Have a personal or library account? Click to login
N-acetylcysteine (NAC) Attenuating Apoptosis and Autophagy in RAW264.7 Cells in Response to Incubation with Mycolic Acid from Bovine Mycobacterium tuberculosis Complex Cover

N-acetylcysteine (NAC) Attenuating Apoptosis and Autophagy in RAW264.7 Cells in Response to Incubation with Mycolic Acid from Bovine Mycobacterium tuberculosis Complex

Open Access
|Jun 2020

Figures & Tables

Fig. 1.

Effect of NAC on the viability and cytokine levels of RAW264.7 cells during incubation with MA. (A) Different groups of RAW264.7 cells were treated with MA (50 μg/ml) for 6, 12, 24, and 36 h and then analyzed for viability with MTT. Changes in the optical density (OD) values at 560 nm were recorded with a microplate reader. (B) The cell culture supernatants were collected after 24 h in the MA group and NAC + MA group; the levels of secreted cytokines in the samples were quantified. The graphical representation shows the relative concentration of the secreted IL-6. (Mean ± standard deviation, n = 3 experiments, *p < 0.05, **p < 0.01, ***p < 0.001 by Student’s t-test).

Fig. 2.

Effects of NAC on apoptosis-related factors in RAW264.7 cells during incubation with MA. The MA group was treated with MA (50 μg/ml) for 24 h. MA + NAC group was pre-treated with NAC at a concentration of 600 mg/ml for 2 h before treatment with MA. The results are representative of three separate experiments. (A) Representative Western blot of BAX in RAW264.7 treated with MA or MA + NAC (n = 3 experiments, *p < 0.05, **p < 0.01 by image J). (B) Quantification of BAX levels, as represented in A it was quantified by densitometry and standardized to the β-actin level. (C, D) The levels of TNF-α and Casp9 mRNA was standardized by the double delta CT method. (Mean ± standard deviation, n = 3 experiments, *p < 0.05, **p < 0.01 by Student’s t-test).

Fig. 3.

Effects of NAC on autophagy-related factors in RAW264.7 cells during incubation with MA. The MA group was treated with MA (50 μg/ml) for 24 h. MA + NAC group was pre-treated with NAC at a concentration of 600 mg/ml for 2 h before treatment with MA. (A) Representative Western blot of beclin-1 and LC3 in RAW264.7 macrophages treated with MA or MA + NAC (n = 3 experiments). (B, C) Quantification of beclin-1(b) and LC3(c) levels, as represented in A. (D, E) The levels of mTOR and AMPK mRNA was quantified by densitometry, and standardized to the β-actin level. (Mean ± standard deviation, n = 3 experiments, *p < 0.05, **p < 0.01 by Student’s t-test).

Fig. 4.

Morphological changes in the lung tissue (H&E staining) in ICR mice treated with MA and induced by NAC. Representative photomicrographs illustrated characteristic lesions in 8 week-old C57BL/6 mice. The lung tissues, which had not been lavaged, were fixed with 4% paraformaldehyde solution and routinely processed for pathological slices. The morphological change of the lung tissue was observed after H&E staining. (A) The control group. (B) The NAC group. (C) The MA group. (D) The MA + NAC group. (Scale bar 50 μm).

Primer sequences_

Gene nameForward primerReverse primer
TNF-αCGCTGAGGTCAATCTGCGGCTGGGTAGAGAATGGA
Caspase-9AGCGATTCTGCCTTTCACTGGAGATTTTGTGGTCAGC
mTORCTGGGGCTGCTTTCTGTACGGTTTTCTGCCTCTTGT
AMPKCATCCCCAAACCTGTCCACAAGCCCCGAACAAAA
DOI: https://doi.org/10.33073/pjm-2020-026 | Journal eISSN: 2544-4646 | Journal ISSN: 1733-1331
Language: English
Page range: 223 - 229
Submitted on: Mar 17, 2020
|
Accepted on: May 10, 2020
|
Published on: Jun 4, 2020
In partnership with: Paradigm Publishing Services
Publication frequency: 4 issues per year

© 2020 XUE LIN, MENGMENG WEI, FUYANG SONG, DI XUE, YUJIONG WANG, published by Polish Society of Microbiologists
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.