Have a personal or library account? Click to login
Screening of Toxin Genes in Methicillin-Resistant Staphylococcus aureus Clinical Isolates from a Hospital Setting in a Tertiary Hospital in Northern Cyprus Cover

Screening of Toxin Genes in Methicillin-Resistant Staphylococcus aureus Clinical Isolates from a Hospital Setting in a Tertiary Hospital in Northern Cyprus

Open Access
|Nov 2022

Figures & Tables

Fig. 1

Molecular detection of the nuc, mecA, exfA, exfB, tst and hla genes by single target PCR. PC – positive control, NC – negative control, M – 100 bp DNA ladder (Hibrigen) for mecA (533 bp) and tst (326 bp), 50 bp DNA ladder (Hibrigen) for nuc (270 bp), exfA (93 bp), exfB 226 bp) and hla (209 bp), bp – base pairs
Molecular detection of the nuc, mecA, exfA, exfB, tst and hla genes by single target PCR. PC – positive control, NC – negative control, M – 100 bp DNA ladder (Hibrigen) for mecA (533 bp) and tst (326 bp), 50 bp DNA ladder (Hibrigen) for nuc (270 bp), exfA (93 bp), exfB 226 bp) and hla (209 bp), bp – base pairs

Distribution of MRSA isolates according to the sample source_

Sample sourcen (%)
Abscess-wound19 (25.0)
Blood17 (22.4)
Nasal swab13 (17.1)
Tracheal aspirate13 (17.1)
Sputum  5 (6.6)
Urine  4 (5.3)
Catheter tip  3 (3.9)
Bronchioalveolar lavage  1 (1.3)
Urethral swab  1 (1.3)
Total76 (100)

Distribution of MRSA isolates according to age, gender, and admission status_

Demographic datan (%)p-value
Age groups
Under 152 (2.6)< 0.005
15–4416 (21.1)
45–6422 (28.9)
65 and above36 (47.4)
Gender
Male44 (57.9)0.107
Female32 (42.1)
Admissions
Inpatients57 (75)< 0.001
Outpatients19 (25)

Oligonucleotides used in this study_

TargetSequence (from 5’ to 3’)Product size (bp)Annealing temp. (°C)Reference
mecA
ForwardAAAATCGATGGTAAAGGTTGGC53355Kot et al. 2020
ReverseAGTTCTGCAGTACCGGATTTGC
nuc
ForwardGCGATTGATGGTGATACGGTT27955Amin et al. 2020
ReverseAGCCAAGCCTTGACGAACTAAAGC
hla
ForwardCTGATTACTATCCAAGAAATTCGATTG20957Rasheed and Hussein 2020
ReverseCTTTCCAGCCTACTTTTTTATCAGT
eta
ForwardGCAGGTGTTGATTTAGCATT9358Rasheed and Hussein 2020
ReverseAGATGTCCCTATTTTTGCTG
etb
ForwardACAAGCAAAAGAATACAGCG
ReverseGTTTTTGGCTGCTTCTCTTG22650Rasheed and Hussein 2020
etd
ForwardAACTATCATGTATCAAGG37647Liu et al. 2018
ReverseCAGAATTTCCCGACTCAG
tst
ForwardACCCCTGTTCCCTTATCATC
ReverseTTTTCAGTATTTGTAACGCC32657Rasheed and Hussein 2020

Distribution of MRSA isolates according to the hospital department_

Departmentn (%)
Cardiology14 (18.4)
Pulmonary infections10 (13.2)
Infectious diseases10 (13.2)
Anesthesiology  7 (9.2)
Orthopedics and traumatology  6 (7.9)
Cardiovascular surgery  5 (6.6)
General surgery  5 (6.6)
Dermatology  4 (5.3)
Neurosurgery  4 (5.3)
Brain surgery  2 (2.6)
Gastroenterology  2 (2.6)
Intensive care unit  2 (2.6)
Dialysis  1 (1.3)
Neurology  1 (1.3)
Pediatrics  1 (1.3)
Plastic surgery  1 (1.3)
Urology  1 (1.3)
Total76 (100)
DOI: https://doi.org/10.33073/pjm-2022-042 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 491 - 497
Submitted on: Jun 23, 2022
Accepted on: Aug 29, 2022
Published on: Nov 12, 2022
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2022 Tchamou M.F. Potindji, Osaid A.A. Momani, Bakare B. Omowumi, Buket Baddal, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.