Skip to main content
Have a personal or library account? Click to login
The Characteristics and Function of Internalin G in Listeria monocytogenes Cover

The Characteristics and Function of Internalin G in Listeria monocytogenes

Open Access
|Mar 2022

Figures & Tables

graphic/j_pjm-2022-009_fig_006.jpg
Table I

PCR primers used in the experiments.

PrimerSequenceProduct (bp)
ΔInlG-F1CGGGATCCGCTTATGATACAGTAGAAGAA (BamHI)633
ΔInlG-R1CCTCCGATGAAAAGCGTTCCTAAAATAGTAGGAATAATTCCCAAGATAGCTGTCACT
ΔInlG-F2ATGTTTTACTTGTAGTGACAGCTATCTTGGGAATTATTCCTACTATTTTAGGAACGC596
ΔInlG-R2GCTCTAGAAGATAATTCAAGTTCTGTTA (XbaI)
D-FTGTCCGCAACAGCTAGCCCAG1,644/3,100
D-RGCAAGTGGGGTTAAATCACTT
Hly-FGATGCATCTGCATTCAATAA1,510
Hly-RTTATTCGATTGGATTATCTAC
Fig. 1

Analysis of the recombinant protein. M – Protein marker, 1 – bacteria before the induction with IPTG, 2 – the induced bacteria, 3 – supernatant of lysed induced bacteria, 4 – precipitation of induced bacteria, 5 – purified InlG recombinant protein, 6 – uninduced bacteria reaction with positive serum, 7 – induced bacteria reaction with positive serum.

Table II

Determination of the median lethal dose of the bacteria (BACT) in mice.

BACT (CFU)Death/TotalMortality (%)
1099/1090
1088/1080
1076/1060
1064/1040
1052/1020
00/100
Fig. 2

Pathological changes in the tissue of infected mice stained with hematoxillin-eosin. a/d – Normal mouse, b/e – the mice immunized with normal saline, c/f – the mice immunized with protein and challenged with bacteria.

Fig. 3

Relative adhesion and invasion of LM and LM-ΔInlG in Caco-2 cells. This test was done in triplicate in each run and repeated for three times. The cell assay rates of LM19111 were set at 100%. * p < 0.05; ** p < 0.01.

Fig. 4

Differentially expressed genes in LM-ΔInlG compared to LM. The abscissa indicates the fold change of gene expression, and the ordinate indicates the significance of the gene difference. The red dots indicate the up-regulated genes, the green dots indicate the down-regulated genes, and the blue dots indicate the genes that are not significantly different.

Fig. 5

KEGG pathway analysis of differentially expressed genes in LM-ΔInlG compared to LM. The enriched KEGG categories are on the vertical axis. The ratio of the enriched DEGs in the KEGG category to the total genes in that category is shown on the horizontal axis.

Table III

Differentially expressed genes in related KEGG pathways in LM-ΔInlG compared to LM.

TermGene IDNameLog2FCTypeDescription
Quorum sensinglmo0205plcB1.89upphospholipase C
lmo0202hly1.77uplisteriolysin O precursor
Novel00001no1.76upthiol-activated cytolysin
Novel00002no1.64upthiol-activated cytolysin beta sandwich domain
lmo2363no–1.35downglutamate decarboxylase
lmo0447no1.66uppyridoxal-dependent decarboxylase conserved domain
Propanoate metabolismlmo1373no–1.86downtransketolase, pyrimidine binding domain
lmo1153no1.88uppropanediol dehydratase subunit alpha
lmo2720no–2.02downAMP-binding enzyme C-terminal domain
lmo1374no–1.52downbiotin-requiring enzyme
lmo1371no–1.28downpyridine nucleotide-disulphide oxidoreductase
Valine, leucine, nd isoleucine degradationlmo1373no–1.86downtransketolase, pyrimidine binding domain
lmo1374no–1.52downbiotin-requiring enzyme
lmo1371no–1.28downpyridine nucleotide-disulphide oxidoreductase
Glycerophospholipid metabolismlmo0205plcB1.89upphospholipase C
lmo1176eutC3.18upethanolamine ammonia-lyase small subunit
lmo1175eutB1.87upethanolamine ammonia-lyase large subunit
Butanoate metabolismlmo1369no–2.94downphosphate acetyl/butaryl transferase
lmo2363no–1.35downglutamate decarboxylase
lmo0447no1.66uppyridoxal-dependent decarboxylase conserved domain
DOI: https://doi.org/10.33073/pjm-2022-009 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 63 - 71
Submitted on: Nov 22, 2021
Accepted on: Feb 10, 2022
Published on: Mar 30, 2022
Published by: Polish Society of Microbiologists
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2022 Huitian Gou, Yuanyuan Liu, Wenjing Shi, Jinyu Nan, Chuan Wang, Yanan Sun, Qihang Cao, Huilin Wei, Chen Song, Changqing Tian, Yanquan Wei, Huiwen Xue, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.