Table I
Oligonucleotides used in this study.
| Target | Sequence (from 5’ to 3’) | Product size (bp) | Annealing temp. (°C) | Reference |
|---|---|---|---|---|
| mecA | ||||
| Forward | AAAATCGATGGTAAAGGTTGGC | 533 | 55 | Kot et al. 2020 |
| Reverse | AGTTCTGCAGTACCGGATTTGC | |||
| nuc | ||||
| Forward | GCGATTGATGGTGATACGGTT | 279 | 55 | Amin et al. 2020 |
| Reverse | AGCCAAGCCTTGACGAACTAAAGC | |||
| hla | ||||
| Forward | CTGATTACTATCCAAGAAATTCGATTG | 209 | 57 | Rasheed and Hussein 2020 |
| Reverse | CTTTCCAGCCTACTTTTTTATCAGT | |||
| eta | ||||
| Forward | GCAGGTGTTGATTTAGCATT | 93 | 58 | Rasheed and Hussein 2020 |
| Reverse | AGATGTCCCTATTTTTGCTG | |||
| etb | ||||
| Forward | ACAAGCAAAAGAATACAGCG | |||
| Reverse | GTTTTTGGCTGCTTCTCTTG | 226 | 50 | Rasheed and Hussein 2020 |
| etd | ||||
| Forward | AACTATCATGTATCAAGG | 376 | 47 | Liu et al. 2018 |
| Reverse | CAGAATTTCCCGACTCAG | |||
| tst | ||||
| Forward | ACCCCTGTTCCCTTATCATC | |||
| Reverse | TTTTCAGTATTTGTAACGCC | 326 | 57 | Rasheed and Hussein 2020 |
Table II
Distribution of MRSA isolates according to age, gender, and admission status.
| Demographic data | n (%) | p-value |
|---|---|---|
| Age groups | ||
| Under 15 | 2 (2.6) | < 0.005 |
| 15–44 | 16 (21.1) | |
| 45–64 | 22 (28.9) | |
| 65 and above | 36 (47.4) | |
| Gender | ||
| Male | 44 (57.9) | 0.107 |
| Female | 32 (42.1) | |
| Admissions | ||
| Inpatients | 57 (75) | < 0.001 |
| Outpatients | 19 (25) | |
Table III
Distribution of MRSA isolates according to the hospital department.
| Department | n (%) |
|---|---|
| Cardiology | 14 (18.4) |
| Pulmonary infections | 10 (13.2) |
| Infectious diseases | 10 (13.2) |
| Anesthesiology | 7 (9.2) |
| Orthopedics and traumatology | 6 (7.9) |
| Cardiovascular surgery | 5 (6.6) |
| General surgery | 5 (6.6) |
| Dermatology | 4 (5.3) |
| Neurosurgery | 4 (5.3) |
| Brain surgery | 2 (2.6) |
| Gastroenterology | 2 (2.6) |
| Intensive care unit | 2 (2.6) |
| Dialysis | 1 (1.3) |
| Neurology | 1 (1.3) |
| Pediatrics | 1 (1.3) |
| Plastic surgery | 1 (1.3) |
| Urology | 1 (1.3) |
| Total | 76 (100) |
Table IV
Distribution of MRSA isolates according to the sample source.
| Sample source | n (%) |
|---|---|
| Abscess-wound | 19 (25.0) |
| Blood | 17 (22.4) |
| Nasal swab | 13 (17.1) |
| Tracheal aspirate | 13 (17.1) |
| Sputum | 5 (6.6) |
| Urine | 4 (5.3) |
| Catheter tip | 3 (3.9) |
| Bronchioalveolar lavage | 1 (1.3) |
| Urethral swab | 1 (1.3) |
| Total | 76 (100) |
Fig. 1
Molecular detection of the nuc, mecA, exfA, exfB, tst and hla genes by single target PCR. PC – positive control, NC – negative control, M – 100 bp DNA ladder (Hibrigen) for mecA (533 bp) and tst (326 bp), 50 bp DNA ladder (Hibrigen) for nuc (270 bp), exfA (93 bp), exfB 226 bp) and hla (209 bp), bp – base pairs