interest Conflict of interest: The authors do not report any financial or personal connections with other persons or organizations, which might negatively affect the contents of this publication and/or claim authorship rights to this publication.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (No. 31960726, No. 32060822), Modern Silk Road Cold and Drought Agricultural Science and Technology Support Project (GSLK-2022-17), National Key Research and Development Program of China (No. 2019YFC1605705), Key Research and Development Program of Gansu Province (No. 20YF8FA136), Gansu Agricultural University Youth Tutor Support Fund (GAU-QDFC-2020-10). We thank all the members of the Laboratory of Public health, Gansu Agricultural University for giving useful advice on writing this manuscript. We are indebted to international science editing for critical correction of this manuscript.

DOI: https://doi.org/10.33073/pjm-2023-002 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 11 - 20
Submitted on: Oct 6, 2022
Accepted on: Dec 27, 2022
Published on: Mar 24, 2023
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2023 ZHIJIE DONG, YANAN SUN, QING CAO, HONGXIA LIU, YUANYUAN LIU, QIHANG CAO, HUILIN WEI, CHEN SONG, HUITIAN GOU, HUIWEN XUE, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.