Table I
Sampling sites characteristics, locations, and their corresponding geographic coordinates.
| Sites/numeration | Geographic coordinates | Location | Characteristics |
|---|---|---|---|
| Menzel Jemil, Bizerte: Site I | 37°14′19″N, 9°54′59″E | Industrial area | Waste and contamination from the textile industry and wiring throwing inside the Bizerte lagoon |
| Menzel Bourguiba, Bizerte: Site II | 37°09′N, 9°47′E | Unit manufacturing printed circuits. In the Iron factory | Contamination by HM from the iron factory in the Bizerte lagoon. Urban and agricultural pollution |
| Tinjah wedi, Bizerte: Site III | 37°10′N, 9°45′E | Near the lagoon of Bizerte | Agricultural pollution and compost contamination. |
| Beja: Site IV | 36°43′30″N, 9°10′55″E | Southwest of the city of Tunis Near the CWTP* | Urban and industrial area, the most known are wastewater and yeast factory |
| Essijoumi Lagoon: Site V | 36°45′52″N, 10°08′49″E | Contribution in the Gulf of Tunis | Lagoon receiving contamination from wastewater contamination and wastes from the capital Tunis. |
| Rades Milian River: Site VI | 36°46′N, 10°17′E | Industrial zone of Rades | High load alluvial estimated at 25 grams per liter. Receiving wastewater from two towns Rades and Ezzahra. |
| Majerda River: Site VII | 37°7′0″N, 10°13′0″E | A peninsula in far north-eastern Tunisia | Used for irrigation of the region’s agriculture |
| Lebna River: Site VIII | 36°45′N, 10°54′E | Inlet manifold sewage treatment plant | Agricultural coastal Plans can be found in the area of Cap Bon |
| Om Larayes, Gafsa: Site IX | 34°28′59″N, 8°16′01″E | The industrial platforms of phosphgyps activity | One of the known mining towns in Gafsa |
| Gulf of Gabes: Site X | 34°05′37″N, 10°26′13″E | The junction between the Eastern and Central Basin | Known by industry for the transformation of merchantable phosphate into Phosphoric Acid (H3PO4) and Chemical Fertilizers |
Table II
Primers, expected fragment size and conditions of PCR experiments used for β-lactams resistance encoding genes.
| Multiplex | Target | Primers sequences (5′–3′) | Size (pb) | Concentration (pmol/µl) | Volume (µl) | Amplification conditions |
|---|---|---|---|---|---|---|
| 1 | TEM | MultiTSO-T_F CATTTCCGTGTCGCCCTTATTC | 800 | 0.4 | 0.4 | 94°C 10 min 94°C 40 sec 60°C 40 sec 30 cycles 72°C 1 min 72°C 7 min |
| MultiTSO-T_R CGTTCATCCATAGTTGCCTGAC | 0.4 | 0.4 | ||||
| SHV | MultiTSO-S_F AGCCGCTTGAGCAAATTAAAC | 713 | 0.4 | 0.4 | ||
| MultiTSO-S_R ATCCCGCAGATAAATCACCAC | 0.4 | 0.4 | ||||
| OXA-1-like | MultiTSO-O_F GGCACCAGATTCAACTTTCAAG | 564 | 0.4 | 0.4 | ||
| MultiTSO-O_R GACCCCAAGTTTCCTGTAAGTG | 0.4 | 0.4 | ||||
| 2 | CTX-M group 1 | MultiCTXMGp1_F TTAGGAARTGTGCCGCTGTA | 688 | 0.4 | 0.4 | |
| MultiCTXMGp1_R CGATATCGTTGGTGGTCCCAT | 0.2 | 0.2 | ||||
| CTX-M group 2 | MultiCTXMGp2_F CGTTAACGGCACGATGAC | 404 | 0.2 | 0.2 | ||
| MultiCTXMGp1_R CGATATCGTTGGTGGTTCCAT | 0.2 | 0.2 | ||||
| CTX-M group 9 | MultiCTXMGp9_F TCAAGCCTGCCGATCTGGT | 561 | 0.4 | 0.4 | ||
| MultiCTXMGp9_R TGATTCTCGCCGCTGAAG | 0.4 | 0.4 | ||||
| CTX-M group 8 | CTX-Mg8/25_F AACTCCCAGACGCTCTAC | 326 | 0.4 | 0.4 | ||
| CTX-Mg8/25_R TCGAGCCGGAASGTGTAAT | 0.4 | 0.4 |
| Simplex | Target | Primers sequences (5′– 3′) | Size (pb) | Concentration (pmol/µl) | Volume (µl) | Amplification conditions |
|---|---|---|---|---|---|---|
| 1 | OXA-48 | MultiOXA-48_F GCTTGATCGCCCTCGATT | 281 | 0.4 | 0.4 | 94°C 10 min 94°C 40 sec 57°C 40 sec 30 cycles 72°C 1 min 72°C 7 min |
| MultiOXA-48_R GATTTGCTCCGTGGCCGAAA | 0.4 | 0.4 |
Table III
Primers, expected fragment size, and conditions of PCR experiments used for quinolones resistance encoding genes.
| Multiplex | Target | Sequence of primer (5′–3′) | Size (bp) | Amplification conditions |
|---|---|---|---|---|
| 3 | qnrA | qnrA_FCAGCAAGAGGATTTCTCACG | 630 | 95°C 15 min 94°C 30 sec 63°C 40 sec 30 cycles 72°C 90 sec 72°C 10 min |
| qnrA_RAATCCGGCAGCACTATTACTC | ||||
| qnrB | qnrB_FGGCTGTCAGTTCTATGATCG | 488 | ||
| qnrB_RGAGCAACGATGCCTGGTAG | ||||
| qnrC | qnrC_FGCAGAATTCAGGGGTGTGAT | 118 | ||
| qnrC_RAACTGCTCCAAAAGCTGCTC | ||||
| qnrD | qnrD_FCGAGATCAATTTACGGGGAATA | 581 | ||
| qnrD_RAACAAGCTGAAGCGCCTG | ||||
| qnrS | qnrS_FGCAAGTTCATTGAACAGGGT | 428 | ||
| qnrS_RTCTAAACCGTCGAGTTCGGCG |
Fig. 1.
Phylogenetic tree based on the partial 16S rRNA gene sequences of the 39 isolates. Ten colors used to distinguish ten different sampling sites classified from north to south of Tunisia: Dark blue: Menzel Jemil; Orange: Iron factory; Red: Tinjahwedi Bizerte; Cyan: Collector between wastewater treatment plant (CWTP) of Beja; Green: Marsh Sejoumi; Yellow: Milian Rades Wedi; Light purple: Majerda River; Pink: Lebnawedi Cap Bon; Dark purple: Om Larayes Gafsa; Grey: Golf of Gabes.
Fig. 2.
Detection by PCR of heavy metal resistance genes.
a – Amplicon of silE of Enterobacter cloacae 27 (400 bp);
b – Amplicon of cusA of Klebsiella pneumoniae 13 (410 bp);
c – Amplicon of merA of Pseudomonas putida 26 (285 bp);
M – Size Marker 1 kb Plus.
Table IV
Phenotypic and molecular characteristics of antibiotic and heavy metal resistant isolates collected from polluted water in Tunisia.
| Strains | Sites | MICs of HM (µg/ml) Ag2+ Cu2+ Hg2+ | HM resistance genes | AB resistance profile | AB resistance genes |
|---|---|---|---|---|---|
| Pseudomonas anguilliseptica 1 | MJ. Bizerte | 0.064 (R) 0.625(S) 0.08 (R) | silE, merA | AMP, ATM, FOS | blaTEM |
| Alcaligenes eutrophus 2 | MJ. Bizerte | 0.064 (R) 3 (R) 0.005 (S) | silE, cusA | AMP, CAZ | blaTEM |
| Escherichia coli. 3 | MJ. Bizerte | 0.064 (R) 6 (R) 0.0025 (S) | silE, cusA | AMP, TIC, PIP, CXM, CFM, CAZ, ATM, GMN, NET, TOB, CTX | blaTEM, blaCTX-M-1, qnrB |
| Staphylococcus aureus 4 | MJ. Bizerte | 0.064 (R) 3(R) 0.08 (R) | silE, cusA, merA | AMP, ATM, FOS, CIP, LEV | blaTEM |
| Pseudomonas mendocina 5 | IF of Bizerte MB | 0.032 (R) 3(R) 0.08 (R) | silE, cusA, merA | AMP, ATM, FOS | blaTEM |
| Alcaligenes eutrophus 6 | IF of Bizerte MB | 0.064 (R) 6(R) 0.005 (S) | silE, cusA | AMP, CAZ, SXT, CHL | blaTEM |
| Klebsiella pneumoniae 7 | IF of Bizerte MB | 0.064 (R) 3(R) 0.08 (R) | silE, cusA, merA | AMP, TIC, FOX, FEP, ETP, AMC, CAZ, IMP, SXT, CTX, FOS, CLS, NOR, CIP, GMN, AKN, NET, TOB, NFE, MNO, TET | blaTEM, blaSHV, blaCTX-M-1, blaOX48, qnrB |
| Pseudomonas putida 8 | IF of Bizerte MB | 0.064 (R) 1.5 (S) 0.005 (S) | silE | AMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOS | blaTEM |
| Alcaligenes faecalis 9 | IF of Bizerte MB | 0.064 (R) 3 (R) 0.005 (S) | silE, cusA | AMP, CAZ | blaTEM |
| Pseudomonas mendocina 10 | Tinjah wedi, Bizerte | 0.064 (R) 1.5 (S) 0.08 (R) | silE, cusA, merA | AMP, ATM, FOS | blaTEM |
| Pseudomonas mendocina 11 | Tinjah wedi, Bizerte | 0.032 (R) 3 (R) 0.005 (S) | silE, cusA | AMP, TCC, FOS | blaTEM |
| Alcaligenes faecalis 12 | Tinjah wedi, Bizerte | 0.064 (R) 3 (R) 0.005 (S) | silE, cusA | AMP, CAZ, CHL | blaTEM |
| Klebsiella pneumoniae 13 | Tinjah wedi, Bizerte | 0.032 (R) 3 (R) 0.04 (R) | silE, cusA, merA | AMP, TIC, AMC, NAL, NOR, CHL, TGC, MNO, TET | blaTEM, blaSHV |
| Pseudomonas fluorescens 14 | CWTP of Beja | 0.064 (R) 3 (R) 0.005 (S) | silE, cusA | AMP, TIC, ATM, FOS, IMP, MEM, | blaTEM |
| Pseudomonas putida 15 | CWTP of Beja | 0.064 (R) 1.5 (S) 0.08 (R) | silE, merA | AMP, TIC, TCC | blaTEM |
| Pseudomonas putida 16 | CWTP of Beja | 0.008 (S) 3 (R) 0.04 (R) | cusA, merA | AMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOS | blaTEM |
| Aeromonas salmonicida 17 | Marsh Sejoumi | 0.032 (R) 1.5 (S) 0.08 (R) | silE, merA | AMP, TIC | blaTEM |
| Alcaligenes eutrophus 18 | Marsh Sejoumi | 0.008 (S) 0.625 (S) 0.08 (R) | merA | AMP, CAZ | blaTEM |
| Pseudomonas alcaligenes 19 | Marsh Sejoumi | 0.0064(R) 3 (R) 0.08 (R) | silE, cusA, merA | AMP, TIC, PIP, TCC, FOS | blaTEM |
| Enterobacter cloacae 20 | Marsh Sejoumi | 0.064 (R) 6 (R) 0.08 (R) | silE, cusA, merA | AMP, TIC, FOX, AMC, CTX | blaTEM, blaOXA-1, blaSHV, blaCTX-M-9 |
| Bacillus coagulans 21 | Milian Rades Wedi | 0.064 (R) 3 (R) 0.02 (R) | silE, cusA, merA | AMP, TIC, TCC, PIP, FEP, CAZ, ATM, FOS | blaTEM |
| Alcaligenes eutrophus 22 | Milian Rades Wedi | 0.064 (R) 0.625 (S) 0.08 (R) | silE, merA | AMP, CAZ, SXT, CHL | blaTEM |
| Pseudomonas putida 23 | Milian Rades Wedi | 0.004 (S) 0.625 (S) 0.005 (S) | – | AMP, ATM, FOS | blaTEM, blaSHV |
| Alcaligenes eutrophus 24 | Majerda River | 0.064 (R) 1.5 (S) 0.005 (S) | silE | AMP, CAZ | blaTEM |
| Serratia marcescens 25 | Majerda River | 0.064 (R) 1.5 (S) 0.02 (R) | silE, merA | AMP, TIC, FOX, AMC | blaTEM, blaOXA-1, blaSHV |
| Pseudomonas putida 26 | Majerda River | 0.032 (R) 0.75 (S) 0.02 (R) | silE, merA | AMP, FOS, ATM, LEV | blaTEM |
| Enterobacter cloacae 27 | Lebna wedi C.B | 0.064 (R) 3 (R) 0.005 (S) | silE, cusA | AMP, TIC, FOX, AMC, TGC, MNO, TET | blaTEM, blaOXA-1 |
| Serratia fonticola 28 | Lebna wedi C.B | 0.064 (R) 1.5 (S) 0.005 (S) | silE | AMP, TIC, AMC, CTX, CLS | blaTEM, blaCTX-M-9 |
| Alcaligenes faecalis 29 | Lebna wedi C.B | 0.032 (R) 3 (R) 0.005 (S) | silE, cusA | AMP, CAZ | blaTEM |
| Klebsiella pneumoniae 30 | Lebna wedi C.B | 0.064 (R) 6 (R) 0.005 (S) | silE, cusA | AMP, TIC, AMC | blaTEM, blaSHV |
| Pseudomonas fluorescens 31 | Om Larayes, Gafsa | 0.064 (R) 3 (R) 0.08 (R) | silE, cusA, merA | AMP, TIC, TCC, PIP, FEP, ATM, IMP, MEM, FOS | blaTEM |
| Aeromonas salmonicida 32 | Om Larayes, Gafsa | 0.064 (R) 0.625(S) 0.005 (S) | silE | AMP | blaTEM |
| Aeromonas salmonicida 33 | Om Larayes, Gafsa | 0.064 (R) 1.5 (S) 0.08 (R) | silE, merA | AMP, TIC, FEP, CAZ, ATM | blaTEM |
| Pseudomonas putida 34 | Om Larayes, Gafsa | 0.032 (R) 1.5 (S) 0.08 (R) | silE, merA | AMP, TIC, TCC, PIP, TZP, CAZ, ATM | blaTEM |
| Pseudomonas fluorescens 35 | Om Larayes, Gafsa | 0.0064 (R) 0.75 (S) 0.005 (S) | silE | AMP, TIC, TCC, ATM, MEM | blaTEM |
| Pseudomonas putida 36 | Gulf of Gabes | 0.064 (R) 3 (R) 0.008 (S) | silE, cusA | AMP, TIC, TCC, PIP, TZP, ATM, MEM | blaTEM |
| Serratia marcescens 37 | Gulf of Gabes | 0.064 (R) 1.5 (S) 0.005 (S) | silE | AMP, FOX, AMC, TGC, MNO, TET | blaTEM |
| Pseudomonas fluorescens 38 | Gulf of Gabes | 0.0064 (R) 6 (R) 0.08 (R) | silE, cusA, merA | AMP, TIC, TCC, PIP, TZP, FEP, CAZ, ATM, MEM, LEV, FOS | blaTEM |
| Klebsiella pneumoniae 39 | Gulf of Gabes | 0.032 (R) 3 (R) 0.0025 (S) | silE, cusA | AMP, TIC, TCC, PIP, CFN, CXM, CFM, CAZ, FEP, ATM, GMN, NET, TOB | blaSHV, blaCTX-M-1, qnrB |
2 AKN – Amikacin; AMC – Amoxicillin-Clavulanic acid; ATM – Aztreonam; CAZ – Ceftazidim; CFM – Cefixim; CFN – Cefalexin; CHL – Chlorampenicol; CIP – Ciprofloxacin; CLS – Colistin; CTX – Cefotaxim; CXM – Cefuroxim; ETP – Ertapenem; FEP – Cefepim; FOS – Fosfomicin; FOX – Cefoxitin; GMN – Gentamicin; IMP – Imipenem; LEV – Levofloxacin; MEP – Meropenem; MNO – Minocyclin; NAL – Nalidixic acid; NET – Netilmecin; NMN – Neomycin; PIP – Piperacillin; SXT – Trimethoprim-Sulfamethoxazole; TCC – Ticarcillin-Clavulanic acid; TET – Tetracycline; TGC – Tigecyclin; TIC – Ticarcillin; TOB – Tobramycin; TZP – Piperacillin-Tazobactam; silE – silver-binding protein; merA – mercury II reductase; cusA – cation efflux system protein CusA
Fig. 3.
Sequence alignment of the partial SilE protein from 39 isolates with SilE from pMG101 (SilE AAD11743). Letters shows res idues different from the consensus. Conserved histidine and methionine residues are marked above with either a circle or a square, respectively.
Fig. 4.
Sequence alignment of the partial Cation efflux system protein CusA from 10 isolates with E. coli P30854. Different residues from the consensus are showed by one letter. Conserved residues are represented by points.
Fig. 5.
Sequence alignment of the partial mercuric reductase protein MerA from 8 isolates with E. cloacae (MerA EU081910). Different residues from the consensus are showed by one letter. Conserved residues are represented by points.